Search

In this study, metagenomic sequence data was used to investigate the phytoplasma taxonomic diversity in vegetable-growing regions across Australia. Metagenomic sequencing was performed on 195 phytoplasma-positive samples, originating either from historic collections ( n =46) or during collection efforts between January 2015 and June 2022 ( n =149). The sampled hosts were classified as crop ( n =155), weed ( n =24), ornamental ( n =7), native plant ( n =6), and insect ( n =3) species. Most samples came from Queensland ( n =78), followed by Western Australia ( n =46), the Northern Territory ( n =32), New South Wales ( n =17), and Victoria ( n =10). Of the 195 draft phytoplasma genomes, 178 met our genome criteria for comparison using an average nucleotide identity approach. Ten distinct phytoplasma species were identified and could be classified within the 16SrII, 16SrXII (PCR only), 16SrXXV, and 16SrXXXVIII phytoplasma groups, which have all previously been recorded in Australia. The most commonly detected phytoplasma taxa in this study were species and subspecies classified within the 16SrII group ( n =153), followed by strains within the 16SrXXXVIII group (' Ca . Phytoplasma stylosanthis'; n =6). Several geographic- and host-range expansions were reported, as well as mixed phytoplasma infections of 16SrII taxa and ' Ca . Phytoplasma stylosanthis'. Additionally, six previously unrecorded 16SrII taxa were identified, including five putative subspecies of ' Ca . Phytoplasma australasiaticum' and a new putative 16SrII species. PCR and sequencing of the 16S rRNA gene was a suitable triage tool for preliminary phytoplasma detection. Metagenomic sequencing, however, allowed for higher-resolution identification of the phytoplasmas, including mixed infections, than was afforded by only direct Sanger sequencing of the 16S rRNA gene. Since the metagenomic approach theoretically obtains sequences of all organisms in a sample, this approach was useful to confirm the host family, genus, and/or species. In addition to improving our understanding of the phytoplasma species that affect crop production in Australia, the study also significantly expands the genomic sequence data available in public sequence repositories to contribute to phytoplasma molecular epidemiology studies, revision of taxonomy, and improved diagnostics.

Luteoviruses (family Tombusviridae ) and poleroviruses (family Solemoviridae ) are economically important pathogens of cereals such as wheat ( Triticum aestivum ), barley ( Hordeum vulgare ) and oat ( Avena sativa ). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trębicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids ( Rhopalosiphum padi ). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass ( Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

We present the genome sequence of a polerovirus (family Solemoviridae) isolated from wild oat ( Avena fatua ) in Australia. The genome sequence consists of 5,631 nucleotides and shares 87% nucleotide identity with its closest relative, cereal yellow dwarf virus RPV isolate 010 (GenBank accession number EF521830)., Competing Interests: The authors declare no conflict of interest.

Shiraz disease (SD) is one of the most destructive viral diseases of grapevines in Australia and is known to cause significant economic loss to local growers. Grapevine virus A (GVA) was reported to be the key pathogen associated with this disease. This study aimed to better understand the diversity of GVA variants both within and between individual SD and grapevine leafroll disease (LRD) affected grapevines located at vineyards in South Australia. Amplicon high throughput sequencing (Amplicon-HTS) combined with median-joining networks (MJNs) was used to analyze the variability in specific gene regions of GVA variants. Several GVA II variant groups contain samples from both vineyards studied, suggesting that these GVA II variants were from a common origin. Variant groups analyzed by MJNs using the overall data set denote that there may be a possible relationship between variant groups of GVA and the geographical location of the grapevines.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus , family Tombusviridae ), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat ( Triticum aestivum ) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trębicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat ( Avena fatua , n=3) and brome grass ( Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

Shiraz disease (SD) is an economically important virus-associated disease that can significantly reduce yield in sensitive grapevine varieties and has so far only been reported in South Africa and Australia. In this study, RT-PCR and metagenomic high-throughput sequencing was used to study the virome of symptomatic and asymptomatic grapevines within vineyards affected by SD and located in South Australia. Results showed that grapevine virus A (GVA) phylogroup II variants were strongly associated with SD symptoms in Shiraz grapevines that also had mixed infections of viruses including combinations of grapevine leafroll-associated virus 3 (GLRaV-3) and grapevine leafroll-associated virus 4 strains 5, 6 and 9 (GLRaV-4/5, GLRaV-4/6, GLRaV-4/9). GVA phylogroup III variants, on the other hand, were present in both symptomatic and asymptomatic grapevines, suggesting no or decreased virulence of these strains. Similarly, only GVA phylogroup I variants were found in heritage Shiraz grapevines affected by mild leafroll disease, along with GLRaV-1, suggesting this phylogroup may not be associated with SD.

Rapid and reliable detection tools are essential for disease surveillance and outbreak management, and genomic data is essential to determining pathogen origin and monitoring of transmission pathways. Low virus copy number and poor RNA quality can present challenges for genomic sequencing of plant viruses, but this can be overcome by enrichment of target nucleic acid. A targeted whole genome sequencing (TWG-Seq) approach for the detection of cucumber green mottle mosaic virus (CGMMV) has been developed where overlapping amplicons generated using two multiplex RT-PCR assays are then sequenced using the Oxford Nanopore MinION. Near complete coding region sequences were assembled with ≥100× coverage for infected leaf tissue dilution samples with RT-qPCR cycle quantification (Cq) values from 11.8 to 38 and in seed dilution samples with Cq values 13.8 to 27. Consensus sequences assembled using this approach showed greater than 99% nucleotide similarity when compared to genomes produced using metagenomic sequencing. CGMMV could be confidently detected in historical seed isolates with degraded RNA. Whilst limited access to, and costs associated with second-generation sequencing platforms can influence diagnostic outputs, the portable Nanopore technology offers an affordable high throughput sequencing alternative when combined with TWG-Seq for low copy or degraded samples.

A phytoplasma was initially detected in Dypsis poivriana by nested and real-time PCR from the botanical gardens in Cairns, Queensland, Australia in 2017. Further surveys in the Cairns region identified phytoplasma infections in eight additional dying ornamental palm species ( Euterpe precatoria, Cocos nucifera , Verschaffeltia splendida, Brassiophoenix drymophloeodes , Burretiokentia hapala , Cyrtostachys renda , Reinhardtia gracilis , Carpoxylon macrospermum ), a Phoenix species, a Euterpe species and two native palms ( Archontophoenix alexandrae ). Analysis of 16S rRNA gene sequences showed that this phytoplasma is distinct as it shared less than 97.5 % similarity with all other ' Candidatus Phytoplasma' species. At 96.3 % similarity, the most closely related formally described member of the provisional ' Ca . Phytoplasma' genus was ' Ca . Phytoplasma noviguineense', a novel taxon from the island of New Guinea found in monocotyledonous plants. It was slightly more closely related (96.6-96.8 %) to four palm-infecting strains from the Americas, which belong to strain group 16SrIV and which have not been assigned to a formal ' Candidatus Phytoplasma' species taxon. Phylogenetic analysis of the 16S rRNA gene and ribosomal protein genes of the phytoplasma isolate from a dying coconut palm revealed that the phytoplasma represented a distinct lineage within the phytoplasma clade. As the nucleotide identity with other phytoplasmas is less than 97.5 % and the phylogenetic analyses show that it is distinct, a novel taxon 'Candidatus Phytoplasma dypsidis' is proposed for the phytoplasma found in Australia. Strain RID7692 (GenBank accession no. MT536195) is the reference strain. The impact and preliminary aspects of the epidemiology of the disease outbreak associated with this novel taxon are described.

In Australia, Stylosanthes little leaf (StLL) phytoplasma has been detected in Stylosanthes scabra Vogel, Arachis pintoi Krapov, Saccharum officinarum L., Carica papaya L., Medicago sativa L., and Solanum tuberosum L. The 16S rRNA gene sequence of StLL phytoplasma strains from S. scabra , C. papaya, S. officinarum and S. tuberosum were compared and share 99.93-100 % nucleotide sequence identity. Phylogenetic comparisons between the 16S rRNA genes of StLL phytoplasma and other ' Candidatus Phytoplasma' species indicate that StLL represents a distinct phytoplasma lineage. It shares its most recent known ancestry with ' Ca . Phytoplasma luffae' (16SrVIII-A), with which it has 97.17-97.25 % nucleotide identity. In silico RFLP analysis of the 16S rRNA amplicon using i PhyClassifier indicate that StLL phytoplasmas have a unique pattern (similarity coefficient below 0.85) that is most similar to that of 'Ca . Phytoplasma luffae'. The unique in silico RFLP patterns were confirmed in vitro . Nucleotide sequences of genes that are more variable than the 16S rRNA gene, namely tuf (tu-elongation factor), secA (partial translocation gene), and the partial ribosomal protein ( rp ) gene operon ( rps19-rpl22-rps3 ), produced phylogenetic trees with similar branching patterns to the 16S rRNA gene tree. Sequence comparisons between the StLL 16S rRNA spacer region confirmed previous reports of rrn interoperon sequence heterogeneity for StLL, where the spacer region of rrnB encodes a complete tRNA-Isoleucine gene and the rrnA spacer region does not. Together these results suggest that the Australian phytoplasma, StLL, is unique according to the International Organization for Mycoplasmology (IRPCM) recommendations. The novel taxon ' Ca . Phytoplasma stylosanthis' is proposed, with the most recent strain from a potato crop in Victoria, Australia, serving as the reference strain (deposited in the Victorian Plant Pathology Herbarium as VPRI 43683).

In this study, we determined the complete genome sequence of a new blunervirus isolated from tomato plants grown in an open field in Italy in the fall of 2018. Like other blunerviruses, the RNA genome of this virus is quadripartite, positive-sense, and single-stranded. Excluding the polyA tail present in each segment, the RNAs 1 and 2 are 5790 nucleotides (nt) and 3621 nt in size, respectively, and each contains a single open reading frame (ORF). The RNAs 3 and 4 are 2842 and 1924 nt long and encode five and two ORFs, respectively. BLASTp analysis of the predicted products of RNA1 and RNA2 ORF1 showed the highest sequence identity (31% and 42%) to tea plant necrotic ring blotch virus (TPNRBV), while the protein encoded by RNA 4 ORF2 had the highest sequence identity (38%) to blueberry necrotic ring blotch virus (BNRBV). These are the only two recognized members in the genus Blunervirus. When the RNA3 ORF3 and ORF5 products were compared with the blunerviruses-encoded proteins, they had the highest sequence identity (30% and 32%) to their TPNRBV-encoded homologs; however, general comparisons showed stronger matches to two different proteins from Acinetobacter baumannii. The proteins encoded by ORFs 1, 2 and 4 of RNA3 and ORF 1 of RNA4 showed no significant BLASTp hits to any known proteins in the databases. Given the limited genetic similarity of this virus to those currently available in the databases, we suggest that this is a new virus, for which we propose the name "tomato fruit blotch virus" (ToFBV). A distinct isolate of the same virus was also detected in Australia.

Grapevine rupestris vein feathering virus (GRVFV; tentative genus Marafivirus; family Tymoviridae ) was first detected from a Greek grapevine (Vitis vinifera), with asteroid mosaic-like symptoms (El Beaino et al. 2001; Ghanem-Sabanadzovic et al. 2003) and was also infected with grapevine fleck virus. GRVFV has been detected in the United States, South Africa, Canada, Spain, China, New Zealand, Brazil, Germany, Korea, Slovakia, Hungary and Pakistan (Cho et al. 2018; Mahmood et al. 2019).Transmission vectors are currently unknown. In 2018, nine grapevine samples were collected between May to July in South Australia (SA) and Western Australia (WA) (Table S1), were analysed by high-throughput sequencing (HTS) to characterise grapevine viruses in Australian vineyards. Total RNA or double stranded RNA was extracted from grapevine canes using RNeasy 96 QIAcube HT kit (Qiagen) with MacKenzie buffer (MacKenzie et al. 1997) or using CF-11 (Balijja et al. 2008). Libraries were prepared using the NEBNext® Ultra II RNA library Prep Kit (NEB) or TruSeq® Stranded mRNA Prep kit (Illumina) with Ribo-Zero®gold plant kit for ribosomal depletion (Illumina, San Diego, CA). Libraries were sequenced using Illumina Miseq (SA) or Hiseq (WA) technology with 2x300 (SA) or 2x100 (WA) paired end reads which were trimmed using Trim Galore! (0.4.0) or BBmap (38.20), respectively. De novo assembly, using the SPAdes (version 3.12.0) genome assembler with default settings, resulted in twelve near full length GRVFV genomes (6713-6737nt), eight sequences from the WA samples and four from the SA samples. WA samples 171 and 178 and SA sample BV each had two distinct GRVFV molecular variants. Variants 171-1 and 171-2 (GenBank accessions MT084811, MT084812) from sample 171 shared 83.39% nucleotide (nt) identity. Variants 178-1 and 178-2 (MT084813, MT084814) from sample 178 shared 83.54% nt identity. Variants BV6799 and BV8822 (MN974274, MN974275) from sample BV shared 82.85% nt identity. Only one GRVFV sequence was obtained from all other samples. The genome of SA isolate LC1 (MN974273) was confirmed by RT-PCR amplification and Sanger sequencing of overlapping genome regions. Tissue from the infected LC1 isolate has been deposited into the Victorian plant pathogen reference collection (VPRI accession No. 43698). When the genomes of all Australian isolates were compared, they had 78.94% to 94.37 % nt identity with each other. The SA isolates LC1, BV8822, BV6799, and SEL-L (MN974276), and the WA isolates 172 (MT084807), 179 (MT084808), 180 (MT084809), and 182 (MT084810) were most closely related to the Swiss isolate CHASS (KY513702; 82.87% to 85.46% nt identity). The WA isolates 171-1, 171-2, 178-1 and 178-2 were most closely related to the New Zealand isolate Ch8021 (MF000325; 83.21% to 93.87%). Grapevine leafroll-associated virus 1 (GLRaV-1), GLRaV-3, GLRaV-4 (strain 6 and 9), grapevine virus A, grapevine rupestris stem pitting associated virus, grapevine yellow speckle viroid 1 and hop stunt viroid were also identified in the sequencing data. This is the first report of GRVFV in Australia. All WA samples were collected during dormancy and symptoms were not observed. Sample LC1 from SA had Shiraz disease, the other SA samples were asymptomatic, and none had asteroid mosaic-like symptoms. Further research is required to determine its distribution and association with disease in Australia.

Melon necrotic spot virus (MNSV) was detected in field-grown Cucumis melo (rockmelon) and Citrullus lanatus (watermelon) plants in the Sunraysia district of New South Wales and Victoria, Australia, in 2012, 2013, and 2016, and in two watermelon seed lots tested at the Australian border in 2016. High-throughput sequencing was used to generate near full-length genomes of six isolates detected during the incursions and seed testing. Phylogenetic analysis of the genomes suggests that there have been at least two incursions of MNSV into Australia and none of the field isolates were the same as the isolates detected in seeds. The analysis indicated that one watermelon field sample (L10), the Victorian rockmelon field sample, and two seed interception samples may have European origins. The results showed that two isolates (L8 and L9) from watermelon were divergent from the type MNSV strain (MNSV-GA, D12536.2) and had 99% nucleotide identity to two MNSV isolates from human stool collected in the United States (KY124135.1, KY124136.1). These isolates also had high nucleotide pairwise identity (96%) to a partial sequence from a Spanish MNSV isolate (KT962848.1). The analysis supported the identification of three previously described MNSV genotype groups: EU-LA, Japan melon, and Japan watermelon. To account for the greater diversity of hosts and geographic regions of the MNSV isolates used in this study, it is suggested that the genotype groups EU-LA, Japan melon, and Japan watermelon be renamed to groups I, II, and III, respectively. The divergent isolates L8 and L9 from this study and the stool isolates from the United States formed a fourth genotype group, group IV. Soil collected from the site of the Victorian rockmelon MNSV outbreak was found to contain viable MNSV and the virus vector, a chytrid fungus, Olpidium bornovanus (Sahtiyanci) Karling, 18 months after the initial MNSV detection. This is a first report of O. bornovanus from soil sampled from an MNSV-contaminated site in Australia.

The near-complete genome sequence of the original Carrot virus Y (CarVY) type isolate (CarVY-Vic) collected in 1999 in Victoria, Australia, and a near-complete genome sequence from an isolate collected in 2019 from the same region (CarVY-2-22) were determined following deep sequencing. The two CarVY genome sequences shared 98% nucleotide identity., (© Crown copyright 2020.)

One hundred Prunus trees, including almond ( P. dulcis ), apricot ( P. armeniaca ), nectarine ( P. persica var. nucipersica ), peach ( P. persica ), plum ( P. domestica ), purple leaf plum ( P. cerasifera ) and sweet cherry ( P. avium ), were selected from growing regions Australia-wide and tested for the presence of 34 viruses and three viroids using species-specific reverse transcription-polymerase chain reaction (RT-PCR) or polymerase chain reaction (PCR) tests. In addition, the samples were tested using some virus family or genus-based RT-PCR tests. The following viruses were detected: Apple chlorotic leaf spot virus (ACLSV) (13/100), Apple mosaic virus (ApMV) (1/100), Cherry green ring mottle virus (CGRMV) (4/100), Cherry necrotic rusty mottle virus (CNRMV) (2/100), Cherry virus A (CVA) (14/100), Little cherry virus 2 (LChV2) (3/100), Plum bark necrosis stem pitting associated virus (PBNSPaV) (4/100), Prune dwarf virus (PDV) (3/100), Prunus necrotic ringspot virus (PNRSV) (52/100), Hop stunt viroid (HSVd) (9/100) and Peach latent mosaic viroid (PLMVd) (6/100). The results showed that PNRSV is widespread in Prunus trees in Australia. Metagenomic high-throughput sequencing (HTS) and bioinformatics analysis were used to characterise the genomes of some viruses that were detected by RT-PCR tests and Apricot latent virus (ApLV), Apricot vein clearing associated virus (AVCaV), Asian Prunus Virus 2 (APV2) and Nectarine stem pitting-associated virus (NSPaV) were also detected. This is the first report of ApLV, APV2, CGRMV, CNRNV, LChV1, LChV2, NSPaV and PBNSPaV occurring in Australia. It is also the first report of ASGV infecting Prunus species in Australia, although it is known to infect other plant species including pome fruit and citrus.

Coding-complete sequences of two barley virus G isolates from Australia were obtained from a 34-year-old oat sample (isolate Aus8) and a 1-year-old barley sample (isolate Aus17N). The Aus8 and Aus17N isolates share 96.3% nucleotide identity with each other and 95.7 to 95.8% nucleotide identity with the South Korean isolate Uiseong., (Copyright © 2019 Nancarrow et al.)

Here, we report the first nearly complete genome sequence of Alfalfa mosaic virus (AMV) obtained from a symptomatic field pea sample (Aus295) in Australia. Its genome RNA1 and RNA2 segments resembled those of the Argentinian isolate Manfredi, with 99.4% and 96.7% nucleotide (nt) identity, respectively; its RNA3 segment resembled that of Chinese isolate AMV-Gyn, with 99.6% nt identity., (Copyright © 2019 Maina et al.)

Apple mosaic virus (ApMV) and prune dwarf virus (PDV) are amongst the most common viruses infecting Prunus species worldwide but their incidence and genetic diversity in Australia is not known. In a survey of 127 Prunus tree samples collected from five states in Australia, ApMV and PDV occurred in 4 (3%) and 13 (10%) of the trees respectively. High-throughput sequencing (HTS) of amplicons from partial conserved regions of RNA1, RNA2, and RNA3, encoding the methyltransferase (MT), RNA-dependent RNA polymerase (RdRp), and the coat protein (CP) genes respectively, of ApMV and PDV was used to determine the genetic diversity of the Australian isolates of each virus. Phylogenetic comparison of Australian ApMV and PDV amplicon HTS variants and full length genomes of both viruses with isolates occurring in other countries identified genetic strains of each virus occurring in Australia. A single Australian Prunus infecting ApMV genetic strain was identified as all ApMV isolates sequence variants formed a single phylogenetic group in each of RNA1, RNA2, and RNA3. Two Australian PDV genetic strains were identified based on the combination of observed phylogenetic groups in each of RNA1, RNA2, and RNA3 and one Prunus tree had both strains. The accuracy of amplicon sequence variants phylogenetic analysis based on segments of each virus RNA were confirmed by phylogenetic analysis of full length genome sequences of Australian ApMV and PDV isolates and all published ApMV and PDV genomes from other countries., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The distribution of Ilarvirus species populations amongst 61 Australian Prunus trees was determined by next generation sequencing (NGS) of amplicons generated using a genus-based generic RT-PCR targeting a conserved region of the Ilarvirus RNA2 component that encodes the RNA dependent RNA polymerase (RdRp) gene. Presence of Ilarvirus sequences in each positive sample was further validated by Sanger sequencing of cloned amplicons of regions of each of RNA1, RNA2 and/or RNA3 that were generated by species specific PCRs and by metagenomic NGS. Prunus necrotic ringspot virus (PNRSV) was the most frequently detected Ilarvirus , occurring in 48 of the 61 Ilarvirus -positive trees and Prune dwarf virus (PDV) and Apple mosaic virus (ApMV) were detected in three trees and one tree, respectively. American plum line pattern virus (APLPV) was detected in three trees and represents the first report of APLPV detection in Australia. Two novel and distinct groups of Ilarvirus -like RNA2 amplicon sequences were also identified in several trees by the generic amplicon NGS approach. The high read depth from the amplicon NGS of the generic PCR products allowed the detection of distinct RNA2 RdRp sequence variant populations of PNRSV, PDV, ApMV, APLPV and the two novel Ilarvirus -like sequences. Mixed infections of ilarviruses were also detected in seven Prunus trees. Sanger sequencing of specific RNA1, RNA2, and/or RNA3 genome segments of each virus and total nucleic acid metagenomics NGS confirmed the presence of PNRSV, PDV, ApMV and APLPV detected by RNA2 generic amplicon NGS. However, the two novel groups of Ilarvirus -like RNA2 amplicon sequences detected by the generic amplicon NGS could not be associated to the presence of sequence from RNA1 or RNA3 genome segments or full Ilarvirus genomes, and their origin is unclear. This work highlights the sensitivity of genus-specific amplicon NGS in detection of virus sequences and their distinct populations in multiple samples, and the need for a standardized approach to accurately determine what constitutes an active, viable virus infection after detection by molecular based methods.

PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.