Search

Citrus yellow vein clearing virus (CYVCV) is a member of the Alphaflexiviridae family that causes yellow vein clearing symptoms on citrus leaves. A total of 118 leaf samples from nine regions of six provinces in Korea were collected from various citrus species in 2020 and 2021. Viral diagnosis using next-generation sequencing and reverse transcription polymerase chain reaction (RT-PCR) identified four viruses: citrus tristeza virus, citrus leaf blotch virus, citrus vein enation virus, and CYVCV. A CYVCV incidence of 9.3% was observed in six host plants, including calamansi, kumquat, Persian lime, and Eureka lemon. Among the citrus infected by CYVCV, only three samples showed a single infection; the other showed a mixed infection with other viruses. Eureka lemon and Persian lime exhibited yellow vein clearing, leaf distortion, and water-soak symptom underside of the leaves, while the other hosts showed only yellowing symptoms on the leaves. The complete genome sequences were obtained from five CYVCV isolates. Comparison of the isolates reported from the different geographical regions and hosts revealed the high sequence identity (95.2% to 98.8%). Phylogenetic analysis indicated that all the five isolates from Korea were clustered into same clade but were not distinctly apart from isolates from China, Pakistan, India, and Türkiye. To develop an efficient diagnosis system for the four viruses, a simultaneous detection method was constructed using multiplex RT-PCR. Sensitivity evaluation, simplex RT-PCR, and stability testing were conducted to verify the multiplex RT-PCR system developed in this study. This information will be useful for developing effective disease management strategies for citrus growers in Korea.

Spuriopimpinella brachycarpa Nakai (Common name, Chamnamul; family Apiaceae) is a plant whose leaves are consumed as a vegetable and used as a folk medicine in Korea (Kim et al., 2020). In February 2020, seven samples of S. brachycarpa leaf showing virus symptoms including yellowing, vein chlorosis, chlorotic lesions, and severe mottling were collected from a greenhouse in Busan, South Korea, to diagnose the potential disease (Fig. S1a, b). The disease incidence rate in the greenhouse was >10% (2,970 m2). To identify the causal virus, we analyzed leaf dip preparation and thin sections of the symptomatic leaves by transmission electron microscopy. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Fig. S1c, d). To confirm these results, the symptomatic leaf samples were further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using potyvirus universal primers (Table S2) and direct sequencing of the PCR products. All samples were positive for konjac mosaic virus (KoMV). To exclude the possibility of infection by multiple viruses, we performed high-throughput sequencing (HTS) on an Illumina NovaSeq 6000 system (Macrogen Inc., Seoul, South Korea). There were two contigs (9,267 and 2,851 nt) mapping to KoMV sequences. A large contig (9,267 nt; 705,967 mapped reads; mean read coverage of 11,351.4x) showed about 80% identity (93% coverage) with KoMV-F (GenBank accession no. NC_007913) isolated from Amorphophallus konjac in Japan (Nishiguchi et al., 2006). To isolate KoMV from S. brachycarpa , we mechanically inoculated leaf extracts from symptomatic samples onto Chenopodium quinoa as an assay host via three single-lesion passages, followed by propagation in Nicotiana benthamiana . In a bioassay of the KoMV isolate (KoMV-BS), we mechanically inoculated sap from infected N. benthamiana onto 31 indicator plants including Cryptotaenia japonica (Apiaceae), which is similar to S. brachycarpa (Table S3). KoMV-BS systemically induced vein chlorosis and/or leaf mottling in four Nicotiana species and C. japonica , and chlorotic local lesions in upper leaves of C. quinoa ; no symptoms were observed in 25 other indicator plants. These results were confirmed by RT-PCR. Next, we obtained the complete genome sequence of KoMV-BS using HTS and 5' and 3' rapid amplification of cDNA ends, with newly designed primers (Table S2). The assembled full-length KoMV-BS genome sequence was 9,392 nt in length, excluding the poly(A) tail, and encoded a polyprotein composed of 3,060 amino acids. The sequence was deposited in GenBank (accession no. OR001914). BLAST analysis showed 84~88% and 90~98% identities at CP nucleotide and amino acid levels, respectively with the reported KoMV isolates, confirming the virus to be an isolate of KoMV (synonym; Japanese hornwort mosaic virus, zantedeschia mosaic virus) (Adams et al., 2005; Nishiguchi et al., 2006). KoMV infection was first reported in A. konjac from Japan (Shimoyama et al. 1992) and has been spread worldwide as one of the major causal agents of viral diseases in calla lily (Liao et al., 2020). To the best of our knowledge, this is the first report of KoMV infection in S. brachycarpa . To date, cucumber mosaic virus and tobacco mosaic virus have been reported to infect S. brachycarpa in Korea (Yoon et al., 2016; 2017). Our findings will be helpful for developing virus-management strategies to prevent yield and quality loss in S. brachycarpa .

Radish ( Raphanus sativus L.) is an important root vegetable widely consumed in kimchi in Korea. In October 2021, radish leaves with virus-like symptoms of mosaic and yellowing were collected in three fields around Naju, Korea (Fig. S1). A pooled sample (n = 24) was screened for causal viruses by high-throughput sequencing (HTS), with detection confirmed by reverse transcription (RT) PCR. Total RNA was extracted from symptomatic leaves using the Plant RNA Prep kit (Biocube System, Korea), and a cDNA library was constructed and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea). De novo transcriptome assembly yielded 63,708 contigs, which were analyzed against the viral reference genome database in GenBank by BLASTn and BLASTx searches. Two large contigs were clearly of viral origin. BLASTn analysis showed that a 9,842-bp contig (4,481,600 mapped reads, mean read coverage 68,758.6×) had 99% identity (99% coverage) with isolate CCLB of turnip mosaic virus (TuMV) from radish in China (KR153038). A second contig of 5,711 bp (7,185 mapped reads, mean read coverage 189.9×) had 97% identity (99% coverage) with isolate SDJN16 of beet western yellows virus (BWYV) from Capsicum annuum in China (MK307779). To confirm the presence of these viruses, total RNA extracted from 24 leaf samples was subjected to RT-PCR using primers specific for TuMV (N60_5'-ACATTGAAAAGCGTAACCA-3' and C30_5'-TCCCATAAGCGAGAATACTAACGA-3', amplicon 356 bp) and BWYV (95F_5'-CGAATCTTGAACACAGCAGAG-3' and 784R_5'-TGTGGG ATCTTGAAGGATAGG-3', amplicon 690 bp) for virus detection. Of the 24 samples, 22 were positive for TuMV and 7 were co-infected with BWYV. Single infection of BWYV was not detected. Infection with TuMV, the predominant virus in radish in Korea, was previously reported (Choi and Choi, 1992; Chung et al., 2015). To determine the complete genomic sequence of the BWYV isolate (BWYV-NJ22) from radish, RT-PCR was conducted using eight overlapping primer pairs designed according to the alignment of previously reported BWYV sequences (Table S2). Terminal sequences of the viral genome were analyzed by 5' and 3' rapid amplification of cDNA ends (RACE; Thermo Fisher Scientific Corp.). The assembled complete genome sequence of BWYV-NJ22 was 5,694 nt long and was deposited in GenBank (accession no. OQ625515). The Sanger sequences shared 96% nt identity with the HTS-derived sequence. BLASTn analysis showed that BWYV-NJ22 had high nucleotide identity (98%) at the complete genome level with a BWYV isolate (OL449448) from C. annuum in Korea. BWYV (genus Polerovirus , family Solemoviridae ), is an aphid-borne virus with a host range that includes > 150 plant species and is one of the most important viruses causing yellowing and stunting of vegetable crops (Brunt et al., 1996; Duffus 1973). In Korea, BWYV was first reported to infect paprika, followed by pepper, motherwort, and figwort (Jeon et al., 2021; Kwon et al., 2016; 2018; Park et al., 2018). During fall and winter 2021, 675 radish plants with virus-like symptoms of mosaic, yellowing, and chlorosis were collected from 129 farms in major cultivation areas in Korea and analyzed by RT-PCR using the BWYV detection primers. The incidence of BWYV in radish plants was 4.7%, and all infections were mixed infections with TuMV. To our knowledge, this is the first report of BWYV infecting radish in Korea. The symptoms of single BWYV infection are unclear, as radish is a new host plant of BWYV in Korea. Further research on the pathogenicity and impact of this virus in radish is therefore needed.

Cucumber mosaic virus (CMV) is one of the most prevalent plant viruses in the world, and causes severe damage to various crops. CMV has been studied as a model RNA virus to better understand viral replication, gene functions, evolution, virion structure, and pathogenicity. However, CMV infection and movement dynamics remain unexplored due to the lack of a stable recombinant virus tagged with a reporter gene. In this study, we generated a CMV infectious cDNA construct tagged with a variant of the flavin-binding LOV photoreceptor (iLOV). The iLOV gene was stably maintained in the CMV genome after more than four weeks of three serial passages between plants. Using the iLOV-tagged recombinant CMV, we visualized CMV infection and movement dynamics in living plants in a time course manner. We also examined whether CMV infection dynamics is influenced by co-infection with broad bean wilt virus 2 (BBWV2). Our results revealed that no spatial interference occurred between CMV and BBWV2. Specifically, BBWV2 facilitated the cell-to-cell movement of CMV in the upper young leaves. In addition, the BBWV2 accumulation level increased after co-infection with CMV., (© 2023. The Author(s).)

Viburnum lentago (family Adoxaceae) is a perennial plant species native to northeastern United States and southern Canada. Globally, V. lentago is a popular garden plant due to its abundant flowers and beautiful autumnal color. V. lentago is also commercially cultivated for medicinal purposes because its roots and fruits can be used in herbal preparations (Jiao et al. 2021). In June 2022, virus-like symptoms of vein chlorosis and yellowing were observed in the leaves of many V. lentago trees planted in a public park in Wonju, South Korea. Leaf samples were collected from five symptomatic V. lentago trees. To identify the causal agent(s) of the virus-like symptoms, total RNA was isolated from one sample using PureLink® RNA Mini Kit (Invitrogen, USA) and subjected to library construction using Illumina TruSeq RNA Sample Preparation Kit v2 (Illumina, Inc., USA). RNA-Seq was performed using an Illumina NovaSeq 6000 system (Macrogen, Korea). De novo assembly of 118,878,556 quality-filtered reads was performed using the Trinity pipeline (Kwon et al. 2018), yielding 296,109 contigs. BLASTn and BLASTx analyses of the contigs against the GenBank viral reference database identified only one large contig (8,816 nt) containing a 26-nt poly(A) tail of viral origin. This contig had a maximum nucleotide identity of 85.53 % (with 99 % coverage) with isolate HZ (accession No. MH427034) of citrus leaf blotch virus (CLBV; genus Citrivirus, family Betaflexiviridae), suggesting that the collected sample was infected with CLBV. All collected V. lentago samples were tested using RT-PCR with CLBV-specific primers (CLBV-Det-Fw 5'-AACGAGGCCAATTCTGCTAT-3' and CLBV-Det-Rv 5'-GACTGCTTGACTAACAC-CCA-3'). All samples were positive for CLBV. For biological indexing, sap from the symptomatic V. lentago leaves was mechanically inoculated to indicator plants, including Nicotiana benthamiana, N. occidentalis, N. tabacum, Datura stramonium, Chenopodium quinoa, Vigna unguiculata, and V. lentago. Three months later, only V. lentago developed the same vein chlorosis symptoms observed in the collected samples, and no other tested plants exhibited obvious symptoms. Further, only V. lentago sample tested positive for CLBV using RT-PCR analysis. To determine the complete genome sequence of the CLBV V. lentago isolate, the contig sequence was confirmed by de novo sequencing of the RT-PCR products amplified using CLBV-specific primers. The 5' terminal sequence of the contig was determined using the 5' rapid amplification of cDNA ends method (Seo et al. 2015). The full-length sequence of CLBV isolated from V. lentago was 8,795 nt in length (excluding poly(A) tail), and deposited in GenBank under the accession number OP751940. Although numerous isolates of CLBV have been identified in various plant species, including citrus, kiwi, and lemon plants (Cao et al. 2017), the V. lentago isolate is likely a distinct variant because its CP gene has a maximum nucleotide identity of 85.53 % with that of a kiwi isolate (MH339916). With little information available on viral diseases infecting V. lentago, this is the first identified and completely sequenced CLBV infecting V. lentago. Significantly, V. lentago plants infected with CLBV did not flower throughout the summer period, reducing their value as an ornamental plant. Furthermore, V. lentago might have acted as an intermediate host to transfer CLBV to other crops such as citrus. To the best of our knowledge, this is the first report of CLBV infecting V. lentago in South Korea and the world.

Pepper mottle virus (PepMoV) infects primarily Capsicum species, including pepper and bell pepper which are important vegetable and spice crops in Korea. We have previously collected 13 PepMoV isolates from nine regions comprising five provinces, causing different symptoms on inoculated indicator host plants in Korea. To further identify the responsible symptom determinant(s) and explore viral protein functions of PepMoV, two out of 13 isolates, including 134 and 205136, were used in this study. Isolate 134 causes necrosis and yellowing, while 205136 causes severe mottle and yellowing symptoms on Nicotiana benthamiana . All chimeric and site-directed mutants contain the PepMoV 134 genome as a backbone with specific regions switched for those from counterparts of PepMoV 205136. Effects of all mutants compared with 134 after inoculation onto N. benthamiana by agroinfiltration. Results from our study provide direct evidence that the helper component-proteinase (HC-Pro) and the nuclear inclusion protein b (NIb)-coat protein (CP) regions are involved in virus accumulation and symptom determinants. In addition, we mapped to amino acid residues tyrosine, glycine, and leucine at position 360, 385, and 527, respectively, in the HC-Pro region participate in faster viral accumulation or movement in the plant. The residue valine at position 2773 of NIb plays an essential role in isolate 134 symptom development. As part of this study, we seek to gain insight into viral factors involved in the PepMoV infection cycle and a better understanding of plant-virus interactions. These findings complement the insufficiency of the gene function study of the PepMoV virus and provide a novel perspective for the protein function study of the Potyvirus ., Competing Interests: The authors declare that the research was conducted without any commercial or financial relationships construed as a potential conflict of interest., (Copyright © 2022 Fang, Yu, Kwak and Kim.)

In Myanmar, yellow mosaic and leaf curl diseases caused by whitefly-transmitted begomoviruses are serious problems for vegetables such as tomatoes and peppers. To investigate the incidence of begomoviruses in Myanmar between 2017 and 2019, a field survey of tomato and pepper plants with virus-like symptoms was conducted in the Naypyitaw, Tatkon, and Mohnyin areas of Myanmar. Among the 59 samples subjected to begomovirus detection using polymerase chain reaction, 59.3% were infected with begomoviruses. Complete genome sequences using rolling circle amplification identified five begomovirus species: tomato yellow leaf curl Thailand virus (TYLCTHV), tomato yellow leaf curl Kanchanaburi virus (TYLCKaV), tobacco leaf curl Yunnan virus (TbLCYnV), chili leaf curl Pakistan virus (ChiLCV/PK), and tobacco curly shoot Myanmar virus (TbCSV-[Myanmar]). Excluding the previously reported TYLCTHV, three begomoviruses (ChiLCV/PK, TYLCKaV, and TbLCYnV) were identified in Myanmar for the first time. Based on the 91% demarcation threshold of begomovirus species, TbCSV-[Myanmar] was identified as a new species in this study. Among these, ChiLCV/PK and TbCSV-[Myanmar] were the most predominant in tomato and pepper fields in Myanmar. Identification of begomovirus species may be helpful for predicting the origin of viruses and preventing their spread.

Ranunculus ( Ranunculus asiaticus L.) is a popular ornamental plant mainly cultivated for cut flowers and flowering potted plants. In January 2021, a leaf sample of R. asiaticus that showed virus-like symptoms including mosaic, yellowing and malformation on leaves was collected from a greenhouse in Jangheung, South Korea for disease diagnosis (Fig. S1). Disease incidence was greater than 30% in the greenhouse (~1,000 m2). Transmission electron microscopy (TEM) of symptomatic leaves identified potyvirus-like filamentous virus particles of about 800 nm. To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for six potyviruses that infect R. asiaticus (Sacco et al., 2018). The sample was positive only for ranunculus mild mosaic virus (RanMMV). Additional analysis of nine symptomatic R. asiaticus plants from the infected greenhouse found that all samples were positive for RanMMV. To exclude the presence of the other viruses, next generation sequencing (NGS) was carried out. Total RNA was extracted from symptomatic leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and a transcriptome library was generated using the TruSeq Stranded Total RNA LT Sample Prep kit (Illumina, San Diego, CA) acccording to the recommended protocol. NGS was performed using an Illumina NovaSeq 6000 system (Macrogen Inc., Korea). A total of 75.58 million reads were obtained, and the reads were de novo assembled to contigs using Trinity software (Grabherr et al., 2011). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database identified the assembled large contig of 9,539 nt (5,321 mapped reads, mean read coverage of 84.2 times) as RanMMV. This sequence shared 98% nt identity (99% coverage) with the RanMMV NL isolate (acc. no. LC604020) isolated from an anemone plant ( A. blanda cv. Charmer) from Netherlands. To obtain the complete genome sequence, the termini sequences were determined by 5' and 3' rapid amplification of cDNA ends (RACE) methods as reported recently (Imamura et al., 2021). The assembled full-length genome sequence of RanMMV-JH is 9,574 nt in length, excluding the poly(A) tail, and encoding a polyprotein of 3,074aa. The sequence was deposited in GenBank under the accession no. OL742438. RanMMV is transmitted by aphids in a nonpersistent manner and has very narrow host range. RanMMV, one of causative agents of ranunculus mosaic disease, has been problematic in ranunculus production area of Japan (Hayahi et al., 2018; Kamikawa et al., 2022). Recently, some perennial weeds from the Ranunculaceae family (e.g. R. japonicus , R. silerifolius and R. tachiroei ) are known to may act as a virus reservoir (Kamikawa et al., 2022). As R. asiaticus is cultivated by vegetative propagation, there is need to develop certification system for producing virus-free R. asiaticus . To our knowledge, this is the first report of RanMMV infection in R. asiaticus in Korea.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

Tomato spotted wilt virus (TSWV) is a highly destructive virus for pepper. Introgression of the resistance gene Tsw in pepper is used to manage TSWV worldwide; however, the occurrence of Tsw resistance-breaking (RB) variants threatens the pepper industry. Here, we developed a multiplex reverse-transcription PCR assay for detection of recently emerged Tsw RB variants in South Korea with high specificity and sensitivity., (Copyright © 2022 Elsevier Ltd. All rights reserved.)

Broad bean wilt virus 2 (BBWV2) is an evolutionarily successful RNA virus with an extensive host range and worldwide distribution that causes severe damage to crops. While numerous BBWV2 isolates from various plant species have been identified and their genome sequences determined, little information is available on the virulence and symptomatic characteristics corresponding to the genomic sequences. In this study, we provide integrated information on the molecular and pathogenic characteristics of three genetically distant BBWV2 isolates: BBWV2-PC, -LS2, and P3 obtained from Gentiana scabra, Leonurus sibiricus, and Pisum sativum, respectively. Phylogenetic and diversity analyses of the BBWV2 population included 42 isolates from various host species and revealed that RNA2 has higher genetic plasticity than RNA1 and may have evolved under host-imposed constraints. In addition, we generated an infectious cDNA clone of BBWV2-PC RNA2 (pBBWV2-PC-R2). Pseudo-recombination analysis of pBBWV2-PC-R2 further demonstrated that RNA2 determines the pathogenic characteristics of the PC isolate., (Copyright © 2021. Published by Elsevier B.V.)

Broad bean wilt virus 2 (BBWV2) is an emerging virus in various economically important crops, especially pepper ( Capsicum annuum L.), worldwide. Recently, the emergence of various BBWV2 strains that induce severe symptoms has increased damage to pepper crops. While the symptomatic variations among virus strains should be associated with differences in the transcriptomic reprogramming of host plants upon infection, underlying molecular mechanisms and associated genes are largely unknown. In the present study, we employed transcriptome analysis to identify responsible host factors for symptom enhancement in the BBWV2-pepper pathosystem using two distinct BBWV2 strains, PAP1 (a severe strain) and RP1 (a mild strain). Comparative analysis of the differentially expressed genes (DEGs) revealed that various genes associated with pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and ethylene signaling were significantly upregulated upon infection with the severe PAP1 strain, but not with the mild RP1 strain. Indeed, hormone analysis revealed that ethylene emission was significantly increased in pepper plants infected with PAP1. These observations imply that the activation of the PTI-associated defense responses reinforce symptom formation during BBWV2 infection in a virus strain-specific manner., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2021 Han, Choi, Kim, Kwon, Kwak and Seo.)

Apple stem grooving virus (ASGV; genus Capillovirus ) is an economically important virus. It has an approx. 6.5 kb, monopartite, linear, positive-sense, single-stranded RNA genome. The present study includes identification of 24 isolates-13 isolates from apple ( Pyrus malus L.) and 11 isolates from pear ( Pyrus communis L.)-from different agricultural fields in South Korea. The coat protein (CP) gene of the corresponding 23 isolates were amplified, sequenced, and analyzed. The CP sequences showed phylogenetic separation based on their host species, and not on the geography, indicating host adaptation. Further analysis showed that the ASGV isolated in this study followed host adaptation influenced and preferred by the host codon-usage.

Brugmansia suaveolens, known as angel's trumpet, is a perennial ornamental shrub in the Solanaceae with large fragrant flowers. In June 2018, a leaf sample of B. suaveolens that showed virus-like symptoms including chlorotic spots, yellowing and mottle on leaves was collected from a greenhouse in Seongnam, South Korea for disease diagnosis (Supplementary Figure S1a, b). Disease incidence in the greenhouse was greater than 80% for about 2,000 B. suaveolens plants. To identify a causal virus, transmission electron microscopy (TEM) was used to analyze symptomatic leaf samples using leaf dips and thin section methods. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Supplementary Figure S1c, d). To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for three potyviruses that infect Brugmansia spp.: Colombian datura virus (CDV), Brugmansia mosaic virus (BruMV), and Brugmansia suaveolens mottle virus (BsMoV) (Lucinda et al, 2008; Park et al., 2014; Verma et al., 2014). The sample was positive only for CDV. CDV is transmitted by aphids in a nonpersistent manner and mechanical inoculation and can infect plants in the Solanaceae family including tomato and tobacco (Kahn and Bartels 1968; Schubert et al. 2006; Verhoeven et al. 1996) and has been designated a quarantine virus in Korea. Additional analysis of 13 symptomatic B. suaveolens plants from the infected greenhouse found that all samples except one were infected with CDV. To isolate CDV from B. suaveolens, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Nicotiana tabacum cv. BY via three single-lesion passages followed by propagation in N. benthamiana. For the bioassay of the CDV isolate (CDV-AT-Kr), sap from infected N. benthamiana was mechanically inoculated on 31 indicator plants, including B. suaveolens (Supplementary Table S2). CDV-AT-Kr induced chlorotic local lesions, necrotic local lesions, mottle, and/or mosaic systemically in 10 Nicotiana spp., and mottle and yellowing in tomato. On inoculated B. suaveolens, te mild mottle symptom was reproduced. No symptoms were observed in pepper or Datura stramonium. These results were confirmed by RT-PCR. To characterize CDV-AT-Kr genetically, the complete genome sequence of CDV-AT-Kr was obtained by RT-PCR using specific primers (Supplementary Table S3) and deposited in GenBank (accession no. MW075268). The CDV-AT-Kr RNA consists of 9,620 nt, encoding a polyprotein of 3,076 aa. BLASTn analysis showed that CDV-AT had maximum nucleotide identities of 98.9% at the complete genome level with a CDV isolate (accession no. JQ801448) from N. tabacum in the UK. To our knowledge, this is the first report of CDV infection in B. suaveolens in Korea and the second report in the world of the complete genome sequence. As B. suaveolens is cultivated by vegetative propagation, production and maintenance of virus-free, healthy B. suaveolens is needed. In addition, as new CDV hosts have been repeatedly reported (Pacifico et al., 2016; Salamon et al., 2015; Tomitaka et al., 2014; Verma et al., 2014), we are monitoring nationwide occurrence to prevent the spread of the virus to other crops.

In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci , in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.

Butterbur ( Petasites japonicus [Siebold & Zucc.] Maxim.) is a perennial herb of the Asteraceae family that is cultivated for medicinal and nutritional purposes. Due to long-term vegetative propagation of virus-infected native species, the yield and quality of butterbur plants have deteriorated. Five viruses have been reported to infect this species: alfalfa mosaic virus (AMV), arabis mosaic virus (ArMV), butterbur mosaic virus (ButMV), broad bean wilt virus 2 (BBWV-2), and cucumber mosaic virus (CMV) (Ham et al. 2016; Tochihara and Tamura 1976). From 2018 to 2019, butterbur plants in four greenhouses in Nonsan, South Korea (Supplementary Figure S1a, b) were found to show virus-like symptoms such as chlorotic and necrotic ring spots, necrosis, and mild mosaic on the leaves. Disease incidence was greater than 80% in one greenhouse (~1,000 m2). To identify the causal virus, we collected 17 symptomatic butterbur leaf samples from these greenhouses and performed reverse-transcription polymerase chain reaction (RT-PCR) analysis using species-specific detection primers for the five reported viruses and tomato spotted wilt virus (TSWV) (Supplementary Table S2). RT-PCR results showed that 12 samples from three greenhouses showing necrotic ring spots and mosaic symptoms were infected with a mixture of TSWV and ButMV, whereas 5 samples from one greenhouse showing mild mosaic symptoms were infected only with ButMV. TSWV (genus Orthotospovirus , family Tospoviridae ) is transmitted by thrips and causes serious damage to a wide range of economically important plants (Pappu et al. 2009). ButMV (genus Carlavirus , family Betaflexiviridae ) is transmitted by aphids, as well as infected vegetative propagation material (Hashimoto et al. 2009) and is the most predominant virus in butterbur in Korea (Ham et al. 2016). To isolate TSWV from butterbur, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Chenopodium quinoa , via three single-lesion passages followed by propagation in Nicotiana tabacum cv. Samsun. Thirty different indicator plant species were used for the bioassay of the TSWV isolate (TSWV-NS-BB20) by mechanical inoculation method (Supplementary Table S3). RT-PCR analysis confirmed that TSWV-NS-BB20 induced necrotic local lesions and mosaic on Nicotiana species and ring spots and mosaic on tomatoes and peppers. Notably, TSWV-NS-BB20 reproduced necrotic local lesions and mild mosaic symptoms on butterbur plants which were infected with ButMV with no obvious symptoms. To characterize TSWV-NS-BB20 genetically, the complete genome sequences of L (8914 nt), M (4751 nt), and S (2917 nt) RNA segments were obtained by RT-PCR using specific primers for TSWV as described previously (Kwak et al., 2020). The obtained sequences were deposited in GenBank under accession nos. MT643236, MT842841, and MN854654, respectively. BLASTn analysis showed that sequences of each segment had maximum nucleotide identities of 99.0, 98.9, and 98.6% to TSWV-L, M, and S (KP008128, FM163373, and KP008129) of TSWV-LL-N.05 isolate from tomato in Spain. Since 2018, TSWV outbreaks on butterbur are observed every year and thus may act as a potential source of TSWV infection for other crops of importance to Korea, such as pepper. Owing to the butterbur vegetative propagation, the identification of TSWV infection in butterbur will be helpful for future virus management to generate virus-free materials. To our knowledge, this is the first report of TSWV infection of butterbur.

Understanding the evolutionary history of a virus and the mechanisms influencing the direction of its evolution is essential for the development of more durable strategies to control the virus in crop fields. While the deployment of host resistance in crops is the most efficient means to control various viruses, host resistance itself can act as strong selective pressure and thus play a critical role in the evolution of virus virulence. Cucumber mosaic virus (CMV), a plant RNA virus with high evolutionary capacity, has caused endemic disease in various crops worldwide, including pepper ( Capsicum annuum L.), because of frequent emergence of resistance-breaking variants. In this study, we examined the molecular and evolutionary characteristics of recently emerged, resistance-breaking CMV variants infecting pepper. Our population genetics analysis revealed that the high divergence capacity of CMV RNA1 might have played an essential role in the host-interactive evolution of CMV and in shaping the CMV population structure in pepper. We also demonstrated that nonsynonymous mutations in RNA1 encoding the 1a protein enabled CMV to overcome the deployed resistance in pepper. Our findings suggest that resistance-driven selective pressures on RNA1 might have contributed in shaping the unique evolutionary pattern of CMV in pepper. Therefore, deployment of a single resistance gene may reduce resistance durability against CMV and more integrated approaches are warranted for successful control of CMV in pepper., (© The Author(s) 2020. Published by Oxford University Press.)

Tomato ( Lycopersicum esculentum L.) and pepper ( Capsicum annuum L.) plants belonging to the family Solanaceae are cultivated worldwide. The rapid development of next-generation sequencing (NGS) technology facilitates the identification of viruses and viroids infecting plants. In this study, we carried out metatranscriptomics using RNA sequencing followed by bioinformatics analyses to identify viruses and viroids infecting tomato and pepper plants in Vietnam. We prepared a total of 16 libraries, including eight tomato and eight pepper libraries derived from different geographical regions in Vietnam. We identified a total of 602 virus-associated contigs, which were assigned to 18 different virus species belonging to nine different viral genera. We identified 13 different viruses and two viroids infecting tomato plants and 12 viruses and two viroids infecting pepper plants with viruses as dominantly observed pathogens. Our results showed that multiple infection of different viral pathogens was common in both plants. Moreover, geographical region and host plant were two major factors to determine viral populations. Taken together, our results provide the comprehensive overview of viral pathogens infecting two important plants in the family Solanaceae grown in Vietnam.

While pepper ( Capsicum annuum ) is a highly recalcitrant species for genetic transformation studies, plant virus-based vectors can provide alternative and powerful tools for transient regulation and functional analysis of genes of interest in pepper. In this study, we established an effective virus-based vector system applicable for transient gain- and loss-of-function studies in pepper using Broad bean wilt virus2 (BBWV2). We engineered BBWV2 as a dual gene expression vector for simultaneous expression of two recombinant proteins in pepper cells. In addition, we established enhanced and stable expression of recombinant proteins from the BBWV2-based dual vector via coexpression of a heterologous viral suppressor of RNA silencing. We also developed a BBWV2-based virus-induced gene silencing (VIGS) vector, and we successfully silenced the phytoene desaturase gene ( PDS ) using the BBWV2-based VIGS vector in various pepper cultivars. Additionally, we optimized the BBWV2-based VIGS system in pepper by testing the efficiency of PDS gene silencing under different conditions. This BBWV2-based vector system represents a convenient approach for rapid and simple analysis of gene functions in pepper., (© 2019 American Society of Plant Biologists. All Rights Reserved.)

Complete genome sequences of 22 isolates of Cucurbit aphid-borne yellows virus (CABYV), collected from melon plants showing yellowing symptom in Korea during the years 2013-2014, were determined and compared with previously reported CABYV genome sequences. The complete genomes were found to be 5,680-5,684 nucleotides in length and to encode six open reading frames (ORFs) that are separated into two regions by a non-coding internal region (IR) of 199 nucleotides. Their genomic organization is typical of the genus Polerovirus . Based on phylogenetic analyses of complete nucleotide (nt) sequences, CABYV isolates were divided into four groups: Asian, Mediterranean, Taiwanese, and R groups. The Korean CABYV isolates clustered with the Asian group with > 94% nt sequence identity. In contrast, the Korean CABYV isolates shared 87-89% sequence identities with the Mediterranean group, 88% with the Taiwanese group, 81-84% with the CABYV-R group, and 72% with another polerovirus , M. . Recombination analyses identified 24 recombination events (12 different recombination types) in the analyzed CABYV population. In the Korean CABYV isolates, four recombination types were detected from eight isolates. Two recombination types were detected in the IR and P3-P5 regions, respectively, which have been reported as hotspots for recombination of CABYV. This result suggests that recombination is an important evolutionary force in the genetic diversification of CABYV populations.

The Sweet potato chlorotic fleck virus (SPCFV), of the genus Carlavirus (family Betaflexiviridae), was first detected as one of several viruses infecting sweet potatoes ( Ipomea batatas L.) in Korea. Out of 154 sweet potato samples collected in 2012 that were showing virus-like symptoms, 47 (31%) were infected with SPCFV, along with other viruses. The complete genome sequences of four SPCFV isolates were determined and analyzed using previously reported genome sequences. The complete genomes were found to contain 9,104-9,108 nucleotides, excluding the poly-A tail, containing six putative open reading frames (ORFs). Further, the SPCFV Korean isolates were divided into two groups (Group I and Group II) by phylogenetic analysis based on the complete nucleotide sequences; Group I and Group II had low nucleotide sequence identities of about 73%. For the first time, we determined the complete genome sequence for the Group II SPCFV isolates. The amino acid sequence identity in coat proteins (CP) between the two groups was over 90%, whereas the amino acid sequence identity in other proteins was less than 80%. In addition, SPCFV Korean isolates had a low amino acid sequence identity (61% CPs and 47% in the nucleotide- binding protein [NaBp] region) to that of Melon yellowing-associated virus (MYaV), a typical Carlavirus .

Sweet potato is a vegetatively propagated crop that is produced for both growth in Korean fields and for export out of the country. The viruses that are present in introduced sweet potatoes can spread both domestically and to foreign countries. Determining the time and path of virus movement could help curtail its spread and prevent future dispersal of related viruses. Determining the consequences of past virus and sweet potato dispersal could provide insight into the ecological and economic risks associated with other sweet potato-infecting viral invasions. We therefore applied Bayesian phylogeographic inferences and recombination analyses of the available Sweepovirus sequences (including 25 Korean Sweepovirus genomes) and reconstructed a plausible history of Sweepovirus diversification and movement across the globe. The Mediterranean basin and Central America were found to be the launchpad of global Sweepovirus dispersal. Currently, China and Brazil are acting as convergence regions for Sweepoviruses. Recently reported Korean Sweepovirus isolates were introduced from China in a recent phase and the regions around China and Brazil continue to act as centers of Sweepovirus diversity and sites of ongoing Sweepovirus evolution. The evidence indicates that the region is an epidemiological hotspot, which suggests that novel Sweepovirus variants might be found., Competing Interests: The authors have declared that no competing interests exist.

Tomato chlorosis virus (ToCV) is a whitefly-transmitted and phloem-limited crinivirus. In 2013, severe interveinal chlorosis and bronzing on tomato leaves, known symptoms of ToCV infection, were observed in greenhouses in Korea. To identify ToCV infection in symptomatic tomato plants, RT-PCR with ToCV-specific primers was performed on leaf samples collected from 11 tomato cultivating areas where ToCV-like symptoms were observed in 2013 and 2014. About half of samples (45.18%) were confirmed as ToCV-infected, and the complete genome of 10 different isolates were characterized. This is the first report of ToCV occurring in Korea. The phylogenetic relationship and genetic variation among ToCV isolates from Korea and other countries were also analysed. When RNA1 and RNA2 are analysed separately, ToCV isolates were clustered into three groups in phylogenetic trees, and ToCV Korean isolates were confirmed to belong to two groups, which were geographically separated. These results suggested that Korean ToCV isolates originated from two independent origins. However, the RNA1 and RNA2 sequences of the Yeonggwang isolate were confirmed to belong to different groups, which indicated that ToCV RNA1 and RNA2 originated from two different origins and were reassorted in Yeonggwang, which is the intermediate point of two geographically separated groups.

The viral infection of plants may cause various physiological symptoms associated with the reprogramming of plant gene expression. However, the molecular mechanisms and associated genes underlying disease symptom development in plants infected with viruses are largely unknown. In this study, we employed RNA sequencing for in-depth molecular characterization of the transcriptional changes associated with the development of distinct symptoms induced by tomato chlorosis virus (ToCV) and tomato yellow leaf curl virus (TYLCV) in tomato. Comparative analysis of differentially expressed genes revealed that ToCV and TYLCV induced distinct transcriptional changes in tomato and resulted in the identification of important genes responsible for the development of symptoms of ToCV (i.e., chlorosis and anthocyanin accumulation) and TYLCV (i.e., yellowing, stunted growth, and leaf curl). Our comprehensive transcriptome analysis can provide molecular strategies to reduce the severity of disease symptoms as well as new insights for the development of virus-resistant crops., (Copyright © 2018 Elsevier Inc. All rights reserved.)

Broad bean wilt virus 2 (BBWV2, genus Fabavirus, family Secoviridae) has a wide host range and infects many economically important crops. Various isolates of BBWV2 have been identified from diverse host plants, and their molecular and biological characteristics have been investigated. In our previous study, we demonstrated that BBWV2 RNA2 contains a symptom determinant(s) capable of enhancing symptom severity by utilizing infectious full-length cDNA clones of two distinct strains of BBWV2, pBBWV2-PAP1 (a severe strain) and pBBWV2-RP1 (a mild strain). In the present study, to identify the symptom determinant(s) of BBWV2, we exploited disease responses of pBBWV2-PAP1- and pBBWV2-RP1-derived chimeric viruses and amino acid substitution mutant viruses in Nicotiana benthamiana and pepper (Capsicum annuum Quarri) and demonstrated that the movement protein (MP) encoded in BBWV RNA2 is the determinant of disease symptom severity in both plants. A single amino acid substitution in the MP was sufficient for changing symptom severity of BBWV2. Our finding provides a role for the MP as a symptom determinant in BBWV2 and increases the understanding of the basis of molecular interactions between host plants and BBWV2., (Copyright © 2017 Elsevier B.V. All rights reserved.)

A nationwide survey was performed to investigate the current incidence of viral diseases in Korean sweet potatoes for germplasm and growing fields from 2011 to 2014. A total of 83.8% of the germplasm in Korea was infected with viruses in 2011. Commercial cultivars that were used to supply growing fields were infected at a rate of 62.1% in 2012. Among surveyed viruses, the incidence of five Potyvirus species that infect sweet potato decreased between 2012 and 2013, and then increased again in 2014. Representatively, the incidence of Sweet potato feathery mottle virus (SPFMV) was 87.0% in 2012, 20.7% in 2013 and then increased to 35.3% in 2014. Unlike RNA viruses, DNA viruses were shown to decrease continuously. The incidence of Sweet potato leaf curl virus (SPLCV) was 5.5% in 2003, 59.5% in 2011, and 47.4% in 2012. It then decreased continuously year by year to 33.2% in 2013, and then 25.6% in 2014. While the infection rate of each virus species showed a tendency to decline, the virus infection status was more variable in 2013 and 2014. Nevertheless, the high rate of single infections and mixed infection combinations were more variable than the survey results from 2012. As shown in the results from 2013, the most prevalent virus infection was a single infection at 27.6%, with the highest rate of infection belonging to sweet potato symptomless virus-1 (SPSMV-1) (12.9%). Compared to 2013, infection combinations were more varied in 2014, with a total of 122 kinds of mixed infection.

The complete genome sequence of a new virus isolated from a longan (Dimocarpus longan Lour.) plant showing witches' broom syndrome was determined. The viral genome is composed of a monopartite single-stranded RNA of 9,428 nucleotides excluding the 3' poly(A) tail and contains one large single open reading frame encoding a polyprotein of 3086 amino acids. BLAST searches of protein databases showed that the encoded polyprotein has a maximum amino acid sequence identity of 35% (with 85% coverage) to that of the isolate Minnesota of rose yellow mosaic virus (RoYMV; family Potyviridae; genus not assigned). Molecular and phylogenetic analysis of the genome and encoded protein sequences showed that the identified virus has the general features that are characteristic of members of the family Potyviridae although it has extremely low sequence similarity to known members of the family Potyviridae. The name longan witches' broom-associated virus (LWBaV) is proposed for this new virus, which may be considered a member of a new genus in the family Potyviridae.

A new virus was isolated from a bellflower (Campanula takesimana) plant showing veinal mottle symptoms, and its complete genome sequence was determined. The viral genome consists of a positive-sense single-stranded RNA of 8,259 ribonucleotides. Electron microscopic observation revealed that the viral genome is packaged as a filamentous particle with an average length of approximately 760 nm. BLAST searches of protein databases showed that the encoded polyprotein has a maximum amino acid sequence identity of 34.1% (with 95% coverage) to that of the isolate AD of Chinese yam necrotic mosaic virus (CYNMV; genus Macluravirus). Phylogenetic analysis and comparison of the encoded amino acid sequences with those of other viruses demonstrated that the identified virus shows minimal sequence similarity to known viruses and should therefore be considered a member of a new genus in the family Potyviridae. The name bellflower veinal mottle virus (BVMoV) is proposed for this new virus.

Bulk-type all-solid-state lithium-ion batteries (ASLBs) for large-scale energy-storage applications have emerged as a promising alternative to conventional lithium-ion batteries (LIBs) owing to their superior safety. However, the electrochemical performance of bulk-type ASLBs is critically limited by the low ionic conductivity of solid electrolytes (SEs) and poor ionic contact between the active materials and SEs. Herein, highly conductive (0.14 mS cm -1 ) and dry-air-stable SEs (Li 4 SnS 4 ) are reported, which are prepared using a scalable aqueous-solution process. An active material (LiCoO 2 ) coated by solidified Li 4 SnS 4 from aqueous solutions results in a significant improvement in the electrochemical performance of ASLBs. Side-effects of the exposure of LiCoO 2 to aqueous solutions are minimized by using predissolved Li 4 SnS 4 solution., (© 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.)

Broad bean wilt virus 2 (BBWV2), which belongs to the genus Fabavirus, is a destructive pathogen of many economically important horticultural and ornamental crops. In this study, we constructed infectious full-length cDNA clones of two distinct isolates of BBWV2 under control of the cauliflower mosaic virus 35S promoter. BBWV2-PAP1 isolated from paprika (Capsicum annuum var. gulosum) induces severe disease symptoms in various pepper varieties, whereas BBWV2-RP1 isolated from red pepper (Capsicum annuum L.) causes mild symptoms. Agrobacterium-mediated inoculation of the infectious cDNA clones of BBWV2-PAP1 and RP1 resulted in the same symptoms as the original virus isolates. The infectious cDNA clones of BBWV2-PAP1 and RP1 were used to examine the symptoms induced by pseudorecombinants between the two isolates to localize in which of the two genomic RNAs are the symptom severity determinants in BBWV2. The pseudorecombinant of RP1-RNA1 and PAP1-RNA2 induced severe symptoms, similar to those caused by the parental isolate PAP1, whereas the pseudorecombinant of PAP1-RNA1 and RP1-RNA2 induced mild symptoms, similar to those caused by the parental isolate RP1. Our results suggest that BBWV2 RNA2 contains a symptom determinant(s) capable of enhancing symptom severity., (Copyright © 2015 Elsevier B.V. All rights reserved.)

The complete genome sequence of a new virus isolated from a bellflower (Campanula takesimana) plant was determined. The genome of this virus is composed of monopartite single-stranded RNA of 11,649 nucleotides in length. BLAST searches of protein databases showed that the encoded polyprotein has a maximum amino acid sequence identity of 42% (with 99% coverage) to the polyprotein of the isolate Orissa of rice tungro spherical virus (RTSV; genus Waikavirus). Phylogenetic analysis strongly supports that the identified virus is a member of a new species of the genus Waikavirus. The name bellflower vein chlorosis virus (BVCV) is proposed for this new virus.

Melon necrotic spot virus (MNSV) was recently identified on watermelon (Citrullus vulgaris) in Korea, displaying as large necrotic spots and vein necrosis on the leaves and stems. The average occurrence of MNSV on watermelon was found to be 30-65% in Hapcheon and Andong City, respectively. Four isolates of the virus (MNSV-HW, MNSV-AW, MNSV-YW, and MNSV-SW) obtained from watermelon plants in different areas were non-pathogenic on ten general indicator plants, including Chenopodium quinoa, while they infected systemically six varieties of Cucurbitaceae. The virus particles purified by 10-40% sucrose density gradient centrifugation had a typical ultraviolet spectrum, with a minimum at 245 nm and a maximum at 260 nm. The morphology of the virus was spherical with a diameter of 28-30 nm. Virus particles were observed scattered throughout the cytoplasm of watermelon cells, but no crystals were detected. An ELISA was conducted using antiserum against MNSV-HW; the optimum concentrations of IgG and conjugated IgG for the assay were 1 μl/ml and a 1:8,000-1:10,000 dilutions, respectively. Antiserum against MNSV-HW could capture specifically both MNSV-MN from melon and MNSV-HW from watermelon by IC/RT-PCR, and they were effectively detected with the same specific primer to produce product of 1,172 bp. The dsRNA of MNSV-HW had the same profile (4.5, 1.8, and 1.6 kb) as that of MNSV-MN from melon. The nucleotide sequence of the coat protein of MNSV-HW gave a different phylogenetic tree, having 17.2% difference in nucleotide sequence compared with MNSV isolates from melon.

Sweet potatoes (Ipomea batatas L.) are grown extensively, in tropical and temperate regions, and are important food crops worldwide. In Korea, potyviruses, including Sweet potato feathery mottle virus (SPFMV), Sweet potato virus C (SPVC), Sweet potato virus G (SPVG), Sweet potato virus 2 (SPV2), and Sweet potato latent virus (SPLV), have been detected in sweet potato fields at a high (~95%) incidence. In the present work, complete genome sequences of 18 isolates, representing the five potyviruses mentioned above, were compared with previously reported genome sequences. The complete genomes consisted of 10,081 to 10,830 nucleotides, excluding the poly-A tails. Their genomic organizations were typical of the Potyvirus genus, including one target open reading frame coding for a putative polyprotein. Based on phylogenetic analyses and sequence comparisons, the Korean SPFMV isolates belonged to the strains RC and O with >98% nucleotide sequence identity. Korean SPVC isolates had 99% identity to the Japanese isolate SPVC-Bungo and 70% identity to the SPFMV isolates. The Korean SPVG isolates showed 99% identity to the three previously reported SPVG isolates. Korean SPV2 isolates had 97% identity to the SPV2 GWB-2 isolate from the USA. Korean SPLV isolates had a relatively low (88%) nucleotide sequence identity with the Taiwanese SPLV-TW isolates, and they were phylogenetically distantly related to SPFMV isolates. Recombination analysis revealed that possible recombination events occurred in the P1, HC-Pro and NIa-NIb regions of SPFMV and SPLV isolates and these regions were identified as hotspots for recombination in the sweet potato potyviruses.

Large conductance Ca(2+)- and voltage-activated potassium (BK) channels are comprised of pore-forming α subunits and various regulatory auxiliary subunits. The BK channel auxiliary γ (BKγ) subunits are a newly identified class of proteins containing an extracellular leucine-rich repeat domain (LRRD), a single transmembrane (TM) segment, and a short cytoplasmic C-terminal tail (C-tail). Although each of the four BKγ proteins shifts the voltage dependence of BK channel activation in a hyperpolarizing direction, they show markedly different efficacies, mediating shifts over a range of 15-145 mV. Analyses of chimeric BKγ subunits created by swapping individual structural elements, and of BKγ deletion and substitution mutants, revealed that differential modulation of BK gating by the four BKγ subunits depends on a small region consisting of the TM segment and the adjacent intracellular cluster of positively charged amino acids. The γ1 and γ2 TM segments contributed approximately -100 mV, and the γ1 and γ3 C-tails contributed approximately -40 mV, to shifting the voltage dependence of BK channel activation, whereas the γ3 and γ4 TM segments and the γ2 and γ4 C-tails contributed much less. The large extracellular LRRDs were mainly functionally interchangeable, although the γ1 LRRD was slightly less effective at enhancing (or slightly more effective at attenuating) the shift in BK channel voltage-dependent gating toward hyperpolarizing potentials than those of the other BKγ subunits. Analysis of mutated BKγ subunits revealed that juxta-membrane clusters of positively charged amino acids determine the functions of the γ1 and γ3 C-tails. Therefore, the modulatory functions of BKγ subunits are coarse- and fine-tuned, respectively, through variations in their TM segments and in the adjacent intracellular positively charged regions. Our results suggest that BK channel modulation by auxiliary γ subunits depends on intra- and/or juxta-membrane mechanisms., (© 2015 Li et al.)

The complete genome sequence of a previously undescribed virus isolated from a yacon plant exhibiting necrotic mottle, chlorosis, stunting, and leaf malformation symptoms in Gyeongju, Korea, was determined. The genome of this virus consists of one circular double-stranded DNA of 7661 bp in size. The genome contained four open reading frames (ORFs 1 to 4) on the plus strand that potentially encode proteins of 26, 32, 234, and 25 kDa. Protein BLAST analysis showed that ORF3, which is the largest ORF, has 45 % amino acid sequence identity (with 89 % coverage) to the ORF3 of fig badnavirus 1 (FBV-1), a recently identified badnavirus. Phylogenetic analysis provided further evidence that the virus identified in this study is probably a member of a new species in the genus Badnavirus. The name yacon necrotic mottle virus (YNMoV) is proposed for this new virus.

Cudrania tricuspidata (Moraceae) is a deciduous tree widely distributed in East Asia, including China, Korea, and Japan. It produces delicious fruit, and its cortex and root bark have been used as a traditional medicine to treat neuritis and inflammation. As C. tricuspidata has become known as a functional food, its cultivation area and production gradually have increased in Korea. However, information of viral disease in C. tricuspidata is very limited. In September 2012, open-field-grown C. tricuspidata trees showing virus-like symptoms of mosaic, yellowing, and distortion on the leaves were found in Naju, Korea. The fruit production in the diseased trees decreased to 20 to 40% of that in healthy trees. To identify causal agent(s), total RNA was isolated from the symptomatic leaves and used to generate a transcriptome library using the TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA) according to the manufacturer's instruction. The transcriptome library was analyzed by next-generation sequencing (NGS) using an Illumina HiSeq2000 sequencer. NGS reads were quality filtered and de novo assembled by the Trinity pipeline, and the assembled contigs were analyzed against the viral reference genome database in Genbank by BLASTn and BLASTx searches (3). The entire NGS procedure was perofrmed by Macrogen Inc. (Seoul, South Korea). Among the analyzed contigs, one large contig (10,043 bp) was of viral origin. Nucleotide blast searches showed that the contig has a maximum identity of 89% (with 100% coverage) to the isolate MS1 (Genbank Accession No. EU761198) of Bean common mosaic virus (BCMV), which was isolated from Macroptilium atropurpureum in Australia. The presence of BCMV was confirmed by a commercially available double-antibody sandwich (DAS)-ELISA kit (Agdia, Elkhart, IN). To confirm the BCMV sequence obtained by NGS, two large fragments covering the entire BCMV genome were amplified by reverse transcription-polymerase chain reaction (RT-PCR) using two sets of specific primers (5'-AAAATAAAACAACTCATAAAGACAAC-3' and 5'-AGACTGTGTCCCAGAGCATTTC-3' to amplify the 5' half of the BCMV genome; 5'-GCATCCTGAGATTCACAGAATTC-3' and 5'-GGAACAACAAACATTGCCGTAG-3' to amplify the 3' half of the BCMV genome) and sequenced. To obtain the complete genome sequence, the 5' and 3' terminal sequences were analyzed by the 5' and 3' rapid amplification of cDNA ends (RACE) method as described previously (1). The assembled full-length sequence of BCMV isolated from C. tricuspidata was 10,051 nucleotides in length without a poly(A) tail. It was deposited in Genbank under the accession number KM076650. BCMV, a member of the genus Potyvirus, is one of the most common viruses naturally infecting legumes, including Phaseolus vulgaris (2). In general, BCMV is known to have a restricted host range outside legume species (2). Therefore, the identification of BCMV from C. tricuspidata in this report is very exceptional. Because BCMV is easily transmitted by various aphids like other potyviruses, a large-scale survey may be required for exact investigation of the BCMV incidence in C. tricuspidata to prevent rapid spread of the virus. To the best of our knowledge, this is the first report of BCMV in C. tricuspidata. References: (1) H.-R. Kwak et al. Plant Pathol. J. 29:274, 2013. (2) M. Saiz et al. Virus Res. 31:39, 1994. (3) S.-E. Schelhorn et al. PLoS Comput. Biol. 9:e1003228, 2013.

The complete genome sequence of a new virus isolated from a motherwort plant exhibiting yellow mottle, mild mosaic, and stunting symptoms in Andong, Korea, was determined. The genome of this virus is composed of two single-stranded RNAs (7068 and 4963 nucleotides in length, respectively) carrying poly(A) tails. RNA1 contains one large open reading frame (RNA1-ORF1), while two potential ORFs (RNA2-ORF1 and RNA2-ORF2) were found in RNA2. BLAST searches of protein databases showed that RNA1-ORF1 and RNA2-ORF2 have maximum amino acid sequence identities of 53 % and 57 % to the RNA1-ORF1 and RNA2-ORF2, respectively, of lettuce necrotic leaf curl virus (LNLCV, a recently identified torradovirus). Phylogenetic analysis provided further evidence that the virus identified in this study is probably a member of a new species in the genus Torradovirus. The name "motherwort yellow mottle virus" (MYMoV) is proposed for this new virus.

Leonurus sibiricus L. (family Lamiaceae) has been used as a traditional herbal remedy to treat various gynecologic diseases. Although it is a widely distributed subtropical weed in Southeast Asia, L. sibiricus have been commercially cultivated on a small scale in many geographic areas of Korea. In August 2012, field-grown L. sibiricus plants showing mosaic, yellowing, and stunting symptoms were collected near a pepper field in Andong, Korea. Since L. sibiricus is only consumed as a raw material of traditional medicine in Korea, symptomatic plants lose commercial value entirely. To identify the causal agent(s) of the virus-like symptoms, total RNA was extracted from the symptomatic leaves, and a transcriptome library was generated using the TruSeq Stranded Total RNA with Ribo-Zero plant kit (Illumina, San Diego, CA) according to the standard protocol. Next-generation sequencing (NGS) was performed using an Illumina HiSeq2000 sequencer. De novo assembly of the quality filtered NGS reads (101-bp paired-end reads) were performed using the Trinity pipeline and the assembled contigs (92,329 contigs) were analyzed against the viral reference genome database in GenBank by BLASTn and BLASTx searches (3). The entire NGS procedure was performed by Macrogen Inc. (Seoul, South Korea). Among the analyzed contigs, only two large contigs were clearly of viral origin. Nucleotide blast searches showed that the first and second contigs (5,914 and 3,534 bp, respectively) have maximum identities of 91 and 95% to RNA1 of the isolate RP3 (GenBank Accession No. JX183225) and RNA2 of the isolate RP7 (JX183234) of Broad bean wilt virus 2 (BBWV-2), which were isolated from pepper in Korea. The NGS results were confirmed by analyzing the sequences of the fragments covering the entire BBWV-2 genome amplified by RT-PCR using specific primers for BBWV-2 as described previously (1). To obtain the complete genome sequence, terminal sequences of both RNA segments were analyzed by the 5' and 3' rapid amplification of cDNA ends (RACE) method as described previously (1). The assembled full-length sequences of BBWV-2 RNA1 and RNA2 isolated from L. sibiricus were 5,951 and 3,575 nucleotides in length, respectively, and deposited in GenBank under the accessions KM076648 and KM076649, respectively. BBWV-2 belongs to the genus Fabavirus in the family Secoviridae and it is known to have a wide host range. To investigate the host range of the BBWV-2 isolated from L. sibiricus, sap from the symptomatic leaves of L. sibiricus was inoculated to the test plants including Nicotiana benthamiana, Capsicum annuum (red pepper), and C. annuum var. gulosum (Paprika). RT-PCR detection and sequencing of the amplicons showed that all the inoculated test plants were infected with the BBWV-2 isolated from L. sibiricus. Currently, BBWV-2 is epidemic in pepper fields in Korea (1,2). Because BBWV-2 is easily transmitted by various aphids, and L. sibiricus is widely distributed in both wild and cultivated fields in Korea, this host might serve as a potential source of BBWV-2 to other crops such as pepper. To the best of our knowledge, this is the first report of BBWV-2 in L. sibiricus. References: (1) H.-R. Kwak et al. Plant Pathol. J. 29:274, 2013. (2) H.-R. Kwak et al. Plant Pathol. J. 29:397, 2013. (3) S.-E. Schelhorn et al. PLoS Comput. Biol. 9:e1003228, 2013.

Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

Studying genetic structure and diversity of viruses is important to understand the evolutionary mechanisms that generate and maintain variations in viral populations. Cucumber mosaic virus (CMV) is endemic in most pepper fields in Korea. Currently, no effective methods for control of CMV are available due to many environmental and biological factors such as the extensive evolutionary capacity of CMV. Thus, analyzing the genetic structure of CMV populations may facilitate the development of strategies for the control of CMV. In this study, 252 pepper (Capsicum annuum) samples showing virus symptoms were collected by field surveys performed throughout Korea in 2007. Reverse-transcription polymerase chain reaction analyses revealed that, in total, 165 collected samples were infected with CMV. Forty-five CMV isolates were randomly selected within each regional subpopulation and analyzed by full-genome sequencing. Analyses of genetic diversity showed that the 2b gene of CMV is under weaker purifying selection than the other genes. Based on the phylogenetic analysis of RNA1, the CMV isolates from pepper were divided into three clusters in subgroup I. Our full-genome sequence-based molecular analyses of the CMV Korean population suggest that the subpopulations of CMV have been geographically localized in pepper fields in Korea.

Glycine max (Soybean) is the most important edible crop in Korea. In Korea, eight viruses have been reported to infect soybean, including Alfalfa mosaic virus (AMV), Cowpea mosaic virus (CPMV), Cucumber mosaic virus (CMV), Soybean dwarf virus (SbDV), Soybean mosaic virus (SMV), Soybean yellow common mosaic virus (SYCMV), Soybean yellow mottle virus (SYMMV), and Peanut stunt virus (PSV) (1). In 2012, Glycine max were observed in Daegu, South Korea, with mosaic and mottling symptoms on leaves. Samples with virus-like symptoms (n = 151) were collected from Daegu including legume genetic resource field. Virus particles were filamentous rod shaped, average length 760 nm, and were analyzed by RT-PCR using specific primers for several Potyviruses and previously reported viruses infecting soybean. Only two samples showing mosaic and mottling symptoms were identified as Clover yellow vein virus (ClYVV) based on RT-PCR using primers specific for ClYVV (5'-GTTGGCTTGGTTGACACTGA-3' and 5'-CTTCGATCATGGATGCACA-3'). The sequences of amplified fragments were 97 to 98% similar with ClYVV. ClYVV is a distinct species in the genus Potyvirus and family Potyviridae. ClYVV is transmitted by several species of aphids and by mechanical inoculation (2). ClYVV was first reported on Gentiana scabra, and the disease has never been reported in soybean fields in Korea. The biological properties and full genome sequence of the selected ClYVV isolate of apparent virus symptoms between two samples were analyzed. The ClYVV isolate was inoculated to local lesion plants, re-isolated from local lesions three times, and propagated in Nicotiana benthamiana, and then named ClYVV-Gm. The ClYVV-Gm induced local lesions on inoculated leaves of N. tabacum cv. Xanthi-nc, Tetragonia expansa, and systemic symptoms on upper leaves of Chenopodium amaranticolor, C. quinoa, and N. clevelandii. The ClYVV-Gm caused mosaic and mottling symptoms on Glycine max cv. Kwangan and Phaseolus vulgaris. The genome of ClYVV-Gm was determined to be 9,584 nucleotides in length (GenBank Accession No. KF975894), and it shared 83% to 97% nucleotide identity with the sequences of 27 previously reported ClYVV isolates including Vicia fava and Pisum sativum. Despite low occurrence of ClYVV in Glycine max, ClYVV has a broad host range including tobacco, weed species, and soybean, which can lead to spreading of the virus. Our results indicate that emergence of ClYVV could become a problem to Leguminosae in Korea. To our knowledge, this is the first biological and molecular report of ClYVV infecting Glycine max in Korea. References: (1) Y. H. Lee et al. Korea Soybean Digest 29:7, 2012. (2) T. Sasaya et al. Phytopathology 87:1014, 1997.

Sweet potato (Ipomoea batatas) is one of the most important crops in eastern Asia, including Korea. Consumption of sweet potato is increasing gradually because of its growing reputation as a health food. Recently, outbreaks of viruses infecting sweet potatoes have increased all over the world, probably because sweet potatoes are produced via vegetative propagation (1,2). In Korea, most sweet potatoes in fields have been infected by a begomovirus, Sweet potato leaf curl virus (SPLCV), and other viruses such as Sweet potato feathery mottle virus, Sweet potato virus G, and Sweet potato latent virus (3). Many countries have monitored sweet potato virus infections in fields as well as in germplasm collections to select virus-free stocks. In 2013, 20 sweet potato plants showing leaf roll symptoms in Muan, South Korea, were collected and analyzed. Total DNA was isolated from sweet potato leaves (Viral Gene-spin Viral DNA/RNA Extraction Kit, iNtRON Biotechnology, Seongnam, Korea) and viral DNA was amplified by rolling circle amplification (RCA, TempliPhi Amplification Kit, GE Healthcare Life Sciences, Uppsala, Sweden) following the manufacturer's instructions. Amplicons were digested by restriction enzyme SacI (TaKaRa Bio, Shiga, Japan) and products were run on a 1.5% agarose gel. A 2.8-kb DNA fragment was purified from a gel, ligated into a pGEM-T easy vector (Promega, Madison, WI), and sequenced (Macrogen, Seoul, Korea). Based on a BLAST search, most of the sequences (36/38) were identified as SPLCV, but two independent clones 2,824 nt in length from sweet potato cv. Sincheonmi were similar to Sweet potato golden vein associated virus (SPGVaV) isolate US:MS:1B-3 (94.38%, GenBank Accession No. HQ333143). The complete genome sequence of the SPGVaV-Korea isolate contained six ORFs, as expected for a typical monopartite begomovirus. The sequence was deposited in GenBank under accession number KF803170. SPGVaV is a whitefly (Bemisia tabaci)-transmitted virus (genus Begomovirus, family Geminiviridae). A phylogenetic analysis that included other begomoviruses that infect sweet potato showed SPGVaV-Korea to segregate with other SPGVaV isolates. SPGVaV has previously only been reported in Brazil and the United States (1). This is the first report of SPGVaV in sweet potato outside of the Americas. References: (1) L. C. Albuquerque et al. Virol. J. 9:241, 2012. (2) E. Choi et al. Acta Virol. 56:187, 2012. (3) H. R. Kwak et al. Plant Pathol. J. 22:239, 2006.

A viral disease causing severe mosaic, necrotic, and yellow symptoms on Vigna angularis var. nipponensis was prevalent around Suwon area in Korea. The causal virus was characterized as Cucumber mosaic virus (CMV) on the basis of biological and nucleotide sequence properties of RNAs 1, 2 and 3 and named as CMV-wVa. CMV-wVa isolate caused mosaic symptoms on indicator plants, Nicotiana tabacum cv. Xanthi-nc, Petunia hybrida, and Cucumis sativus. Strikingly, CMV-wVa induced severe mosaic and malformation on Cucurbita pepo, and Solanum lycopersicum. Moreover, it caused necrotic or mosaic symptoms on V. angularis and V. radiate of Fabaceae. Symptoms of necrotic local or pin point were observed on inoculated leaves of V. unguiculata, Vicia fava, Pisum sativum and Phaseolus vulgaris. However, CMV-wVa isolate failed to infect in Glycine max cvs. 'Sorok', 'Sodam' and 'Somyeong'. To assess genetic variation between CMV-wVa and the other known CMV isolates, phylogenetic analysis using 16 complete nucleotide sequences of CMV RNA1, RNA2, and RNA3 including CMV-wVa was performed. CMV-wVa was more closely related to CMV isolates belonging to CMV subgroup I showing about 85.1-100% nucleotide sequences identity to those of subgroup I isolates. This is the first report of CMV as the causal virus infecting wild Vigna angularis var. nipponensis in Korea.

The full-genome sequences of fourteen isolates of Broad bean wilt virus 2 (BBWV2), collected from broad bean, pea, spinach, bell pepper and paprika plants in Korea during the years 2006-2012, were determined and analyzed comparatively along with fifteen previously reported BBWV2 genome sequences. Sequence analyses showed that RNA-1 and RNA-2 sequences of BBWV2 Korean isolates consisted of 5950-5956 and 3568-3604 nucleotides, respectively. Full-length genome sequence-based phylogenetic analyses revealed that the BBWV2 Korean isolates could be divided into three major groups comprising GS-I (isolates BB2 and RP7) along with isolate IP, GS-II (isolates BB5, P2, P3 and RP3) along with isolate B935, and GS-III including 16 BBWV2 Korean isolates. Interestingly, GS-III appears to be newly emerged and predominant in Korea. Recombination analyses identified two recombination events in the analyzed BBWV2 population: one in the RNA-1 of isolate K and another one in the RNA-2 of isolate XJ14-3. However, no recombination events were detected in the other 21 Korean isolates. On the other hand, out of 29 BBWV2 isolates, 16 isolates were found to be reassortants, of which each RNA segment (i.e. RNA1 and RNA2) was originated from different parental isolates. Our findings suggested that reassortment rather than recombination is a major evolutionary force in the genetic diversification of BBWV population in Korea.

The incidence of Broad bean wilt virus 2 (BBWV2) on red pepper was investigated using the samples obtained from 24 areas of 8 provinces in Korea. Two hundred and five samples (79%) out of 260 collected samples were found to be infected with BBWV2. While the single infection rate of BBWV2 was 21.5%, the co-infection rate of BBWV2 with Cucumber mosaic virus, Pepper mottle virus, Pepper mild mottle virus and/or Potato virus Y was 78.5%. To characterize the genetic diversity of BBWV2 Korean isolates, 7 isolates were fully sequenced and analyzed. Phylogenetic analyses revealed that BBWV2 isolates could be divided largely into two groups as Group I and Group II. Based on the partial sequence analyses, 153 selected BBWV2 isolates were subgrouped into GS-I (21.6%), GS-II (3.9%) and GS-III (56.9%). BBWV2 GS-III, which was predominant in Korea, appears to be a new combination between Group I RNA-1 and Group II RNA-2. Viral disease incidence of BBWV2 on red pepper was under 2% before 2004. However, the incidence was increased abruptly to 41.3% in 2005, 58.2% in 2006 and 79% in 2007. These rapid increases might be related with the emergence of new combinations between BBWV2 groups.

The measurement of the hepatic venous pressure gradient (HVPG) for the estimation of portal hypertension (PH) in cirrhosis has some limitations, including its invasiveness. Hepatic vein arrival time (HVAT), as assessed by microbubble contrast-enhanced ultrasonography (CEUS), is negatively correlated with the histological grade of liver fibrosis because of the associated hemodynamic abnormalities. Anatomical and pathophysiological changes in liver microcirculation are the initial events leading to PH. However, the direct relationship between HVAT and PH has not been evaluated. The present study measured both HVPG and HVAT in 71 consecutive patients with compensated cirrhosis and analyzed the relationship between the two parameters (i.e., the derivation set). Results were validated in 35 compensated patients with cirrhosis at another medical center (i.e., the validation set). The derivation set had HVPG and HVAT values of 11.4 ± 5.0 mmHg (mean ± standard deviation; range, 2-23) and 14.1 ± 3.4 seconds (range, 8.4-24.2), respectively; there was a statistically significant negative correlation between HVPG and HVAT (r(2) = 0.545; P < 0.001). The area under the receiver operating characteristic curve (AUROC) was 0.973 for clinically significant PH (CSPH; HVPG, ≥ 10 mmHg), and the sensitivity, specificity, positive predictive value, negative predictive value, and positive and negative likelihood ratios for CSPH for an HVAT cut-off value of 14 seconds were 92.7%, 86.7%, 90.5%, 89.7%, 6.95, and 0.08, respectively. In addition, a shorter HVAT was associated with worse Child-Pugh score (P < 0.001) and esophageal varices (P = 0.018). In the validation set, there was also a significant negative correlation between HVAT and HVPG (r(2) = 0.538; P < 0.001), and AUROC = 0.953 for CSPH. HVAT was significantly correlated with PH. These results indicate that measuring HVAT is useful for the noninvasive prediction of CSPH in patients with compensated cirrhosis., (Copyright © 2012 American Association for the Study of Liver Diseases.)

New strains of Tobacco leaf curl virus (TbLCV) were isolated from tomato plants in four different local communities of Korea, and hence were designated TbLCV-Kr. Phylogenetic analysis of the sequences of the whole genome and of individual ORFs of these viruses indicated that they are closely related to the Tobacco leaf curl Japan virus (TbLCJV) cluster, which includes Honeysuckle yellow vein virus (HYVV), Honeysuckle yellow vein mosaic virus (HYVMV), and TbLCJV isolates. Four putative recombination events were recognized within these virus sequences, suggesting that the sequence variations observed in these viruses may be attributable to intraspecific and interspecific recombination events involving some TbLCV-Kr isolates, Papaya leaf curl virus (PaLCV), and a local isolate of Tomato yellow leaf curl virus (TYLCV)., (Copyright © 2011 Elsevier B.V. All rights reserved.)