Search

Ancylogastra amphiaula (Meyrick, 1934), comb. n. (Figs 1, 9, 10, 25, 26) Cypholomia amphiaula Meyrick, 1934: 529, 530. Holotype male with labels: 1) Holotype; 2) Elisabethville [Democratic Republic of the Congo, Lubumbashi] 15.XII.1933, Ch. Seydel [legit], 3) GS 4179 Błeszyński; 4) Cypholomia amphiaula Meyrick type; 5) Cypholomia amphiaula S. Błesz [yński] det. Deposited in RMCA. Examined. Diagnosis. Ancylogastra amphiaula (Fig. 1) is similar to A. magnifica Bassi sp. n. (Fig. 2) and A. endroedyi Bassi sp. n. (Fig. 5), but it can be easily distinguished in the more rounded termen of the forewing and in the subdorsal dark stripe that does not reach the subterminal area. The male genitalia (Fig. 9) are characterized by the extremely long phallus and vinculum produced and strongly bifid apically. In the female genitalia, A. amphiaula (Fig. 25) is similar to A. magnifica Bassi sp. n. (Fig. 27) and A. endroedyi Bassi sp. n. (Fig. 28), both described below, but differs in having a stout bifid sterigma, a larger ductus bursae and larger and more strongly sclerotised lateral extension of the ductus bursae. COI barcode sequence of a male from Malawi BC 92323 ZSM, BIN ADF318 (611 bp): TTGAGCAGGAATAGTAGGAACATCTTTAAGTCTTTTAATTCGAGCTGAATTAGGAAATCCTGGTTCATTAATTGGTGATGATCAAATTTATAATACTATTGTAACTGCTCACGCTTTTATTATAATTTTTTTTATGGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCTG ATATGGCTTTCCCCCGAATAAATAATATAAGATTTTGATTACTTCCACCTTCATTAACTCTTTTAATTTCTAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTATACCCCCCCCTTTCATCTAACATTGCTCATGGAGGGGGTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATCTCTTCA ATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAATTAATGGTTTATCATTCGATCAAATACCTTTATTTGTTTGATCTGTTGGTATTACAGCTTTATTACTTCTTCTTTCACTTCCTGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCAGCTGG AGGGGGAGACC. Redescription (Fig. 1). Wingspan 28–32 mm, males slightly smaller than females. Labial palpi four and a half times eye diameter, bronze brown with upper and inner side white. Maxillary palpi subtriangular, bronze brown tipped white. Antenna bipectinate in male, with rami one and a half as long as flagellomere, brown with costa dark brown whitening apically; in female simple, brown. Frons rounded, moderately produced, white. Ocelli and chaetosemata normally developed. Vertex white with median line pale brown. Tegulae white with inner side black. Thorax white. Forewing subrectangular, rounded apex and termen oblique; ground colour dorsally white with scattered black and brown scales; medial stripe blackish brown, slightly enlarging distally and reaching subterminal area; subdorsal stripe narrow, blackish brown, ending postmedially with a distinct dot; subterminal area white with seven black spots and subterminal fascia silvery white; fringes silvery white with both short and long scales tipped grey; underside pale bronze brown. Hindwing dorsally white with light yellow brown suffusion; terminal line narrow, yellowish brown; fringes white; underside white, strongly suffused with brown dorsally. Foreleg bronze brown; mid and hindleg bronze brown with inner side white. Abdomen with first tergite white, second to fourth bronze brown bordered with white, then white bordered pale golden yellow; sternites bronze brown; anal tuft golden yellow. Sclerotisations of male abdominal segment VIII as in Fig. 10. Male genitalia (Fig. 9). Uncus and gnathos equal in length, slender, both slightly curved distally. Tegumen long and narrow. Vinculum stout, strongly produced dorsally and bifid apically. Pseudosaccus drop-shaped, moderate. Juxta large, v-shaped. Valva elongated, ventrobasally reinforced with rounded cucullus; costal arm as long as the valva, stout, subapically enlarged, distally upcurved with rounded apex. Phallus longer than valva + vinculum, broad, straight; vesica with one slender cornutus as long as phallus shaft. Female genitalia (Figs 25, 26). Papillae anales slightly concave medially, with rounded extremities. Apophyses posteriores basally subtriangular, then narrow and slightly curved apically. Abdominal segment VIII rather large and sclerotised, except ventrally. Apophyses anteriores slightly longer than apophyses posteriores, narrow, slightly curved. Sterigma with lamella antevaginalis produced, strongly bifid. Ostium bursae membranous. Ductus bursae shorter than corpus bursae, with a hourglass-shaped sclerotisation basally, then swollen, wrinkled and densely spiny; lateral extension longer than ductus bursae, with shaft large, spiny basally, strongly wrinkled distally and with distal sac membranous. Corpus bursae suboval, wrinkled and scobinate. Distribution. Widespread throughout Central Africa: Angola (NHMUK), Burundi (RMCA), Democratic Republic of the Congo (MHNG, RMCA), Kenya (NHMUK, National Museums of Kenya, Nairobi), Malawi (RCGB), Tanzania (NMHO), Uganda (NHMUK) and Zambia (NHMUK)., Published as part of Bassi, Graziano, Sáfián, Szabolcs, Léger, Théo, Müller, Günter C., Kravchenko, Vasiliy D. & Poltavsky, Alexander N., 2021, Ancylogastra, a new genus of Afrotropical Crambinae, with descriptions of seven new species (Lepidoptera, Pyraloidea, Crambidae), pp. 42-60 in Zootaxa 5052 (1) on pages 46-49, DOI: 10.11646/zootaxa.5052.1.2, http://zenodo.org/record/5566019

Cypholomia Meyrick, 1933: 378 Type series: Cypholomia leptodeta Meyrick, 1933: 378. Type locality: Democratic Republic of the Congo. Remarks. The type species was described from three males syntypes from Elisabethville (currently Lubumbashi, DRC) (ex-coll. Seydel). The examination of the type series, deposited in RMCA, shows that the genus is actually very close to Charltona. The male genitalia differ in the strong development of the vinculum and in the phallus subapically broadened, as opposed to the moderate development of the vinculum and cylindrical phallus in Charltona. A revision of the genus Charltona including examination of Cypholomia leptodeta is needed in order to ascertain the validity of Cypholomia. Meyrick (1934) described two additional species of Cypholomia: C. amphiaula and C. crypsibela. Both have genitalia structure rather different from that of C. leptodeta and are respectively transferred to Ancylogastra Bassi & Poltavsky, gen. n. and Prionotalis, below., Published as part of Bassi, Graziano, Sáfián, Szabolcs, Léger, Théo, Müller, Günter C., Kravchenko, Vasiliy D. & Poltavsky, Alexander N., 2021, Ancylogastra, a new genus of Afrotropical Crambinae, with descriptions of seven new species (Lepidoptera, Pyraloidea, Crambidae), pp. 42-60 in Zootaxa 5052 (1) on page 43, DOI: 10.11646/zootaxa.5052.1.2, http://zenodo.org/record/5566019, {"references":["Meyrick, E. (1930 - 1936) Exotic Microlepidoptera. Taylor and Francis, London, 642 pp."]}

Ancylogastra burundiana Bassi, sp. n. (Figs 7, 16, 17, 29, 30) Holotype male, with labels: 1) Holotypus; 2) Urundi [Burundi]: Kitega [Gitega, approximatively 1500 m a.s.l. and 03°26’S, 29°54’E], 20.X.1965, Dr. M. Fontaine [legit], 3) GS 2441 GB, 4) Ancylogastra burundiana Bassi, Holotype, G. Bassi det. Deposited in RMCA. Paratypes: 1 male, Burundi, Gitega, 29.X.1967, Dr. M. Fontaine, RCGB; 1 female, Burundi, Gitega, 2.III.1968, Dr. M. Fontaine legit, GS 2829 GB, RMCA. Diagnosis. In habitus the species is similar to A. ghanensis sp. n. (Fig. 8) described below, but with forewing termen wider with white ground colour and abdomen paler. In the male genitalia (Fig. 16) the phallus is cylindrical with an apical tooth. In the female genitalia (Fig. 29), the sterigma is larger and less pointed and the ductus bursae is larger and less sclerotised. This and the next two new species described below are very close to each other in having the female genitalia with the lateral extension of the ductus bursae membranous, very short, and delicate (Figs 30–32). Etymology. The name refers to the country where the type series was collected. Description (Fig. 7). Wingspan: males 25–26 mm, female 31 mm. Labial palpi four times as long as eye diameter, brown with upper margin and tip sprinkled with white. Maxillary palpi subtriangular, brown tipped white. Antenna in male shortly bipectinate with rami one and a half times as long as flagellomere; in female simple, brown with costa bronze brown. Frons rounded, gently produced, white with brown dot medially. Ocelli normally developed. Chaetosemata minute. Vertex white. Patagia brown with scattered white scales. Tegulae pale brown. Thorax white sprinkled with brown. Forewing subtriangular, apex rounded, termen large and slightly concave medially; ground colour white with costa darker with scattered brown scales; three irregular dots medio-dorsally, antemedially and in cell; postmedial fascia silvery white, with very distinct brown serrate inner border and weakly serrate brown outer border; subterminal area white with seven subtriangular black spots; terminal line black; fringes silvery white with short scales tipped brown; underside bronze brown suffused with white. Hindwing shiny white in male, shiny white suffused with pale ivory yellow in female; fringes shiny white; underside white suffused with brown along costa. Legs bronze brown with tarsi annulated with white. Abdomen white and pale bronze brown. Tergite of male abdominal segment VIII as in Fig. 17. Male genitalia (Fig. 16). Uncus and gnathos of equal lengths, both slightly curved distally and with narrowly rounded apex. Tegumen long and narrow. Vinculum stout, rounded. Pseudosaccus subconical. Juxta large, cupshaped. Valva simple, ventrobasally bulged, narrowing towards apex; costal arm strongly sclerotised, upcurved and apically pointed. Phallus slightly shorter than valva, almost cylindrical, with rounded apex bearing a triangular tooth; vesica with several minute scobinations. Female genitalia (Figs 29, 30). Papillae anales subrectangular. Apophyses posteriores with base strongly sclerotised, then narrow and apically slightly curved. Abdominal segment VIII more intensely sclerotised ventrally and dorsally. Apophyses anteriores longer than apophyses posteriores, narrow, slightly curved. Sterigma bulged dorsally and broadly subtriangular ventrally. Ostium bursae membranous. Ductus bursae larger than antrum, slightly longer than corpus bursae, strongly sclerotised basally, with a narrowing sclerotised band along its length, ending at inception of ductus seminalis, proximally in corpus bursae; lateral extension small, sclerotised basally and then membranous. Corpus bursae membranous with scobinations laterally and basally. Distribution. Only known from Burundi., Published as part of Bassi, Graziano, Sáfián, Szabolcs, Léger, Théo, Müller, Günter C., Kravchenko, Vasiliy D. & Poltavsky, Alexander N., 2021, Ancylogastra, a new genus of Afrotropical Crambinae, with descriptions of seven new species (Lepidoptera, Pyraloidea, Crambidae), pp. 42-60 in Zootaxa 5052 (1) on pages 53-58, DOI: 10.11646/zootaxa.5052.1.2, http://zenodo.org/record/5566019

Ancylogastra coronata Bassi, sp. n. (Figs 6, 32, 33) Holotype female, with labels: 1) Holotypus; 2) SO Kamerun [Equatorial Guinea], 14.09.[19]08, Uem Gebiet [probably Uelleburg near Benito = Mbini, 01°35’ N, 09° 37’ E], G. Tessmann S.G. [legit]; 2) GS 4055 GB; 3) Ancylogastra coronata Bassi, Holotype, G. Bassi det. Deposited in MFNB. Diagnosis. The bright white ground colour distinguishes A. coronata sp. n. (Fig. 6) from all congeners. The female genitalia (Fig. 33) are close to A. ghanensis sp. n. (Fig. 31) and A. burundiana sp. n. (Fig. 29), but the stout sterigma as opposed the slenderer sterigma of the other two species is diagnostic. Etymology. The name is derived from the Latin coronatus-a = with crown, and refers to the shape of the sterigma in the female genitalia. Description (Fig. 6). Wingspan 28 mm. Labial palpi four times as long as wider diameter of eye, white with a black spot medially. Maxillary palpi white. Frons rounded, slightly produced, white. Antennae thin, serrate, dark brown with silvery white costa. Ocelli well developed; chaetosemata minute. Vertex white. Patagia white, laterally sprinkled with black. Tegulae white, black medially. Thorax white. Forewing slender, with rounded apex and almost straight termen; ground colour off-white sprinkled with silvery white, with basal patch of large scales brown and brown tipped black; two large black dots in cell and medio-dorsally; subterminal fascia gently arched toward costa, silvery white bordered with pale brown; subterminal area pale ivory yellow with seven subterminal black spots; terminal line black; fringes bicoloured silvery white and bronze brown; underside white suffused black brown medially and along costa. Hindwing white with terminal line pale yellowish brown; fringes white; underside white with costa suffused with yellowish brown. Legs white with tarsi annulated with black. Abdomen pale yellow sprinkled with brown. Male unknown. Female genitalia (Figs 32, 33). Papillae anales stout, rounded. Apophyses posteriores arched and apically bulged, with bases irregularly sclerotised. Abdominal segment VIII dorsally sclerotised in basal half. Apophyses anteriores longer than apophyses posteriores, narrow, arched and apically bifid. Sterigma ring-shaped, spiny and weakly sclerotised dorsally, strongly produced and sclerotised, spiny and wrinkled ventrally. Ostium bursae membranous. Ductus bursae larger than antrum, slightly shorter than corpus bursae, with a subtriangular sclerotised band, ending at inception of ductus seminalis, between ductus bursae and corpus bursae; lateral extension small, rounded, membranous. Corpus bursae membranous, subrectangular, scobinate proximally, then delicately wrinkled, with weakly sclerotised row of scobinations medially. Distribution. Only known from the type locality in Equatorial Guinea., Published as part of Bassi, Graziano, Sáfián, Szabolcs, Léger, Théo, Müller, Günter C., Kravchenko, Vasiliy D. & Poltavsky, Alexander N., 2021, Ancylogastra, a new genus of Afrotropical Crambinae, with descriptions of seven new species (Lepidoptera, Pyraloidea, Crambidae), pp. 42-60 in Zootaxa 5052 (1) on pages 58-59, DOI: 10.11646/zootaxa.5052.1.2, http://zenodo.org/record/5566019

Ancylogastra magnifica Bassi, sp. n. (Figs 2, 11, 12, 13, 27) Holotype male with labels: 1) Holotypus; 2) H[au]t Katanga, Tsinkolobwe [Democratic Republic of the Congo, 11°10’S, 26°34’E], 21.XI.[19]30, J. Romieux legit, 3) GS 1417 MHNG 4) GS 2199 GB; 4) Ancylogastra magnifica Bassi, Holotype, G. Bassi det. Deposited in MHNG. Paratypes: 2 males, H[au]t Katanga, Tsinkolobwe, 12.XII.[19]30, J. Romieux legit, GS 6208 GB, MHNG and RCGB; 1 male, 1 female, H[au]t Katanga, Tsinkolobwe, 15.XII.[19]30, J. Romieux legit, MHNG; 1 female, H[au]t Katanga, Sakania, 7.XII.[19]31, J. Romieux legit, GS 5384 GB, MHNG; 1 female, Malawi, Nyika Nat [ional] Park, Juniper Forest, 2340 m, 10°44’S, 22° 53’ E, 22.XII.2010, R. Murphy legit, GS 5333 GB, RCGB; 1 female, Malawi, Kasungu N[ational]P[ark], Black Rock Camp, 1050 m, 13°01’S, 33°07’E, 4.I.2012, V. Kovtunovich legit, GS 6200 GB, RCGB; 1 female, Urundi [Burundi]: Kitega [Gitega, 03°26’S, 29°54’E], 10.XII.1963, Dr. M. Fontaine, GS 6204 GB, RMCA; 1 female, n 1393, N[orth] Rhodesia [Zambia], Solwezi [12°11’S, 26°24’E] 5.XII.52, P. Johnsen, GS 2957 GB, ZMUC. Other material: 1 female, H[au]t Katanga, Panda, 18.XII.1929, J. Romieux legit, MHNG, excluded from type series because the specimen is without abdomen. Diagnosis. Ancylogastra magnifica sp. n. (Fig. 2) externally resembles A. amphiaula (Fig. 1), especially in faint specimens, but the forewing is slightly broader, with apex less rounded and termen almost straight, and the black median stripe is larger and reaches the termen. In the male genitalia, a shorter uncus and gnathos, the v-shaped juxta, a shorter vinculum, and a shorter phallus distinguish A. magnifica sp. n. (Figs 11, 12) from A. amphiaula (Fig. 9). The female genitalia of A. magnifica sp. n. (Fig. 27) have an almost rounded sterigma, a narrow and longer ductus bursae with a lateral arm narrow with a large and sclerotised distal sac, as opposed to the bifid sterigma and the small distal sac of A. amphiaula (Fig. 25). Etymology. The new species derives its name from the Latin magnificus-a = marvellous, referring to the very nice habitus of the adult. Description (Fig. 2). Wingspan: males 27–28 mm, females 27–31 mm. Labial palpi four times as long as eye diameter, dark brown with upper and inner side white. Maxillary palpi subtriangular, dark brown tipped white. Antenna bipectinate in male, with rami twice as long as flagellomere, brown with costa dark brown; in female simple, brown with costa blackish brown becoming paler distally. Frons rounded, moderately produced, white suffused with pale yellow. Ocelli and chaetosemata normally developed. Vertex white. Tegulae white with inner side black. Thorax white, suffused with pale yellow. Forewing subtriangular, with rounded apex and termen large and straight; ground colour white with scattered black and brown scales; medial stripe blackish brown, enlarging distally and reaching termen, subdorsal stripe narrow, blackish brown, reaching termen; subterminal area poorly defined by a white and brown inner fascia; seven black subterminal dots; fringes silvery white with short scales tipped bronze brown; underside brown suffused with white. Hindwing white with brown suffusion and brown terminal line below apex; fringes white; underside white suffused with brown along costa. Foreleg bronze brown; mid and hindleg bronze brown with inner side white. Abdomen grey with first segments bordered with brown; sternites grey brown; anal tuft ivory yellow. Sclerotisations of male abdominal segment VIII as in Fig. 13. Male genitalia (Figs. 11, 12). Uncus slightly longer than gnathos, almost straight and with rounded apex. Gnathos with slightly upcurved tip. Tegumen very long and narrow. Vinculum stout, caudally bifid. Pseudosaccus subconical, small. Juxta large, v-shaped, folded apically. Valva elongated, five times longer than average width, with ventrobasal bulge and rounded cucullus; costal arm longer than valva, narrow, strongly sclerotised, distally upcurved and with acuminate apex. Phallus short, two-thirds of valva length, broad, distally upcurved; vesica with one small subtriangular cornutus and scattered scobinations. Female genitalia (Fig. 27). Papillae anales elongated, with rounded extremities. Apophyses posteriores basally drop-like, then very narrow and slightly curved apically. Abdominal segment VIII subrectangular, moderately sclerotised.Apophyses anteriores slightly longer than apophyses posteriores, narrow, slightly curved. Sterigma with lamella antevaginalis slightly produced, rounded or slightly concave medially. Ostium bursae moderately sclerotised. Ductus bursae twice longer than corpus bursae, with a short hourglass-shaped sclerotisation basally, then wrinkled and partially scobinate; lateral extension longer than ductus bursae, arm narrow and sclerotised, distal sac spongy and sclerotised in posterior half of its length. Corpus bursae suboval, membranous with rows of scobinations basally and medially. Distribution. Widespread in Central Africa: Burundi, Democratic Republic of the Congo, Malawi and Zambia., Published as part of Bassi, Graziano, Sáfián, Szabolcs, Léger, Théo, Müller, Günter C., Kravchenko, Vasiliy D. & Poltavsky, Alexander N., 2021, Ancylogastra, a new genus of Afrotropical Crambinae, with descriptions of seven new species (Lepidoptera, Pyraloidea, Crambidae), pp. 42-60 in Zootaxa 5052 (1) on pages 49-50, DOI: 10.11646/zootaxa.5052.1.2, http://zenodo.org/record/5566019

Ancylogastra boireaui Bassi & Sáfián, sp. n. (Figs 3, 14, 15, 34, 36) Holotype male with labels: 1) Holotypus; 2) Guinea, Nimba Mountains, Richard Molard Camp, 1382 m, 1-8.vi.2019, at light, 07°36’N, 08°25’W, S. Sáfián legit, 3) Ancylogastra boireaui Bassi & Sáfián, Holotype, G. Bassi det. Deposited in RCGB. Paratypes: 4 males, 3 females, same data as holotype, GS 6630, 6655, 6860, 6870 and 6882 GB; MFNLEP099, MFNLEP100 and MFNLEP101, RCGB, MHNG. Diagnosis. Ancylogastra boireaui sp. n. (Fig. 3) is characterized by the black brown forewing, suffused with yellow. Externally the species resembles A. gangraensis sp. n. (Fig. 4) described below, but A. boireaui sp. n. is more intense in ground colour and clearly larger wingspan (25–31 mm vs. 15–23 mm). In male genitalia (Fig. 14) the slender costal arm medially bent inward and the large cornutus distinguish A. boireaui sp. n. from its congeners. The female genitalia (Fig. 34) of A. boireaui sp. n. are characterized by the strongly produced and pointed sterigma and the stout extension of the ductus bursae, unlike those of all congeners. COI barcode sequence of MFNLEP100, BOLD ID = AFROC005-20 (646 bp): AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGTCTATTAATTCGAGCTGAATTAGGAAATCCAGGTTCATTAATTGGTGATGATCAAATTTATAATACTATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATCATAATTGGTGGATTTGGTAATTGATTAG TTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAACATAAGATTTTGACTACTTCCTCCTTCATTAACCCTTTTAATTTCTAGAAGAATTGTTGAAAACGGAGCAGGAACAGGATGAACAGTATATCCCCCCCTTTCGTCTAATATTGCTCACGGTGGAGGATCAGTTGATTTAGCTATTTTTTCC TTACATTTAGCTGGTATTTCCTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATGGATTATCTTTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCTTTATTACTCCTTCTTTCTCTTCCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTCTTTGATCCAGCTGGAGGAGGAGATCCTATTCTCTAT Etymology. Named after Patrick Boireau, French lepidopterist, who has been working in the Nimba and Ivory Coast for decades. Description (Fig. 3). Wingspan: males 25–27 mm, females 30–31mm. Labial palpi four and a half times as long as eye diameter, charcoal grey with dorsal side off-white. Maxillary palpi subtriangular, charcoal tipped offwhite. Antenna strongly bipectinate in male, with rami four times as long as flagellomere, black with costa charcoal lightening apically; in female simple, brown with costa grey. Frons rounded, moderately produced, yellow with dark dot medially. Ocelli and chaetosemata normally developed. Vertex off-white with raised scales. Patagia pale yellow. Tegulae pale yellow with inner side black. Thorax off-white to pale yellow. Forewing subrectangular, with rounded apex and slightly oblique termen; ground colour black brown suffused with yellow, pale brown and off-white; costal line black; costal stripe white bordered yellow; medial stripe originates from one-third of length of wing, white bordered blackish brown, reaching subterminal area; subdorsal stripe large, white; dorsum yellowish white sprinkled with black; subterminal area white with seven rectangular black spots and subterminal fascia arched, silvery white bordered yellow; fringes silvery white with both short and long scales tipped grey; underside charcoal with costa partially yellow; fringes with both short and long scales yellow tipped grey. Hindwing white with yellow suffusion; fringes white with pale yellow basal suffusion; underside white, strongly suffused with brown dorsally; fringes with short scales off-white tipped grey and long scales white tipped grey. Foreleg bronze brown; mid and hindleg bronze brown with inner side white. Abdomen off-white. Tergite of male abdominal segment VIII as in Fig. 15. Male genitalia (Fig. 14). Uncus slightly longer than gnathos, slightly curved distally. Gnathos almost straight, with rounded apex. Tegumen long and narrow. Vinculum stout, caudally bifid. Pseudosaccus subconical, small. Juxta large, broadly v-shaped. Valva elongated, narrowing toward apex; costal arm slightly longer than valva, narrow, distally strongly upcurved and with acuminate apex. Phallus broad, slightly shorter than valva, with blunt apex; vesica with one large and arched cornutus. Female genitalia (Figs 34, 36). Papillae anales rounded in dorso-lateral view. Apophyses posteriores basally subtriangular, then slightly arched and medially bulged. Abdominal segment VIII wavy, moderately sclerotised. Apophyses anteriores basally enlarged, then narrow, slightly curved. Sterigma jagged dorsally, triangular and strongly produced ventrally. Ostium bursae membranous, bordered by a sclerotised ring. Ductus bursae narrower than ostium bursae, longer than corpus bursae, with moderate sclerotisation along its length, ending at inception of ductus seminalis; lateral extension short, large, jagged, strongly sclerotised medially. Corpus bursae membranous, delicately wrinkled. Distribution. Only known from the type locality in Guinea. Remarks. The adults were attracted to an artificial light in a mixed vegetation habitat around Richard Molard Camp, 1382 meters a.s.l., Nimba Mountains (Fig. B)., Published as part of Bassi, Graziano, Sáfián, Szabolcs, Léger, Théo, Müller, Günter C., Kravchenko, Vasiliy D. & Poltavsky, Alexander N., 2021, Ancylogastra, a new genus of Afrotropical Crambinae, with descriptions of seven new species (Lepidoptera, Pyraloidea, Crambidae), pp. 42-60 in Zootaxa 5052 (1) on pages 51-52, DOI: 10.11646/zootaxa.5052.1.2, http://zenodo.org/record/5566019

Ancylogastra gangraensis Bassi, Sáfián, Müller & Kravchenko, sp. n. (Figs 4, 21–24, 35, 37) Holotype male: 1) Holotypus; 2) Liberia, Nimba County, Nimba Mountains, Western Range, Mount Gangra, Western slope, 7°33’29.73”N, 8°38’16.40”W, 648 m. a.s.l., 20.III.2017, Sáfián, Sz., Simonics, G. Leg[unt], 3) Ancylogastra gangraensis Bassi Sáfián, Müller & Kravchenko, Holotype, G. Bassi det. Deposited in SMTA. Paratypes: 1 female, same data as holotype; 1 male, 1 female, same data as holotype, but 23.III.2017; 2 females, Liberia, Nimba County, Nimba Mountains, ENNR [East Nimba Nature Reserve], 700 m a.s.l., Cellcom Road: 7°32’46.88”N, 8°32’1.14”W, Elevation: 700 m a.s.l., 27.III.2017 and 31.III.2017, Leg[unt] Sáfián, Sz., Simonics, G., SMTA; 1 male, 2 females, Guinea, Nimba Mountains, Richard Molard Camp, 1382 m, 1-8.vi.2019, at light, 07°36’N, 08°25’W, S. Sáfián legit, GS 6666 and 6690 GB, RCGB. Diagnosis. Ancylogastra gangraensis sp. n. (Fig. 4) is characterized by the brown, white-streaked forewing. Externally the species resembles A. boireaui sp. n. (Fig. 3), which is more intense in ground colour and clearly larger wingspan (25–31 mm vs. 15–23 mm). In male genitalia the slender and inwardly bent apex of the costal arm and the tridentate cornutus distinguish A. gangraensis sp. n. (Fig. 21) from its congeners. The female genitalia of A. gangraensis sp. n. (Fig. 35) are characterized by the large globular extension of the ductus bursae, which is unlike that of all congeners. Etymology. The new species derives its name from the type locality, on Mount Gangra. Description (Fig. 4). Wingspan: males 15–23 mm, females 16–21 mm. Labial palpi four times as long as wider diameter of eye, brown with upper and inner sides white. Maxillary palpi subtriangular, brown tipped white with inner side white. Antenna bipectinate in male, scape thickened, off-white, rami as long as flagellomere, brown with silvery brown costa; in female coloured as in male, but slightly serrate. Frons rounded, slightly produced, pale brown sprinkled with white. Ocelli poorly developed. Chaetosemata well developed. Vertex white with thin distal line brown. Patagia and thorax pale brown. Tegulae pale brown with inner side brown. Forewing ground colour brown with subapical area, interveins and subdorsal stripe white; subdorsal stripe dorsally bordered dark brown and ending before termen; postmedial fascia white with brown borders, large and widely concave subapically; subterminal area white with seven elongated subterminal spots; apex rounded; termen oblique; fringes bright white with both short and long scales tipped silvery grey; underside brown with terminal spots visible. Hindwing off-white; fringes white; underside off-white distinctly suffused brown dorsally. Legs brown with inner side white and well-developed tibial spurs. Abdomen ivory yellow with anal tuft more intense. Sclerotisations of male abdominal segment VIII as in Figs 22, 23. Male genitalia (Figs 21, 24). Uncus slightly shorter than gnathos, moderately curved. Gnathos slender, with rounded, slightly upcurved tip. Tegumen subtriangular. Vinculum subrectangular, with thick border and small bifid dorsal projection. Juxta broad, v-shaped. Pseudosaccus suboval. Valva elongated, narrowing towards cucullus; costa strongly sclerotised in first half, with long and slender costal arm apically bent inwards; sacculus simple. Phallus shorter than valva, almost straight, with apex slightly produced dorsally; vesica with single tridentate cornutus. Female genitalia (Figs 35, 37). Papillae anales drop-shaped. Apophyses posteriores longer than apophyses anteriores basally lightly sclerotised, then strongly sclerotised, wavy and with an inner tooth submedially. Abdominal segment VIII narrow and larger ventrally. Sterigma ventrally subtriangular, produced; dorsally with U-shaped reinforcement. Ostium bursae membranous. Ductus bursae wrinkled, longer than corpus bursae, with large globular extension sponge-like and wrinkled. Corpus bursae suboval, slightly wrinkled. Distribution. Known from Liberia and Guinea, at elevations between 648 and 1382 meters a.s.l. Remarks. The adults were attracted to an artificial light in a mixed vegetation habitat. The settling of a giant iron mine wiped out the whole summit of Mount Gangra and thus destroyed the type locality. Its discovery on Mount Nimba (Richard Molard) in Guinea (Fig. B) suggests that fortunately the species is widespread along the whole Nimba Mountains chain.

Ancylogastra ghanensis Bassi, sp. n. (Figs 8, 18–20, 31) Holotype male with labels: 1) Holotypus; 2) Ghana, Volta region, Amezdofe, 830 m, 06°52’ N 0°26’ W, Dr. S. Endrődy-Younga [legit] 3) nr. 273, at light, 1.IX.1967 4) Ancylogastra ghanensis Bassi, Holotype, G. Bassi det. Deposited in HNHM. Paratypes: 6 males, 3 females, same data as holotype, GS 5481, 6195, 6199, 6220, 6246 GB, HMNH and RCGB. Diagnosis. In habitus (Fig. 8) close to A. burundiana sp. n. (Fig. 7), but with forewing narrower and in yellowish white ground colour, and abdomen yellow. In the male genitalia (Fig. 18) the phallus is distally swollen and curved, without apical tooth. In the female genitalia (Fig. 31) the sterigma is narrower and more pointed and the ductus bursae is narrower and more sclerotised. Etymology. The name of the new species refers to the name of the country of origin of the type series. Description (Fig. 8). Wingspan: males 20–24 mm, females 24–29 mm. Labial palpi four times as long as eye diameter, dark brown with dorsal margin more or less white with subapical dark brown dot. Maxillary palpi subtriangular, dark brown tipped white. Antenna in male bipectinate, with rami one and a half times as long as flagellomere, dark brown with costa brown sprinkled with white; in female simple, brown. Frons rounded, slightly produced, brown sprinkled with white. Ocelli and chaetosemata poorly developed. Vertex white with brown dot medially. Tegulae white sprinkled with brown and dark brown. Thorax dark brown sprinkled with white. Forewing ground colour yellowish white, sprinkled with silvery, brown and dark brown scales; costal margin brown up to two thirds its length; dorsum dark brown mixed with brown and white; medial fascia large, dark brown, ill-defined to zig-zag shaped; medial dot large, subrectangular, blackish brown; postmedial fascia silvery white, with brown borders, especially the inner one strongly dentate; subterminal area ivory yellow with seven black subterminal spots; terminal line black; apex rounded; termen straight to slightly concave; fringes bicoloured white and silvery grey; underside bronze brown with termen and dorsal line white. Hindwing shiny white suffused with pale ivory yellow; terminal line black brown; fringes bright white; underside white strongly suffused with brown along costa. Foreleg brown with tarsi annulated with white; mid and hindleg white with tarsi annulated with brown. Abdomen in males ivory yellow; in females more yellow with tergites often bordered with pale golden yellow and with yellow anal tuft. Sclerotisations of male abdominal segment VIII as in Figs 19, 20. Male genitalia (Fig. 18). Uncus and gnathos of equal length, both slightly curved distally and with thinly rounded apex. Tegumen long and narrow. Vinculum rounded. Pseudosaccus subconical. Juxta v-shaped. Valva simple, narrowing towards apex; costal arm strongly upcurved beyond middle, pointed. Phallus shorter than valva, bulged and downcurved towards apex; vesica with small sclerotised plates and several scobinations. Female genitalia (Fig. 31). Papillae anales stout, bulged ventrally. Apophyses posteriores basally narrow and medially bulged, then stout and slightly arched. Abdominal segment VIII almost parallel-margined, less sclerotised ventrally. Apophyses anteriores slightly longer than apophyses posteriores, narrow and almost straight. Sterigma bulged dorsally and acutely subtriangular ventrally. Ostium bursae lightly sclerotised. Ductus bursae basally funnelshaped, slightly longer than corpus bursae, strongly sclerotised basally, with a subtriangular sclerotised band along its length, ending at inception of ductus seminalis, proximally in corpus bursae; lateral extension narrow, very short, sclerotised basally and then membranous. Corpus bursae suboval, membranous, wrinkled. Distribution. Only known from the type locality in Ghana., Published as part of Bassi, Graziano, Sáfián, Szabolcs, Léger, Théo, Müller, Günter C., Kravchenko, Vasiliy D. & Poltavsky, Alexander N., 2021, Ancylogastra, a new genus of Afrotropical Crambinae, with descriptions of seven new species (Lepidoptera, Pyraloidea, Crambidae), pp. 42-60 in Zootaxa 5052 (1) on pages 59-60, DOI: 10.11646/zootaxa.5052.1.2, http://zenodo.org/record/5566019

Prionotalis crypsibela (Meyrick, 1934), comb. n. Cypholomia crypsibela Meyrick, 1934: 530. Type locality: Democratic Republic of the Congo Type material: 4 males and 4 females (syntypes), deposited in RMCA. Examined. Remarks. Described from four males and four females from Elisabethville (currently Lubumbashi, DRC) (ex-coll. Seydel). It seems rather common in the Katanga Province, as several specimens are present not only in RMCA, but also in NHMUK and MHNG. Its genitalia are characteristic of Prionotalis Hampson, 1919 (see Bassi, 2016: 13, Fig 8, 11). The species will be fully reviewed in a forthcoming paper on this genus., Published as part of Bassi, Graziano, Sáfián, Szabolcs, Léger, Théo, Müller, Günter C., Kravchenko, Vasiliy D. & Poltavsky, Alexander N., 2021, Ancylogastra, a new genus of Afrotropical Crambinae, with descriptions of seven new species (Lepidoptera, Pyraloidea, Crambidae), pp. 42-60 in Zootaxa 5052 (1) on page 44, DOI: 10.11646/zootaxa.5052.1.2, http://zenodo.org/record/5566019, {"references":["Bassi, G. (2016) Studies on Afrotropical Crambinae (Lepidoptera, Pyraloidea, Crambidae): Notes on the genus Aurotalis Bleszynski, 1970. Revue suisse de zoologie, Geneve, 123 (1), 11 - 20. https: // doi. org / 10.5281 / zenodo. 46283"]}

Ancylogastra endroedyi Bassi, sp. n. (Figs 5, 28) Holotype female with labels: 1) Holotypus; 2) Ghana, Northern Region, Banda-Nkwanta, 150m, 08°22’N 02°08’W, Dr. S. Endrödy-Younga [legit]; 3) N[umbe]r 71, light trap, 5-8.IX.1965; 4) GS 5472 GB, 5) Ancylogastra endroedyi Bassi, Holotype, G. Bassi det. Deposited in HNHM. Diagnosis. In size, A. endroedyi sp. n. (Fig. 5) is similar to A. amphiaula (Fig. 1), but it has a yellowish white ground colour in contrast to the greyish white ground colour of A. amphiaula. The female genitalia of A. endroedyi sp. n. (Fig. 28) are similar to those of A. amphiaula (Fig. 25) and A. magnifica sp. n. (Fig. 27), differing in the more rounded papillae anales, the poor sclerotisation of abdominal segment VIII, the slender and strongly bifid lamella antevaginalis of the sterigma and the smaller lateral extension of the ductus bursae with its shaft only half sclerotised. Etymology. Named after Sebestyén Endrődy-Younga, collector of many, very valuable entomological specimens throughout Africa. Description (Fig. 5). Wingspan 27 mm. Labial palpi four times as long as eye diameter, brown with upper half white. Maxillary palpi subtriangular, dark brown tipped white. Antenna simple, off-white with costa bronze brown. Frons rounded, moderately produced, white. Ocelli and chaetosemata poorly developed. Vertex white. Tegulae and thorax brown. Forewing ground colour yellowish white with scattered brown scales; with subrectangular dot in cell; brown stripe dividing in thinner stripes after cell; subterminal fascia narrow, angled at apex, silvery white bordered pale brown; terminal line brown; seven brown subterminal spots; apex rounded; termen slightly oblique; fringe pale grey with short scales white tipped brown; underside white strongly suffused with yellow brown. Hindwing bright white with light yellow suffusion; fringes concolorous; underside white with costal yellow brown suffusion. Legs bronze brown. Abdomen white. Male unknown. Female genitalia (Fig. 28). Papillae anales rounded, weakly sclerotised. Apophyses posteriores basally rounded, then narrow and apically slightly curved. Abdominal segment VIII subrectangular, poorly sclerotised. Apophyses anteriores slightly longer than apophyses posteriores, strongly sclerotised basally, narrow, slightly curved. Sterigma with lamella antevaginalis strongly bifid. Ostium bursae membranous. Ductus bursae longer than corpus bursae, with wrinkled sclerotisations basally, then wrinkled and partially scobinate; lateral extension longer than ductus bursae, with shaft narrow and partially sclerotised with distal sac sponge-like and lightly sclerotised. Corpus bursae suboval, membranous with rows of scobinations basally and medially. Distribution. Only known from Ghana., Published as part of Bassi, Graziano, Sáfián, Szabolcs, Léger, Théo, Müller, Günter C., Kravchenko, Vasiliy D. & Poltavsky, Alexander N., 2021, Ancylogastra, a new genus of Afrotropical Crambinae, with descriptions of seven new species (Lepidoptera, Pyraloidea, Crambidae), pp. 42-60 in Zootaxa 5052 (1) on pages 50-51, DOI: 10.11646/zootaxa.5052.1.2, http://zenodo.org/record/5566019

Ancylogastra Bassi & Poltavsky, gen. n. Type species: Cypholomia amphiaula Meyrick, 1934 Diagnosis. Medium to large sized species, somewhat similar to Ancylolomia Staudinger and Charltona members, from which it is distinguished by the longer labial palpi, at least three times eye diameter, and by the larger termen of the forewing, 0.33 to 0.45 as long as the forewing length. Usually, coloured dots are found along termen in Crambinae, but in Ancylogastra, gen. n., these are long drop-like or stripy spots crossing the subterminal area. The male genitalia are characterized by the full development of the costal process, conspicuous vinculum, broad and sometimes extremely long phallus, half to twice as long as valva. The female genitalia are distinguished from the closely related genera by the presence of a more or less developed lateral extension of the ductus bursae. The species of the melanothoracia - prepiella complex (Bassi & Trematerra 2014) in the inornata species group of Ancylolomia (Błeszyński 1970; Bassi 2013, 2019) also have a lateral extension, but it takes its origin basally from the corpus bursae. Etymology. The generic name is a S. Błeszyński’s manuscript name. The prefix Ancylo- recalls to Ancylolomia, referring to the similarities between the two genera, while - gastra means “bulging container”, possibly referring to the extra pouch found in female genitalia. The gender of the new genus is feminine. Description. Medium to large sized species, with labial palpi at least three times as long as eye diameter, broad forewing with termen from a third to a half of the length of the wing at the apex wide and well developed subterminal area. Sclerotisations of abdominal segment VIII, especially of tergite, are characteristic of each species. Male genitalia. Uncus and gnathos fully developed. Tegumen with slender arms, tegumen roof one fourth to a half of tegumen arm length. Vinculum stout, square to strongly produced dorsally. Juxta broad, v-shaped. Pseudosaccus always present. Valva elongated to strongly elongated, tapering towards apex, ventrobasally often bulged near pseudosaccus; costal process always strongly developed, half as long to as long as valva. Phallus stout to slender, weakly slerotised, half to twice as long as valva. Female genitalia. Papillae anales well developed, often rounded. Apophyses well developed, roughly as long as papillae anales. Sterigma well developed, often anteriorly produced. Ostium membranous. Ductus bursae elongated, with more or less extended sclerotisation and always bearing a more or less developed lateral extension. Ductus seminalis originating between ductus bursae and corpus bursae. Corpus bursae oval, without genuine signum, but often with rows of dense spines. Distribution and biology. Widespread in Central and Western Africa, with centre of distribution presumably in Western Africa, where four species, all endemic, are present. The biology is unknown. Systematic position. This genus is part of tribe Ancylolomiini Ragonot (Léger et al. 2019: 769). The stout adult and the well-developed subterminal area of the forewing positions it close to Ancylolomia and Charltona. The wing venation matches perfectly with Błeszyński’s (1965: 401) figure of Ancylolomia. The narrow tegumen, slender valva with strongly developed costal arm and well developed vinculum in male genitalia suggest that Ancylogastra gen. n. is closely related to the inornata species group of Ancylolomia. In the female genitalia the characteristic lateral extension of the ductus bursae places the genus close to the melanothoracia-prepiella complex of the inornata species group of Ancylolomia. Only very few barcoded specimens of Ancylogastra gen. n. and allied genera exist for a comprehensive DNA comparison. A single male specimen of Ancylogastra amphiaula as well as three specimens of A. boireaui sp. n. were successfully barcoded. The Maximum Likelihood analysis recovered Ancylogastra gen. n. as monophyletic (bootstrap= 96) with respect to other African genera of Ancylolomiini sampled here (Ancylolomia, Aurotalis Błeszyński and Charltona) (Table A, Fig. A). However, analysis of the COI barcode alone is not sufficient and will requires a larger dataset in order to be conclusive on the relationships with other genera of Ancylolomiini., Published as part of Bassi, Graziano, Sáfián, Szabolcs, Léger, Théo, Müller, Günter C., Kravchenko, Vasiliy D. & Poltavsky, Alexander N., 2021, Ancylogastra, a new genus of Afrotropical Crambinae, with descriptions of seven new species (Lepidoptera, Pyraloidea, Crambidae), pp. 42-60 in Zootaxa 5052 (1) on pages 44-46, DOI: 10.11646/zootaxa.5052.1.2, http://zenodo.org/record/5566019, {"references":["Bassi, G. & Trematerra, P. (2014) The Crambinae from Ethiopia and Mozambique collected by the University of Molise expeditions in 2008 and 2009 (Lepidoptera: Pyraloidea: Crambidae, Crambinae). Entomologia, 2, 35 - 45. https: // doi. org / 10.4081 / entomologia. 2014.160","Bleszynski, S. (1970) A revision of the Oriental species of the genus Ancylolomia Hubner (Studies on the Crambinae, Lepidoptera, Pyralidae, Part 49). Tijdschrift voor Entomologie, 113, 27 - 43.","Bassi, G. (2013) Revisione delle specie afrotropicali del genere Ancylolomia Hubner, [1825] (Lepidoptera: Pyralidae, Crambinae). I: i gruppi indica e chrysargyria. Shilap Revista de Lepidopterologia, 41 (164), 517 - 529.","Bassi, G. (2019) Crambidae: Crambinae. In: Mey, W. & Kruger, M. (eds.): The Lepidoptera fauna of Asante Sana in the Great Escarpment of South Africa. Esperiana Memoir, 8, 299 - 313.","Leger, T., Landry, B. & Nuss, M. (2019) Phylogeny, character evolution and tribal classification in Crambinae and Scopariinae (Lepidoptera, Crambidae). Systematic Entomology, 44, 757 - 776. https: // doi. org / 10.1111 / syen. 12353","Bleszynski, S. (1965) Crambinae. In: Amsel, H. G., Gregor, F. & Reisser, H. (Eds.), Microlepidoptera Palaearctica. 1 (1 - 2). Georg Fromme & Co., Wien, pp. i - l + 1 - 553, pls. 1 - 133."]}

В статье рассматривается проблема дефицит пищевого белка и возможные пути ее решения. С экологических позиций проанализированы достоинства и недостатки сырьевой базы животного и растительного белка. Охарактеризованы перспективы производства горохового протеина. There are discussed the problem of nutritional protein deficiency and possible ways to solve it. The advantages and disadvantages of the raw material base of animal and vegetable protein are analyzed from the ecological positions . The prospects for the production of pea protein are characterized.

Available information on the Israeli plume moths is rather scarce and outdated. Prior to our investigation, 41 species were recorded from the country. The material from the Steinhardt Museum of Natural History in Tel Aviv yielded another four species: Agdistis bellissima Arenberger, 1975; Marasmarcha ehrenbergiana (Zeller, 1841); Pterophorus pentadactyla (Linnaeus, 1758); and Wheeleria so­beidae (Arenberger, 1981). Five species are endemics or sub-endemics of Israel: Hellinsia aegyptiacus (Rebel, 1914); Hellinsia scholastica (Meyrick, 1924); Agdistis pygmaea Amsel, 1955; Agdistis nigra Amsel, 1955; Capperia fletcheri Adamczewski, 1951. The diversity of ecologies in Israel suggests that the plume moth fauna in the country may substantially increase through a targeted collection effort.

The history of studies of the Crambidae in Israel is summarized. Prior to this study, 104 species of the Crambidae were recorded in Israel according to published surveys. Another 56 grass moth species have been found in the Steinhardt Museum of Natural History, Tel Aviv, thus increasing the Israeli fauna of the Crambidae to 160 species, although the historical record of Chilo suppressalis in Israel was apparently based on misidentification. A checklist of all species with remarks on their general distribution pattern, distribution in Israel, flight periods and host plants is compiled.

During a moth diversity survey, 106 species of Pyraloidea were collected in March and April 2017 in the Nimba Mountains (East Nimba Nature Reserve and Mount Gangra) in Liberia. In total, 86 species were identified and for another ten species identification was provided to the genus level only. Seventy six of the 86 species are new records for Liberia. The majority of species (54) are purely Afrotropical, nine species are cosmopolitan, while the remaining species are Palaeotropic in their distribution pattern. It is estimated that the present research endeavour reflects no more than 30% of pyraloid diversity in the region and future collecting efforts may increase the species list three-fold.

Seventeen species of Noctuoidea (Lepidoptera) are newly recorded for Israel, bringing the owlet moth fauna to 565 species. Four species are new records for the Levant, others have been known from Lebanon, Cyprus, Syria, and Jordan. Most of new records are done in the northern and southern parts of the country. The ‘southern’ group is represented by the Afrotropical and Pan-Eremic species, which reached the northern limit of their distribution. The ‘northern’ group is represented by species on the southern border of their distribution, including Trans-Palearctic and Mediterranean elements at the forested medium elevations, the Mediterranean–Iranian species in the montane steppes, and the alpine and xeromontane species at elevations over 2000 m. The pattern of occurrence of the new records reflects the position of Israel in the region as a transitional area between a more humid Mediterranean part in the north and a more arid part in the south.

55. Poliobotys ablactalis (Walker, 1859) Material: 2 ex. Mali, Bamako, Ouronina 12°5'39.78"N 8°24'3.16"W, 29– 30.10.2014, leg. Kravchenko et al. (SMNH). Distribution: Palaeotropical. In Africa: Angola, Cameroon, DR Congo, Côte d'Ivoire, Gambia, Kenya, Lesotho, Madagascar, Mozambique, Réunion, Seychelles, Uganda, Zambia, Zimbabwe (De Prins & De Prins, 2018) and Mali (new record). Also in Australasia: Australia; Oriental: Indonesia (Borneo, Java, Sulawesi), Sri Lanka (De Prins & De Prins 2018). Host-plants: Unknown., Published as part of Poltavsky, Alexander N., Kravchenko, Vasiliy D., Traore, Mohammed M., Traore, Sekou F., Gergely, Petrányi, Witt, Thomas J., Sulak, Harry, Beck, T., Junnila, Amy, Revay, Edita E., Doumbia, Seydou, Beier, John C. & Muller, Gunter C., 2018, The Pyraloidea (Lepidoptera) fauna of the woody savannah belt in Mali, West Africa, pp. 39-69 in Zootaxa 4457 (1) on page 57, DOI: 10.11646/zootaxa.4457.1.2, http://zenodo.org/record/1457559, {"references":["De Prins, J. & De Prins, W. (2018) Afromoths, online database of Afrotropiсal moth speсies (Lepidoptera). Available from: http: // www. afromoths. net / (aссessed 10 May 2018)"]}

49. Palpita vitrealis (Rossi, 1794) Synonymy follows Nuss et al. (2003 –2018): = Pyralis unionalis Hübner, 1796. Material: 13 ex. Mali, Bamako, Ouronina 12°5'39.78"N 8°24'3.16"W, 21– 28.01.2014, leg. Kravchenko et al., 421 ex. same data except the date 14.05.– 28.10.2014 (SMNH). Distribution: Cosmopolitan. In Africa: Cape Verde, Central African Republic, Comoros, DR Congo, Ethiopia, Gambia, Ghana, Kenya, Lesotho, Liberia, Madagascar, Mauritius, Réunion, Seychelles, South Africa, Tanzania, Uganda, Yemen, Zambia, Zimbabwe (De Prins & De Prins 2018) and Mali (new record). Also in Australasia: Australia; Oriental: South Asia; Palaearctic: Canary Islands, Japan, Madeira, South Europe (De Prins & De Prins 2018). Host-plants: Oleaceae: Fraxinus sp., Jasminum auriculatum Vahl, J. dichotomum Vahl, J. fluminense Vell., J. officinale L., J. sambac (L.) Aiton, Ligustrum sp., Olea europaea L., Phillyrea sp. (De Prins & De Prins 2018). Known as olive leaf moth—this pest is highly mobile having dispersed as far as northern Europe, such as Sweden and Poland. This species has also been recorded on wild olives in Southern Africa and jasmine in Kenya (Ghoneim 2015)., Published as part of Poltavsky, Alexander N., Kravchenko, Vasiliy D., Traore, Mohammed M., Traore, Sekou F., Gergely, Petrányi, Witt, Thomas J., Sulak, Harry, Beck, T., Junnila, Amy, Revay, Edita E., Doumbia, Seydou, Beier, John C. & Muller, Gunter C., 2018, The Pyraloidea (Lepidoptera) fauna of the woody savannah belt in Mali, West Africa, pp. 39-69 in Zootaxa 4457 (1) on page 55, DOI: 10.11646/zootaxa.4457.1.2, http://zenodo.org/record/1457559, {"references":["Rossi, P. (1794) Mantissa insectorum, exhibens species nuper in Etruria collectas, adjectis faunae Etruscae illustrationibus ac emendationibus. Polloni, Pisa, 332 pp. https: // doi. org / 10.5962 / bhl. title. 49449","Nuss, M., Landry, B., Mally, R., Vegliante, F., Trankner, A., Bauer, F., Hayden, J., Segerer, A., Sсhouten, R., Li, H., Trofimova, T., Solis, M. A., De Prins, J. & Speidel, W. (2003 - 2018) Global Information System on Pyraloidea. Available from: http: // www. pyraloidea. org (aссessed 28 May 2018)","Hubner, J. (1796) Sammlung europaischer Schmetterlinge. 6. Horde. Die Zunsler; nach der Natur geordnet, beschrieben und vorgestellt (continued by C. Geyer). Published by the author, Augsburg, 32 pp.","De Prins, J. & De Prins, W. (2018) Afromoths, online database of Afrotropiсal moth speсies (Lepidoptera). Available from: http: // www. afromoths. net / (aссessed 10 May 2018)","Ghoneim, K. (2015) The olive leaf moth Palpita unionalis (Hubner) (Lepidoptera: Pyralidae) as a serious pest in the world: a review. International Journal of Research Studies in Zoology (IJRSZ), 1 (2), 1 - 20."]}