Search

Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene ‘Sw-5’ offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars (‘BL163’ and ‘HT 2’) planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.

Since the first report of the ‘spotted wilt’ disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Background The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system has become a powerful tool for functional genomics in plants. The RNA-guided nuclease can be used to not only generate precise genomic mutations, but also to manipulate gene expression when present as a deactivated protein (dCas9). Results In this study, we describe a vector toolkit for analyzing dCas9-mediated activation (CRISPRa) or inactivation (CRISPRi) of gene expression in maize protoplasts. An improved maize protoplast isolation and transfection method is presented, as well as a description of dCas9 vectors to enhance or repress maize gene expression. Conclusions We anticipate that this maize protoplast toolkit will streamline the analysis of gRNA candidates and facilitate genetic studies of important trait genes in this transformation-recalcitrant plant.

Cucurbit leaf crumple virus (CuLCrV), a bipartite begomovirus, is transmitted by whiteflies in a persistent and circulative manner. Like other begomoviruses, CuLCrV transmission via feeding is well understood; however, whether and how CuLCrV is transmitted by horizontal and vertical modes in its vector, Bemisia tabaci, remains unexplored. We studied transovarial and mating transmission of CuLCrV, and comparatively analyzed virus accumulation in whiteflies through feeding and nonfeeding modes. Furthermore, we quantified CuLCrV DNA A accumulation at different time points to determine whether this virus propagates in whiteflies. CuLCrV DNA A was transmitted vertically and horizontally by B. tabaci, with low frequency in each case. Transovarial transmission of CuLCrV DNA A was only 3.93% in nymphs and 3.09% in adults. Similarly, only a single viruliferous male was able to transmit CuLCrV DNA A to its nonviruliferous female counterparts via mating. In contrast, viruliferous females were unable to transmit CuLCrV DNA A to nonviruliferous males. Additionally, the recipient adults that presumably acquired CuLCrV transovarially and via mating were not able to transmit the virus to squash plants. We further report that the CuLCrV DNA A viral copy numbers were significantly lower in nonfeeding modes of transmission than in feeding ones. The viral copy numbers significantly decreased at succeeding time points throughout adulthood, suggesting no CuLCrV propagation in B. tabaci. Altogether, the low frequency of nonfeeding transmission, reduced virus accumulation in whiteflies, and absence of plant infectivity through nonfeeding transmission suggest that transovarial and mating CuLCrV transmission might not substantially contribute to CuLCrV epidemics.

The association of plant viruses with their vectors has significant implications for virus transmission and spread. Only a few studies, with even fewer pathosystems, have explored non-persistent (NP) virus-vector interactions that are presumed to be transient. We studied how a NP virus, Papaya ringspot virus (PRSV) influenced the behavior and biology of its vector, the melon aphid (Aphis gossypii Glover) and the non-vector, silverleaf whitefly (Bemisia tabaci Gennadius). We also assessed whether the fitness effects on aphids are modulated through changes in the host plant, squash (Cucurbita pepo L.) nutrient profile. The overall performance of A. gossypii was substantially higher on PRSV-infected plants, along with increased arrestment on PRSV-infected than non-infected plants. No such PRSV-modulated fitness effects were observed with B. tabaci. PRSV-infected plants had increased concentrations of free essential amino acids: threonine, arginine and lysine; non-essential amino acids: glycine and homocysteine; and soluble carbohydrates: galactose, raffinose and cellobiose. In general, PRSV encouraged long-term feeding and enhanced fitness of A. gossypii through host plant nutrient enrichment. These findings provide evidence for a NP virus mediated positive fitness effects on its vector, with no spillover fitness benefits to the non-vector within the same feeding guild.

Citrus yellow-vein disease (CYVD) was first reported in California in 1957. We now report that CYVD is associated with a virus-like agent, provisionally named citrus yellow-vein associated virus (CYVaV). The CYVaV RNA genome has 2,692 nucleotides and codes for two discernable open reading frames (ORFs). ORF1 encodes a protein of 190 amino acid (aa) whereas ORF2 is presumably generated by a −1 ribosomal frameshifting event just upstream of the ORF1 termination signal. The frameshift product (717 aa) encodes the RNA-dependent RNA polymerase (RdRp). Phylogenetic analyses suggest that CYVaV is closely related to unclassified virus-like RNAs in the familyTombusviridae. Bio-indexing and RNA-seq experiments indicate that CYVaV can induce yellow vein symptoms independently of known citrus viruses or viroids.

Potyviruses are the largest group of plant infecting RNA viruses that cause significant losses in a wide range of crops across the globe. The majority of viruses in the genus Potyvirus are transmitted by aphids in a non-persistent, non-circulative manner and have been extensively studied vis-à-vis their structure, taxonomy, evolution, diagnosis, transmission, and molecular interactions with hosts. This comprehensive review exclusively discusses potyviruses and their transmission by aphid vectors, specifically in the light of several virus, aphid and plant factors, and how their interplay influences potyviral binding in aphids, aphid behavior and fitness, host plant biochemistry, virus epidemics, and transmission bottlenecks. We present the heatmap of the global distribution of potyvirus species, variation in the potyviral coat protein gene, and top aphid vectors of potyviruses. Lastly, we examine how the fundamental understanding of these multi-partite interactions through multi-omics approaches is already contributing to, and can have future implications for, devising effective and sustainable management strategies against aphid-transmitted potyviruses to global agriculture.

Potyviruses are the largest group of plant infecting RNA viruses that cause significant losses in a wide range of crops across the globe. The majority of viruses in the genus Potyvirus are transmitted by aphids in a non-persistent, non-circulative manner and have been extensively studied vis-à-vis their structure, taxonomy, evolution, diagnosis, transmission, and molecular interactions with hosts. This comprehensive review exclusively discusses potyviruses and their transmission by aphid vectors, specifically in the light of several virus, aphid and plant factors, and how their interplay influences potyviral binding in aphids, aphid behavior and fitness, host plant biochemistry, virus epidemics, and transmission bottlenecks. We present the heatmap of the global distribution of potyvirus species, variation in the potyviral coat protein gene, and top aphid vectors of potyviruses. Lastly, we examine how the fundamental understanding of these multi-partite interactions through multi-omics approaches is already contributing to, and can have future implications for, devising effective and sustainable management strategies against aphid-transmitted potyviruses to global agriculture.

Cucurbit leaf crumple virus (CuLCrV), a bipartite begomovirus, is transmitted by whiteflies in a persistent and circulative manner. Like other begomoviruses, CuLCrV transmission via feeding is well understood; however, whether and how CuLCrV is transmitted by horizontal and vertical modes in its vector

The use of microbial inoculants containing plant growth-promoting rhizobacteria as a promoter of plant fitness and health is becoming increasingly popular in agriculture. However, whether and how these bacteria affect indigenous bacterial communities in field conditions is sparsely explored. We studied the effects of seed inoculation and field soil application of ubiquitous soil bacteria, B. cereus, B. subtilis, and B. amyloliquefaciens, on the diversity, evenness, and richness of endophytic bacterial communities in sprouting broccoli roots using high-throughput metagenome sequencing. The multiple operational taxonomic units (OTUs) assigned to different bacterial taxa clearly showed changes in ecological measures and relative abundances of certain taxa between control and treatment groups. The Bacillus inocula, themselves, failed to flourish as endophytes; however, the effects they extended on the endophytic bacterial community were both generic as well as species specific. In each case, Pseudomonadales, Rhizobiales, Xanthomonadales, and Burkholderiales were the most abundant orders in the endosphere. B. amyloliquefaciens drastically reduced the most abundant genus, Pseudomonas, while increasing the relative abundance of a range of minor taxa. The Shannon-Weiner diversity and Buzas and Gibson’s evenness indices showed that the diversity and evenness were increased in both B. amyloliquefaciens and mixed treated plants. The UniFrac measurement of beta diversity showed that all treatments affected the specific composition of the endophytic bacterial community, with an apparent interspecies competition in the mixed treatment. Taken together, Bacillus species influenced the diversity, evenness, and composition of the endophytic bacterial community. However, these effects varied between different Bacillus spp. in a context-specific manner.

Biological and morphological plasticity in polyphagous insect herbivores allow them to exploit diverse host plant species. Geographical differences in resource availability can lead to preferential host exploitation and result in inconsistent host specialization. Biological and molecular data provide insights into specialization and plasticity of such herbivore populations. In agricultural landscapes, Aphis gossypii encounters several crop and non-crop hosts, which exist in temporal and spatial proximity. We investigated the host-specialization of two A. gossypii host-associated populations (HAPs), which were field collected from cotton and squash (cotton-associated population and melon-associated population), and later maintained separately in the greenhouse. The two aphid populations were exposed to seven plant species (cotton, okra, watermelon, squash, cucumber, pigweed, and morning glory), and evaluated for their host utilization plasticity by estimating aphid's fitness parameters (nymphal period, adult period, fecundity, and intrinsic rate of increase). Four phenotypical characters (body length, head capsule width, hind tibia length and cornicle length) were also measured from the resulting 14 different HAP × host plant combinations. Phylogenetic analysis of mitochondrial COI sequences showed no genetic variation between the two HAPs. Fitness parameters indicated a significant variation between the two aphid populations, and the variation was influenced by host plants. The performance of melon-aphids was poor (up to 89% reduction in fecundity) on malvaceous hosts, cotton and okra. However, cotton-aphids performed better on cucurbitaceous hosts, squash and watermelon (up to 66% increased fecundity) compared with the natal host, cotton. Both HAPs were able to reproduce on two weed hosts. Cotton-aphids were smaller than melon-aphids irrespective of their host plants. Results from this study suggest that the two HAPs in the study area do not have strict host specialization; rather they exhibit plasticity in utilizing several hosts. In this scenario, it is unlikely that host-associated A. gossypii populations would evolve into host-specific biotypes.

Mixed virus infection in host plants can differentially alter the plant phenotype, influence vector fitness, and affect virus acquisition and inoculation by vectors than single-virus infection. Vector acquisition of multiple viruses from multiple host plants could also differentially affect vector fitness and virus inoculation than acquisition of one virus. Whitefly-virus pathosystems in the southern United States include both the above-stated facets. For the first facet, this study examined the effects of single and mixed infection of cucurbit leaf crumple virus (CuLCrV, a begomovirus) and cucurbit yellow stunting disorder virus (CYSDV, a crinivirus) infecting squash on whitefly (Bemisia tabaci Gennadius MEAM1) host preference and fitness. Mixed infection of CuLCrV and CYSDV in squash plants severely altered their phenotype than single infection. The CYSDV load was reduced in mixed-infected squash plants than in singly-infected plants. Consequently, whiteflies acquired reduced amounts of CYSDV from mixed-infected plants than singly-infected plants. No differences in CuLCrV load were found between singly- and mixed-infected squash plants, and acquisition of CuLCrV by whiteflies did not vary between singly- and mixed-infected squash plants. Both singly- and mixed-infected plants similarly affected whitefly preference, wherein non-viruliferous and viruliferous (CuLCrV and/or CYSDV) whiteflies preferred non-infected plants over infected plants. The fitness study involving viruliferous and non-viruliferous whiteflies revealed no differences in developmental time and fecundity. For the second facet, this study evaluated the effects of individual or combined acquisition of tomato-infecting tomato yellow leaf curl virus (TYLCV, a begomovirus) and squash-infecting CuLCrV on whitefly host preference and fitness. Whiteflies that acquired both CuLCrV and TYLCV had significantly lower CuLCrV load than whiteflies that acquired CuLCrV alone, whereas TYLCV load remained unaltered when acquired individually or in conjunction with CuLCrV. Whitefly preference was not affected following individual or combined virus acquisition. Viruliferous (CuLCrV and/or TYLCV) whiteflies preferred to settle on non-infected tomato and squash plants. The mere presence of CuLCrV and/or TYLCV in whiteflies did not affect their fitness. Taken together, these results indicate that mixed infection of viruses in host plants and acquisition of multiple viruses by the vector could have implications for virus accumulation, virus acquisition, vector preference, and epidemics that sometimes are different from single-virus infection or acquisition.

Soil microbes present a novel and cost-effective method of increasing plant resistance to insect pests and thus create a sustainable opportunity to reduce current pesticide application. However, the use of microbes in integrated pest management programs is still in its infancy. This can be attributed primarily to the variations in microbial inoculum performance under laboratory and field conditions. Soil inoculants containing single, indigenous microbial species have shown promising results in increasing chemical defenses of plants against foliar feeding insects. Conversely, commercial inoculants containing multiple species tend to show no effects on herbivore infestation in the field. We present here a simple model that endeavours to explain how single and multiple species in microbial inoculants differentially govern insect population dynamics via changes in plant chemical profiles. We discuss further how this knowledge can be applied to manipulate soil microbial species and develop 'tailored' microbial inoculants that could be used in plant protection against antagonists.

Mixed infection of plant viruses is ubiquitous in nature and can affect virus&ndash, plant&ndash, vector interactions differently than single virus infection. While several studies have examined virus&ndash, virus interactions involving mixed virus infection, relatively few have examined effects of mixed virus infection on vector preference and fitness, especially when multiple vectors are involved. This study explored how single and mixed viral infection of a non-persistently transmitted cucumber mosaic virus (CMV) and propagative and persistently-transmitted tomato spotted wilt orthotospovirus (TSWV) in pepper, Capsicum annum L., influenced the preference and fitness of their vectors, the green peach aphid, Myzus persicae (Sulzer), and the tobacco thrips, Frankliniella fusca (Hinds), respectively. In general, mixed infected plants exhibited severe symptoms compared with individually infected plants. An antagonistic interaction between the two viruses was observed when CMV titer was reduced following mixed infection with TSWV in comparison with the single infection. TSWV titer did not differ between single and mixed infection. Myzus persicae settling preference and median developmental were not significantly different between CMV and/or TSWV-infected and non-infected plants. Moreover, M. persicae fecundity did not differ between CMV-infected and non-infected pepper plants. However, M. persicae fecundity was substantially greater on TSWV-infected plants than non-infected plants. Myzus persicae fecundity on mixed-infected plants was significantly lower than on singly-infected and non-infected plants. Frankliniella fusca fecundity was higher on CMV and/or TSWV-infected pepper plants than non-infected pepper plants. Furthermore, F. fusca-induced feeding damage was higher on TSWV-infected than on CMV-infected, mixed-infected, or non-infected pepper plants. Overall, our results indicate that the effects of mixed virus infection on vectors were not different from those observed following single virus infection. Virus-induced host phenotype-modulated effects were realized on both specific and non-specific vectors, suggesting crosstalk involving all vectors and viruses in this pathosystem. The driving forces of these interactions need to be further examined. The effects of interactions between two viruses and two vectors towards epidemics of one or both viruses also need to be examined.

The uniformity of crop yield is extremely important for consumers and of as much relevance to the grower as overall yield. However, size inequality within a plant population is rarely measured and has never before been considered in relation to the use of beneficial microbes for yield enhancement. For the first time, we show that addition of soil bacteria to calabrese plants significantly increased size inequality. These effects were usually more apparent in above-ground biomass. This was caused by some (but not all) plants growing very large when inoculated with bacteria, while control plants were mostly small. We suggest that the main reason is the incompatibility of the inoculated bacteria with those already present in the rhizosphere. In some cases the inoculum matched the indigenous community, providing a benefit to plant growth, while often it did not and plants remained relatively small. We conclude that analyses of size inequality should be an integral part of experiments using microbial soil amendments. These analyses can help to inform the production of more effective microbial products and to ensure that the integration of beneficial microbes into sustainable production systems does not impair uniformity in yield.

Rhizobacteria are key belowground drivers of plant–insect higher trophic interactions aboveground. Conventionally, rhizobacteria have been studied in the context of their effects on plant growth and yield in agricultural situations. However, the focus of rhizobacterial studies shifted recently to explore their effects on plant biochemistry, defense signaling, the plant microbiome, and insect herbivores. Here, we review the interactions between rhizobacteria and foliar-feeding insects and consider some of the mechanisms by which these interactions occur. To develop a robust understanding of whether and how rhizobacteria govern plant–insect interactions, a multidisciplinary approach involving ecological and -omics approaches is imperative. Such an approach will not only elucidate the key mechanisms underpinning these intricate interactions, including a wide range of variables at spatiotemporal scales, but also open new avenues for their applicability in agricultural and allied fields. This review attempts to (1) synthesize existing knowledge of rhizobacteria–plant–herbivore interactions, (2) identify and address the key issues in the current study systems, and (3) discuss the potential importance of rhizobacteria in insect community ecology.

Numerous soil-dwelling Bacillus species form mutualistic relationships with plants, in which the hosts derive an array of benefits, including the alteration of nutrient and chemical content. Despite such ubiquitous and intimate Bacillus–plant associations, the role of these bacteria in affecting the performance of specialist foliage-feeding insects is largely unknown. We studied the effects of individual and mixed treatments of Bacillus cereus, Bacillus subtilis and Bacillus amyloliquefaciens on calabrese growth and important life-history characteristics and the population dynamics of the specialist phloem-feeding aphid Brevicoryne brassicae. All Bacillus species negatively affected the life-history traits and supressed the populations of B. brassicae in varying magnitudes. The differences in aphid populations and number of leaves infested increased swiftly towards the end of the experiment and peaked 71 days after sowing. Bacillus cereus was the most effective treatment in reducing B. brassicae growth rates, followed by the mixture of species, B. amyloliquefaciens and B. subtilis treatments. However, no synergistic or additive effects of bacteria were found. Overall, plant growth promoting Bacillus species significantly suppress the growth and development of B. brassicae and show great potential for use in an integrated biological control programme for this pest.

This study for the first time provides evidence for the presence of Cucurbit yellow stunting disorder virus (CYSDV) in Georgia. Thus, three whitefly-transmitted cucurbit-infecting viruses are now known in the state. Future research is required to evaluate the host range of CYSDV and its economic impact on cucurbit production in Georgia.

Endophytic fungi are ubiquitous in the plant kingdom and they produce a variety of secondary metabolites to protect plant communities and to show some potential for human use. However, secondary metabolites produced by endophytic fungi in the medicinal plant Curcuma wenyujin are sparsely explored and characterized. The aim of this study was to characterize the secondary metabolites of an active endophytic fungus. M7226, the mutant counterpart of endophytic fungus EZG0807 previously isolated from the root of C. wenyujin, was as a target strain. After fermentation, the secondary metabolites were purified using a series of purification methods including thin layer chromatography, column chromatography with silica, ODS-C18, Sephadex LH-20, and macroporous resin, and were analyzed using multiple pieces of data (UV, IR, MS, and NMR). Five compounds were isolated and identified as curcumin, cinnamic acid, 1,4-dihydroxyanthraquinone, gibberellic acid, and kaempferol. Interestingly, curcumin, one of the main active ingredients of C. wenyujin, was isolated as a secondary metabolite from a fungal endophyte for the first time.