Search

High-throughput sequencing (HTS) and sequence mining tools revolutionized virus detection and discovery in recent years and implementing them with classical plant virology techniques results to a powerful approach to characterize viruses. An example of a virus discovered through HTS is Solanum nigrum ilarvirus 1 (SnIV1) (familyBromoviridae), which was recently reported in various solanaceous plants from France, Slovenia, Greece, and South Africa. It was likewise detected in grapevines (Vitaceae) and severalFabaceaeandRosaceaeplant species. Such a very diverse host association is atypical for ilarviruses, thus warranted further investigation. In this study, modern and classical virological tools were combined to accelerate the characterization of SnIV1. Through HTS-based virome surveys, mining of sequence read archive datasets, and literature search, SnIV1 was further identified from diverse plant and non-plant sources globally. SnIV1 isolates showed relatively low variability compared to other phylogenetically related ilarviruses. Phylogenetic analyses showed a distinct basal clade of isolates from Europe, while the rest formed clades of mixed geographic origin. Furthermore, systemic infection of SnIV1 inSolanum villosumand its mechanical and graft transmissibility to solanaceous species were demonstrated. Near identical SnIV1 genomes from the inoculum (S. villosum) and inoculatedNicotiana benthamianawere sequenced, thus partially fulfilling Koch’s postulates. SnIV1 was shown to be seed-transmitted and potentially pollen-borne, has spherical virions, and possibly induces histopathological changes in infectedN. benthamianaleaf tissues. Overall, this study provided information to better understand the diversity, distribution, and pathobiology of SnIV1, but whether it could emerge as a destructive pathogen remains uncertain.FundingEU Horizon 2020 Marie Skłodowska-Curie Actions Innovative Training Network (H2020 MSCA-ITN) project no. GA 813542Administration of the Republic of Slovenia for Food Safety, Veterinary Sector and Plant Protection and Slovenian Research Agency (ARRS) funding no. P4-0165, P4-0407, J4-4553Balik Scientist Program (Republic Act 11035) of the Department of Science and Technology– Philippine Council for Agriculture, Aquatic, and Natural Resources Research and Development (DOST–PCAARRD), Republic of the PhilippinesThe Belgian FPS Health Food Chain Safety and Environment under Project RT18/3 SEVIPLANT

Dioscorea mosaic associated virus (DMaV) is a member of the genus Sadwavirus, family Secoviridae, that is associated with mosaic symptoms in Dioscorea rotundata in Brazil. The genome of a DMaV isolate detected in D. trifida in Guadeloupe was sequenced by high-throughput sequencing. Using an RT-PCR-based detection assay, we found that DMaV infects D. alata, D. bulbifera, D. cayenensis-rotundata, D. esculenta, and D. trifida accessions conserved in Guadeloupe and Côte d'Ivoire and displays a very high level of molecular diversity in a relatively small region of the genome targeted by the assay. We also provide evidence that DMaV is also present in D. rotundata in Benin and in D. alata in Nigeria.

International audience; A novel geminivirus was identified in France and Spain in asymptomatic plants of white clover (Trifolium repens) and shrub medick (Medicago arborea). Its genome has the hallmarks of a capulavirus, and its relationship to other capulaviruses was confirmed by phylogenetic analysis. White clover isolates formed a tight cluster in the phylogenetic tree, while shrub medick isolates formed two distinct, more divergent groups with sequence identity values close to the species cutoff. These three groups have likely participated in recombination events involving alfalfa leaf curl virus and French bean severe leaf curl virus. The name "trifolium virus 1" (TrV1) is proposed for this new Capulavirus. Three TrV1 genotypes (TrV1-A, TrV1-B, and TrV1-C) were clearly distinguished.

International audience; An emerging systemic necrosis disease of corn salad was first observed in the Nantes region of France in the late 2000’s. Classical virology and high-throughput sequencing approaches demonstrated that the disease is associated with four different necroviruses, tobacco necrosis virus A (TNVA), tobacco necrosis virus D (TNVD), olive mild mosaic virus (OMMV) and a novel recombinant Alphanecrovirus for which the name corn salad necrosis virus (CSNV) is proposed. Satellite tobacco necrosis virus (STNV) was also frequently observed. Koch’s postulates were completed for all four agents, each one alone being able to cause systemic necrosis of varying severity in corn salad. OMMV was the most frequently observed virus and causes the most severe symptoms. TNVA was the second, both in terms of prevalence and symptom severity while TNVD and CSNV were only rarely observed and cause the less severe symptoms. The emergence of this systemic disease may have been favoured by the short and repeated cropping cycles used for corn salad, possibly allowing the selection of necrovirus isolates with an improved ability to systemically invade this specialty crop.

UMR BFP - Equipe Virologie; International audience; Double-stranded RNAs purified from cultivated (Lactuca sativa) or wild (L. serriola) lettuce from southwest France were analyzed by high-throughput sequencing. For both samples, BLAST annotation revealed contigs with homology to Betaflexiviridae family members. The full genome sequence of the isolate from cultivated lettuce (JG1) was completed (8,536 nucleotides [nt], excluding the poly(A) tail). The sequence of the 3' half of the genome (4,800 nt) of a wild lettuce isolate (P22) was determined and found to share 95.1% nt sequence identity with the JG1 isolate. The JG1 genome contains four open reading frames, encoding a replicase, a movement protein, a capsid protein, and a protein of unknown function, respectively. Based on genome organization and phylogenetic relationships, the lettuce virus is most closely related to the recently described carrot chordoviruses 1 and 2 in the family Betaflexiviridae. Considering the species demarcation criteria in this family, the two lettuce viruses represent isolates of a new chordovirus species for which the name "lettuce chordovirus 1" (LeCV1) is proposed.

Metagenomic studies have indicated that the diversity of plant viruses was until recently far underestimated. As important components of ecosystems, there is a need to explore the diversity and richness of the viruses associated with plant populations and to understand the drivers shaping their diversity in space and time. Two viral sequence enrichment approaches, double-stranded RNA (dsRNA) and virion-associated nucleic acids (VANA), have been used and compared here for the description of the virome of complex plant pools representative of the most prevalent plant species in unmanaged and cultivated ecosystems. A novel bioinformatics strategy was used to assess viral richness not only at the family level but also by determining operational taxonomic units (OTU) following the clustering of conserved viral domains. A large viral diversity dominated by novel dsRNA viruses was detected in all sites, while a large between-site variability limited the ability to draw a clear conclusion on the impact of cultivation. A trend for a higher diversity of dsRNA viruses was nevertheless detected in unmanaged sites (118 versus 77 unique OTUs). The dsRNA-based approach consistently revealed a broader and more comprehensive diversity for RNA viruses than the VANA approach, whatever the assessment criterion. In addition, dissimilarity analyses indicated both approaches to be largely reproducible but not necessarily convergent. These findings illustrate features of phytoviromes in various ecosystems and a novel strategy for precise virus richness estimation. These results allow us to reason methodological choices in phytovirome studies and likely in other virome studies where RNA viruses are the focal taxa. IMPORTANCE There are today significant knowledge gaps on phytovirus populations and on the drivers impacting them but also on the comparative performance-methodological approaches for their study. We used and compared two viral sequence enrichment approaches, double-stranded RNAs (dsRNA) and virion-associated nucleic acids (VANA), for phytovirome description in complex pools representative of the most prevalent plant species in unmanaged and cultivated ecosystems. Viral richness was assessed by determining operational taxonomic units (OTU) following the clustering of conserved viral domains. There is some limited evidence of an impact of cultivation on viral populations. These results provide data allowing us to reason the methodological choices in virome studies. For researchers primarily interested in RNA viruses, the dsRNA approach is recommended because it consistently provided a more comprehensive description of the analyzed phytoviromes, but it understandably underrepresented DNA viruses and bacteriophages.

High-throughput sequencing (HTS), combined with bioinformatics forde novodiscovery and assembly of plant virus or viroid genome reads, has promoted the discovery of abundant novel DNA and RNA viruses and viroids. However, the elucidation of a viral population in a single plant is rarely reported. In five birch trees of German and Finnish origin exhibiting symptoms of birch leaf-roll disease (BRLD), we identified in total five viruses, among which three are novel. The number of identified virus variants in each transcriptome ranged from one to five. The novel species are genetically - fully or partially - characterized, they belong to the generaCarlavirus, IdaeovirusandCapillovirusand they are tentatively namedbirch carlavirus,birch idaeovirus, andbirch capillovirus, respectively. The only virus systematically detected by HTS in symptomatic trees affected by the BRLD was the recently discovered birch leafroll-associated virus. The role of the new carlavirus in BLRD etiology seems at best weak, as it was detected only in one of three symptomatic trees. Continuing studies have to clarify the impact of the carlavirus to the BLRD. The role of theCapillovirusand theIdaeoviruswithin the BLRD complex and whether they influence plant vitality need to be investigated. Our study reveals the viral population in single birch trees and provides a comprehensive overview for the diversities of the viral communities they harbor.

Cherry virus A (CVA) is a member of the Capillovirus genus (2). It was discovered serendipitously during cloning of the little cherry agent (2) and has since been shown to be relatively widespread in sweet and sour cherry (Prunus cerasus and P. avium) (2,3). It is currently unclear whether CVA is associated with any specific symptoms in these hosts. Although it can be transmitted by grafting and thus propagated in peach, it has not been reported to naturally infect any host other than cherry. Using a degenerate reverse transcription-polymerase chain reaction (RT-PCR) technique targeting a conserved region of the RNA-dependent RNA polymerase (RdRp) and allowing the amplification of members of the Trichovirus, Capillovirus, and Foveavirus genera of filamentous plant viruses (1), a number of symptomatic Prunus spp. germplasm were evaluated. Among these, a cv. Mirabelle dorée accession (Prunus domestica var. insititia P332) of French origin exhibited severe symptoms of rosetting, severe leaf and fruit deformation, and yellow mosaic occasionally turning necrotic. RT-PCR conducted on symptomatic samples produced an amplification product of the expected size (362 bp) in several independent experiments. Sequencing of these products yielded a single sequence (GenBank Accession No. AY792509) with 88.1% nucleotide identity and 93.2% amino acid identity with the type strain of CVA (2). Presence of a CVA isolate was independently confirmed using a CVA-specific PCR assay directly on the original plum material or following experimental transmission by grafting on several new hosts including apricot (P. armeniaca cv. Priana) and plum (P. domestica cv. Prune d'Ente). To our knowledge, this is the first report of natural infection of CVA in plum. The symptoms observed in the infected plum are reminiscent of those caused by severe Prune dwarf virus (PDV) strains. Infection by PDV was confirmed using a PDV-specific PCR assay. The contribution, if any, of CVA to the symptoms observed remains to be evaluated. These findings suggest that the possible presence of CVA in noncherry Prunus spp. hosts should be taken into consideration by quarantine and certification programs. References: (1) X. Foissac et al. Acta Hortic. 550:3743, 2001. (2) W. Jelkmann. J. Gen. Virol. 76:2015, 1995. (3) M. J. Kirby et al. Plant Pathol. 50:6, 2001.

The potyvirus Lettuce mosaic virus (LMV) is a common pathogen of lettuce crops worldwide, but it also infects other Asteraceae spp. including ornamentals (2,3,4). Cape daisies (Osteospermum sp.) are widely grown perennial ornamentals reported to be natural hosts of LMV (2,4), which causes faint leaf mosaic and sometimes mild flower breaking. A preliminary observation of mosaic symptoms prompted a large-scale survey during the spring of 2005 in Cape daisies grown in the Tunis metropolitan area and the south of Tunisia (Djerba, Medenine). Two hundred seventy-one samples (Tunis: 14 sites, 219 samples; South: 9 sites, 52 samples) were randomly collected from nurseries, roadway plantings, and home gardens and analyzed. Ninety-three samples (Tunis: 40%, South: 12%; overall: 34%) showed distinct mosaic symptoms. LMV infection was verified by immuno-tissue printing on all collected samples (1), providing evidence for even higher infection levels (Tunis: 60%; South: 25%; overall: 56%). This technique, therefore, allowed the detection of symptomless infection in a significant proportion of samples. It should however, be stressed that symptoms can be very difficult to observe in water-stressed plants, a situation frequently observed in Tunisia. Subsequent PCR analysis with LMV-specific primers (1) of a subset of 24 symptomatic and tissue-print-positive samples confirmed LMV infection in all cases. This is to our knowledge, the first report of LMV infection in Cape daisies in Tunisia. The very high rate of infection observed suggests that these popular ornamentals might constitute a reservoir of LMV as previously reported in the United States (4). References: (1) H. Fakhfakh et al. J. Plant Pathol. 83:3, 2001. (2) R. Jordan and M. Guaragna. (Abstr.) Phytopathology 96(suppl.):S56, 2006. (3) O. Le Gall. No. 399 in: Description of Plant Viruses. A. T. Jones et al., eds. CMI/AAB, Kew, Surrey, UK, 2003. (4) D. C. Opgenorth et al. Plant Dis. 75:751, 1991.

Natural infections of Cherry virus A (CVA) have been reported in sweet (Prunus avium) and sour cherry (P. cerasus) from a number of European countries, North America, and Japan. CVA has been detected occasionally in other Prunus hosts such as peach, plum, and apricot (1). In the spring of 2007, samples from four Japanese apricot (Prunus mume) trees from the Jiangsu Province of China were analyzed by a polyvalent reverse transcriptase-PCR assay that amplifies a short region of the polymerase gene of viruses from several genera in the family Flexiviridae (2). Sequencing of the amplified products identified CVA in three samples. Two isolates (GenBank Accession Nos. EU730949 and EU730950) were closely related and highly homologous (97.5 to 99.3% identity) to noncherry isolates of CVA (GenBank Accession Nos AY792509 and DQ445275 to DQ445292). The third isolate (GenBank Accession No. EU730951) was approximately 90% identical to the other P. mume isolates and showed the highest identity (92.3%) to a cherry isolate (GenBank Accession No AF413923). CVA infection of the P. mume samples was confirmed by two CVA-specific primer pairs targeting genomic regions corresponding to the movement or coat protein genes. Since the samples showed mixed infections with Plum pox virus (PPV) or Asian Prunus virus 1 (APV1), potential CVA symptomatology could not be evaluated. To our knowledge, these results are the first identification of CVA in China and in P. mume, extending the geographical distribution and natural host range of this virus. Additional work is needed to evaluate whether CVA poses a threat to P. mume production or whether, as in other identified hosts, CVA is largely latent. References: (1) M. Barone et al. Plant Dis. 90:1459, 2006. (2) X. Foissac et al. Phytopathology 95:617, 2005.

UMR BFP - Equipe Virologie; International audience

UMR BFP - Equipe Virologie; International audience; As part of a grapevine metagenome study, total RNA extracted from grapevine phloem scrapings was analyzed by Illumina sequencing. For one 420A rootstock sample, reads mapping against a reference database and BLAST annotation of contigs identified the presence of a divergent isolate of Botrytis virus F (BVF). The full genome sequence of this isolate (IVC-5-77) was determined (6,828 nucleotides [nt], excluding the poly(A) tail) and shown to be collinear with that of the BVF reference isolate, with the two open reading frames encoding a replication-associated protein (REP) and a coat protein (CP). The IVC-5-77 isolate, however, is very divergent, showing only 81.3-81.6% nucleotide sequence identity to the two other sequenced BVF isolates. The internal non-coding region was also found to be highly variable between BVF isolates. Analysis of the RNASeq reads demonstrated that close to 20% of them belong to Botrytis cinerea, the putative host of the IVC-5-77 isolate. These results extend our knowledge of the diversity and variability of BVF and demonstrate its detectability, together with that of its B. cinerea host, in total RNA RNASeq data from grapevine phloem scrapings.

UMR BFP - Equipe Virologie; International audience; Little cherry virus 1 (LChV1, Velarivirus, Closteroviridae) is a widespread pathogen of sweet or sour cherry and other Prunus species, which exhibits high genetic diversity and lacks a putative efficient transmission vector. Thus far, four distinct phylogenetic clusters of LChV1 have been described, including isolates from different Prunus species. The recent application of high throughput sequencing (HTS) technologies in fruit tree virology has facilitated the acquisition of new viral genomes and the study of virus diversity. In the present work, several new LChV1 isolates from different countries were fully sequenced using different HTS approaches. Our results reveal the presence of further genetic diversity within the LChV1 species. Interestingly, mixed infections of the same sweet cherry tree with different LChV1 variants were identified for the first time. Taken together, the high intra-host and intra-species diversities of LChV1 might affect its pathogenicity and have clear implications for its accurate diagnostics.

International audience; Complete genomic sequences of Artichoke latent virus (ArLV) have been obtained by classical or high-throughput sequencing for an ArLV isolate from Italy (ITBr05) and for two isolates from France (FR37 and FR50). The genome is 8,278 to 8,291 nucleotides long and has a genomic organization comparable with that of Chinese yam necrotic mosaic virus (CYNMV), the only macluravirus fully sequenced to date. The cleavage sites of the viral polyprotein have been tentatively identified by comparison with CYNMV, confirming that macluraviruses are characterized by the absence of a P1 protein, a shorter and N-terminally truncated coat protein (CP). Sequence comparisons firmly place ArLV within the genus Macluravirus, and confirm previous results suggesting that Ranunculus latent virus (RALV), a previously described Macluravirus sp., is very closely related to ArLV. Serological relationships and comparisons of the CP gene and of the partial RaLV sequence available all indicate that RaLV should not be considered as a distinct species but as a strain of ArLV. The results obtained also suggest that the spectrum of currently used ArLV-specific molecular hybridization or polymerase chain reaction detection assays should be improved to cover all isolates and strains in the ArLV species.

UMR BFP - Equipe Virologie; First Report of [i]Carrot torradovirus 1[/i] (CaTV1), a Member of the [i]Torradovirus[/i] Genus, Infecting Carrots in France

UMR BFP - Equipe Virologie; Des symptômes inédits affectent la production de mâche nantaise. Leur cause n'a pas été facile à déterminer. Récit d'une enquête.

Potato virus Y (PVY) is one of the rare members of the genus Potyvirus for which the genetic diversity is structured by the plant species of origin. This structure has been explained by the occurrence in some crop species of barriers to infection by PVY isolates originating from other plant species. A particularly strong barrier to infection has been shown between PVY isolates from pepper (Capsicum spp.) and potato (Solanum tuberosum). PVY isolates from potato belong mainly to clades N and O and are poorly or not infectious at all in pepper. By contrast, PVY isolates from pepper belong mainly to clade C1 and are poorly or not infectious at all in potato. Recent surveys and genetic analyses, however, have revealed that PVY isolates of clades N and/or O can be quite frequent in pepper crops. Conversely, PVY isolates of clade C1 are almost absent in potato crops. However, we showed that PVY isolates of clade C1 from pepper are infectious in a potato cultivar devoid of the resistance gene Nc tbr . It has also been shown that, among pepper, tomato and tobacco genotypes carrying eIF4E-mediated recessive resistances, PVY evolution in one crop species could favour its future adaptation to other species. Altogether, these results suggest a lack of strong barriers to PVY host change between solanaceous crops. The contrast with older studies could be due to a range of factors, including an insufficient sampling effort in previous studies (too few isolates collected and characterised, too few plant genotypes assayed), to recent changes among PVY populations and/or to the contrasted behaviour of different genotypes within a plant species upon PVY inoculation.

An isolate of Lettuce mosaic virus (LMV, a Potyvirus) infecting Madagascar periwinckle (Catharanthus roseus) was identified and characterized by Illumina deep sequencing. LMV-Cr has no close affinities to previously sequenced LMV isolates and represents a novel, divergent LMV clade. Inoculation experiments with other representative LMV isolates showed that they are unable to infect C. roseus, which was not known to be a host for LMV. However, three C. roseus variants of one of these isolates, LMV-AF199, could be selected and partially or completely sequenced. These variants are characterized by the accumulation of mutations affecting the C-terminal part of the cylindrical inclusion (CI) helicase and the central part of the VPg. In particular, a serine to proline mutation at amino acid 143 of the VPg was observed in all three independently selected variants and is also present in the LMV-Cr isolate, making it a prime candidate as a host-range determinant. Other mutations at VPg positions 65 and 144 could also contribute to the ability to infect C. roseus. Inoculation experiments involving a recombinant LMV expressing a permissive lettuce eukaryotic translation initiation factor 4E (eIF4E) suggest that eIF4E does not contribute to the interaction of most LMV isolates with C. roseus.

Equipe Virologie végétale; First Report of Little cherry virus 1 on Plum in France

The complete nucleotide sequence of a French isolate of Maize rough dwarf virus (MRDV) was determined by next-generation sequencing and compared with the single available complete sequence and with the partial sequences of two additional isolates available in online databases.

The variability of Cherry capillovirus A (CVA) was analysed using a short, 275-bp region of the viral RNA-dependent RNA polymerase gene amplified by a polyvalent RT-PCR assay. As for other members of the family Betaflexiviridae, CVA appears to show significant diversity, with an average pairwise nucleotide divergence of 9·4% between isolates in the analysed region. Phylogenetic analyses provide evidence for the existence of at least five clusters of CVA isolates, one of which is associated with noncherry hosts of the virus, providing evidence that transmission of CVA isolates between cherry and noncherry hosts is probably rare. Comparison of existing detection techniques using a panel of CVA isolates representative of the various phylogenetic groups indicated that dot-blot hybridization assays show high polyvalence but may lack the sensitivity to detect CVA in some samples. On the other hand, available detection primers failed to amplify a wide range of CVA isolates. Partial genome sequencing of two divergent isolates allowed the identification of conserved genomic regions and the design of new primer pairs with improved polyvalence. These new primer pairs were used to develop PCR assays allowing the reliable detection of CVA isolates belonging to all phylogenetic clusters.

Publication Inra prise en compte dans l'analyse bibliométrique des publications scientifiques mondiales sur les Fruits, les Légumes et la Pomme de terre. Période 2000-2012. http://prodinra.inra.fr/record/256699; International audience; Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

International audience

International audience

International audience

We previously showed that allelic genes mo11 and mo12 used to protect lettuce crops against Lettuce mosaic virus (LMV) correspond to mutant alleles of the gene encoding the eukaryotic translation initiation factor 4E. LMV resistance-breaking determinants map not only to the main potyvirus virulence determinant, a genome-linked viral protein, but also to the C-terminal region of the cylindrical inclusion (CI), with a key role of amino acid at position 621. Here, we show that the propagation of several non-lettuce isolates of LMV in mo11 plants is accompanied by a gain of virulence correlated with the presence in the CI C terminus of a serine at position 617 and the accumulation of mutations at positions 602 or 627. Whole-genome sequencing of native and evolved isolates showed that no other mutation could be associated with adaptation to mo1 resistance. Site-directed mutagenesis pinpointed the key role in the virulence of the combination of mutations at positions 602 and 617, in addition to position 621. The impact of these mutations on the fitness of the virus was evaluated, suggesting that the durability of mo1 resistance in the field relies on the fitness cost associated with the resistance-breaking mutations, the nature of the mutations, and their potential antagonistic effects.

International audience; The genome of yam virus X (YVX), a new member of the genus Potexvirus from yam (Dioscorea trifida), was completely sequenced. Structural and phylogenetic analysis showed that the closest relative of YVX is nerine virus X. A prevalence study found YVX only in plants maintained in Guadeloupe and showed that it also infects members of the complex D. cayenensis rotundata. This study provides evidence for the existence of two additional potexviruses, one of which infects D. nummularia in Vanuatu and the other, D. bulbifera and D. rotundata in Haiti and D. trifida and D. rotundata in Guadeloupe. This work also shows that existing potexvirus-specific degenerate primers targeting the ORF1-encoded polymerase domain are well suited for the identification of the three potexviruses reported here.

The purpose of this study was to investigate the aetiology of two degenerative diseases of peach originally transmitted by graft-inoculation from apricot, the peach asteroid spot and the peach sooty ringspot diseases previously characterised at the Ctifl center of Lanxade by J.C. Desvignes and colleagues. Two isolates, named respectively LA2 for the peach asteroid spot disease and Caserta-12 for the peach sooty ringspot disease, were propagated on GF305 peach seedlings and on Nicotiana occidentalis and assessed for the presence of dsRNAs. Double stranded RNAs could be purified from plants infected with either of these isolates, and were submitted to SMARTTM long distance RT-PCR (LD-PCR). For LA2 a polyadenylated, 1151 bp long cDNA was cloned and sequenced. For isolate Caserta-12 an approximately 4 kbp polyadenylated cDNA was cloned and partially sequenced. These cDNAs encode the last 327 amino acids of the LA2 coat protein and the last 202 amino acids of the Caserta-12 coat protein. The partial coding sequences thus obtained revealed respectively 96% and 97% identity with the sequence encoding the coat protein of Apricot latent virus (ALV), a Foveavirus serologically related to ASPV. Close relatedness between ALV and the agents present in the LA2 and Caserta 12 isolates was also demonstrated by hybridisation of total RNA extracts of GF305 seedlings graft-inoculated with ALV, LA2 and Caserta-12 with ALV or LA2-specific cRNA probes. Polyvalent nested RT-PCR allowed us to amplify a 362 bp cDNA encoding part of the RNA dependent RNA polymerase of these three agents from silica-captured nucleic acid extracts of infected N. occidentalis and GF305 peach. The sequencing of these amplicons confirmed the close relationship of this three members of the Foveavirus genus.

International audience

Sorbitol is a sugar alcohol, present with sucrose in Rosaceae trees, which seems to have a role in plant response to environmental stress. The aim of this study was to investigate variability in sorbitol : sucrose ratio in source leaves of 53 species or hybrids of Prunus. The studied taxa, representing three subgenera and 11 sections of the Prunus genus, were chosen from the Prunus collection at the Institut National de la Recherche Agronomique, Bordeaux, France. Young mature leaves were sampled on three dates in spring and summer and were analyzed for neutral soluble sugars using high-performance liquid chromatography. There were differences in sorbitol : sucrose ratio according to sampling date and according to taxon. Sorbitol content increased and sucrose content decreased from May to July, leading to an increase in sorbitol : sucrose ratio. For each date, there was a high variability within botanical sections for sorbitol : sucrose ratio. The highest variability between species for sorbitol : sucrose ratio was in July, with P. cocomilia having the lowest ratio (1.15, w/w) and P. fremontii having the highest ratio (5.59, w/w). When species were pooled according to their geographical zone of origin, species originating from Japan showed the lowest sorbitol : sucrose ratio for all sampling dates. In July, species originating from Japan, Europe, and central to western North America had sorbitol : sucrose ratio significantly lower than that of species originating from Europe to western Asia, China to eastern Asia, and central to eastern North America. These results indicate that variability in sorbitol : sucrose ratio exists in the Prunus germplasm and seems to be related to the geographical origin of the species. Moreover, variability in sorbitol to sucrose ratio is high in the germplasm of different Prunus taxa.

International audience

International audience; A systematic search for viral infection was performed in the isolated Kerguelen Islands, using a range of polyvalent genus-specific PCR assays. Barley yellow dwarf virus (BYDV) was detected in both introduced and native grasses such as Poa cookii. The geographical distribution of BYDV and its prevalence in P. cookii were analyzed using samples collected from various sites of the archipelago. We estimate the average prevalence of BYDV to be 24.9% in P. cookii, with significant variability between sites. BYDV genetic diversity was assessed using sequence information from two genomic regions: the P3 open reading frame (ORF) (encoding the coat protein) and the hypervariable P6 ORF region. The phylogenetic analysis in the P3 region showed that BYDV sequences segregate into three major lineages, the most frequent of which (Ker-I cluster) showed close homology with BYDV-PAV-I isolates and had very low intra-lineage diversity (0.6%). A similarly low diversity was also recorded in the hypervariable P6 region, suggesting that Ker-I isolates derive from the recent introduction of BYDV-PAV-I. Divergence time estimation suggests that BYDV-PAV-I was likely introduced in the Kerguelen environment at the same time frame as its aphid vector, Rhopalosiphum padi, whose distribution shows good overlap with that of BYDV-Ker-I. The two other lineages show more than 22% amino acid divergence in the P3 region with other known species in the BYDV species complex, indicating that they represent distinct BYDV species. Using species-specific amplification primers, the distribution of these novel species was analyzed. The high prevalence of BYDV on native Poaceae and the presence of the vector R. padi, raises the question of its impact on the vulnerable plant communities of this remote ecosystem.

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

International audience

International audience

International audience

National audience; Only a few number of metagenomic studies concern plant viruses. However, a global knowledge of viral diversity would be very interesting in terms of ecology and could have important impacts on viral taxonomy and diversity studies and, potentially, on the prediction of emerging plant diseases. As an example, the “Plant Virus Biodiversity and Ecology” (PVDE) project has been initiated to survey the biodiversity of vascular plant viruses in the nature Conservancy’s Tallgrass Prairie Preserve of Oklahoma in USA (Wren et al., 2006). Our purpose is to describe the viral metagenome of the French sub-antarctic islands, especially in the Kerguelen islands. This project is included in the nationally funded EVINCE project “Vulnerability of native communities to invasive insects and climate change in sub-Antarctic islands” The ecosystems of these islands provide a suite of environments and scenarios that give key opportunities to improve our understanding of the consequences of climate change and biological invasions on terrestrial ecosystems. An additional interest is that almost nothing is known on the plant viruses present in such remote ecosystems, with the exception of a single report describing a new member of the Badnavirus genus (Skotnicki et al., 2003). Viral screening was done by two approaches. The first one, opened, consists in the analysis of double-stranded RNA, random cloning, sequencing, and comparison with sequences in databanks. By this approach we have been able to detect in an introduced Tropaeolum majus sample, sequences presenting 34% of identity in amino acids (56% of similarity) with the replicase of Oryza sativa endornavirus. The same approach permitted the identification of a new plant or fungal virus in a native plant of Kerguelen islands (Aceana magellanica). The sequences revealed 50% of identity with the capsid of Black raspberry virus F. The second approach consists in the screening of viruses belonging to known viral genera by polyvalent detection RT-PCR tests. One Tropaeolum majus sample was identified as being infected by a virus belonging to the Nepovirus genus. Indeed, the sequencing of the amplified fragment showed a significant identity in amino acids (89% and 93% of similarity) with the RNA-dependent RNA polymerase region of Cherry leaf roll virus (CLRV), a well known member of Nepovirus genus. Tropaeolum majus was known to be an experimental host of CLRV, but for our knowledge it is the first time that CLRV is described to infect naturally Tropaeolum majus. In this case, it seems that the virus was introduced in same time than the host plant, demonstrating, if necessary, the impact of species introduction on such terrestrial ecosystems.

International audience; In Arabidopsis thaliana Columbia (Col-0) plants, the restriction of Tobacco etch virus (TEV) long-distance movement involves at least three dominant RTM (restricted TEV movement) genes named RTM1, RTM2, and RTM3. Previous work has established that, while the RTM-mediated resistance is also effective against other potyviruses, such as Plum pox virus (PPV) and Lettuce mosaic virus (LMV), some isolates of these viruses are able to overcome the RTM mechanism. In order to identify the viral determinant of this RTM-resistance breaking, the biological properties of recombinants between PPV-R, which systemically infects Col-0, and PPV-PSes, restricted by the RTM resistance, were evaluated. Recombinants that contain the PPV-R coat protein (CP) sequence in an RTM-restricted background are able to systemically infect Col-0. The use of recombinants carrying chimeric CP genes indicated that one or more PPV resistance-breaking determinants map to the 5′ half of the CP gene. In the case of LMV, sequencing of independent RTM-breaking variants recovered after serial passages of the LMV AF199 isolate on Col-0 plants revealed, in each case, amino acid changes in the CP N-terminal region, close to the DAG motif. Taken together, these findings demonstrate that the potyvirus CP N-terminal region determines the outcome of the interaction with the RTM-mediated resistance.

Sixteen Plum pox virus (PPV) isolates collected in the Ankara region of Turkey were analyzed using available serological and molecular typing assays. Surprisingly, despite the fact that all isolates except one, which was a mix infection, were typed as belonging to the PPV-M strain in four independent molecular assays, nine of them (60%) reacted with both PPV-M specific and PPV-D specific monoclonal antibodies. Partial 5' and 3' genomic sequence analysis on four isolates demonstrated that irrespective of their reactivity towards the PPV-D specific monoclonal antibody, they were all closely related to a recombinant PPV isolate from Turkey, Ab-Tk. All three isolates for which the relevant genomic sequence was obtained showed the same recombination event as Ab-Tk in the HC-Pro gene, around position 1566 of the genome. Complete genomic sequencing of Ab-Tk did not provide evidence for additional recombination events in its evolutionary history. Taken together, these results indicate that a group of closely related PPV isolates characterized by a unique recombination in the HC-Pro gene is prevalent under field conditions in the Ankara region of Turkey. Similar to the situation with the PPV-Rec strain, we propose that these isolates represent a novel strain of PPV, for which the name PPV-T (Turkey) is proposed. Given that PPV-T isolates cannot be identified by currently available typing techniques, it is possible that their presence has been overlooked in other situations. Further efforts should allow a precise description of their prevalence and of their geographical distribution in Turkey and, possibly, in other countries. (C) 2009 Elsevier B.V. All rights reserved.

International audience; Cherry virus A (CVA) is a poorly known member of the Capillovirus genus whose potential association to a new decline disease of sweet cherry described from Southern France was recently questioned. The PDO nested RT-PCR was used as a detection tool to look for Trichoviruses, Capilloviruses and Foveaviruses in symptomatic and asymptomatic cherry samples (Foissac et al., 2005). The results suggest that there is no association between CVA and the cherry tree decline disease. In parallel, using the short fragment of the viral RNA-dependent RNA polymerase (RdRp) amplified by the PDO nested RT-PCR assay, the diversity of CVA isolates was analyzed. Substantial diversity was observed, with an average pairwise nucleotide divergence between isolates of about 9%. The major group of isolates identified clustered together with the CVA type isolate. Four additional divergent clusters of isolates could be identified, one of which corresponds to isolates obtained from non-cherry (apricot, plum) hosts. The average genetic distance between the various clusters in the sequenced region reached 19%. The polyvalence of the currently available CVA detection techniques was then assessed using a range of isolates representative of the four main phylogenetic clusters. Remarkably, outside of the major phylogenetic cluster, neither molecular hybridisation tests using probes derived from the 5' end or from the 3' end of the genome, nor the RT-PCR assay using the CVA1-CVA2 primer pair (James and Jelkmann, 1998) permitted the detection of all the CVA isolates. These results provide evidence for a previously unrecognized genetic diversity in CVA and indicate that new, more polyvalent assays are needed for the efficient detection of all isolates of this virus.

Serological reactivity to Plum pox virus (PPV) antisera has been described in several Prunus sources of Asian origin that are free of PPV infection. Using polyvalent or specific PCR assays, the presence of three closely related agents in two of these sources, Prunus mume cv. Bungo and P. persica cv. Ku Chu'a Hung, was demonstrated. Similarities in genome organization and sequence comparisons indicate that these agents should be regarded as members of the genus Foveavirus, their only singular trait being a very large (>800 nt) 3' non-coding region (NCR), as compared to the ca. 130-180 nt 3' NCR observed in other Foveaviruses. The three agents are very divergent from known Foveaviruses but are also significantly removed one from the others, with overall nucleotide sequence identity levels in the sequenced region of ca. 74-76% and of only 60.8-67.5% in their complete CP gene (61.9-71.3% amino acid sequence identity). Given the species discrimination criteria in the family Flexiviridae, these three agents should be regarded as three related yet distinct new viruses belonging to the Foveavirus genus, for which the names Asian prunus virus 1, 2 and 3 are proposed. Evidence is provided for the presence of variants of these new viruses in other Prunus germplasm of Asian origin.