Search

Cannabinoids exert complex effects on blood pressure related to their interference with cardiovascular centres in the central nervous system and to their direct influence on vascular muscle, vascular endothelium and heart. In view of the relative lack of information on the occurrence of CB1 receptors on the vascular postganglionic sympathetic nerve fibres, the aim of the present study was to examine whether cannabinoid receptor ligands affect the electrically evoked tritium overflow in superfused vessels (tissue pieces) from the guinea-pig, the rat and the mouse preincubated with 3H-noradrenaline. The cannabinoid receptor agonist WIN 55,212-2 (R(+)-[2,3-dihydro-5-methyl-3-[(morpholinyl)methyl]-pyrrolo[1,2,3-de]1,4-benzoxazinyl](1-naphthalenyl) methanone) inhibited the evoked tritium overflow in the guinea-pig aorta, but not in that of the rat or mouse. The concentration–response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist rimonabant, yielding an apparent pA2 value of 7.9. The most pronounced (near-maximum) inhibition obtained at the highest WIN 55,212-2 concentration applied (3.2 μM) amounted to 40%. WIN 55,212-2 also inhibited the evoked overflow in guinea-pig pulmonary artery, basilar artery and portal vein, again in a manner sensitive to antagonism by rimonabant. The latter did not affect the evoked overflow by itself in the four vessels, but did increase the electrically evoked tritium overflow from superfused guinea-pig hippocampal slices preincubated with 3H-choline and from superfused guinea-pig retina discs preincubated with 3H-noradrenaline (labelling dopaminergic cells in this tissue). The inhibitory effect of 3.2 μM WIN 55,212-2 on the evoked overflow from the guineapig aorta was comparable in size to that obtained with agonists at the histamine H3, κ opioid (KOP) and ORL1 (NOP) receptor (1 or 10 μM, producing the respective near-maximum effects) whereas prostaglandin E2 1 μM caused a higher near-maximum inhibition of 70%. Prostaglandin E2 also induced an inhibition by 65 and 80% in the rat and mouse aorta respectively, indicating that the present conditions are basically suitable for detecting presynaptic receptor-mediated inhibition of noradrenaline release. The results show that the postganglionic sympathetic nerve fibres in the guineapig aorta, but not in the rat or mouse aorta, are endowed with presynaptic inhibitory cannabinoid CB1 receptors; such receptors also occur in guineapig pulmonary artery, basilar artery and portal vein. These CB1 receptors are not subject to an endogenous tone and the extent of inhibition obtainable via these receptors is within the same range as that of several other presynaptic heteroreceptors, but markedly lower than that obtainable via receptors for prostaglandin E2. [ABSTRACT FROM AUTHOR]

We studied whether serotonin release in the CNS is inhibited via cannabinoid receptors. In mouse brain cortex slices preincubated with [3H]serotonin and superfused with medium containing indalpine and metitepine, tritium overflow was evoked either electrically (3 Hz) or by introduction of Ca2+ (1.3 mM) into Ca2+-free K+-rich (25 mM) medium containing tetrodotoxin. The effects of cannabinoid receptor ligands on the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline and on the binding of [3H]WIN 55,212–2 and [35S]GTPγS to mouse brain cortex membranes were examined as well. In superfused mouse cortex membranes preincubated with [3H]serotonin, the electrically evoked tritium overflow was inhibited by the cannabinoid receptor agonist WIN 55,212–2 (maximum effect of 20%, obtained at 1 µM; pEC50=7.11) and this effect was counteracted by the CB1 receptor antagonist SR 141716 (apparent pA2=8.02), which did not affect the evoked tritium overflow by itself. The effect of WIN 55,212–2 was not shared by its enantiomer WIN 55,212–3 but was mimicked by another cannabinoid receptor agonist, CP-55,940. WIN 55,212–2 also inhibited the Ca2+-evoked tritium overflow and this effect was antagonized by SR 141716. Concentrations of histamine, prostaglandin E2 and neuropeptide Y, causing the maximum effect at their respective receptors, inhibited the electrically evoked tritium overflow by 33, 69 and 73%, respectively. WIN 55,212–2 (1 µM) inhibited the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline by 49%. [3H]WIN 55,212–2 binding to mouse cortex membranes was inhibited by CP-55,940, SR 141716 and WIN 55,212–2 (pKi=9.30, 8.70 and 8.19, respectively) but not by the auxiliary drugs indalpine, metitepine and tetrodotoxin (pKi<4.5). [35S]GTPγS binding was increased by WIN 55,212–2 (maximum effect of 80%, pEC50=6.94) but not affected by WIN 55,212–3. In conclusion, serotonin release in the mouse brain cortex is inhibited via CB1 receptors, which may be located presynaptically and are not activated by endogenous cannabinoids. The extent of inhibition is smaller than that obtained (1) via another three presynaptic receptors on serotoninergic neurones and (2) via CB1 receptors on cholinergic neurones in the same tissue. [ABSTRACT FROM AUTHOR]

We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and –8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (KD) of rat CB1 cannabinoid receptors, labelled by the radioligand [3H]-SR141716, did not differ in membranes from rats treated with saline, AS1, AS2 or MM. The density of receptor binding (Bmax) was reduced by the antisense oligodeoxynucleotides, 10 nmol, in the hippocampus (AS1, –40%; AS2, –20%) and striatum (AS1, –29%; AS2 –6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of Bmax in the hippocampus and striatum was only marginally increased; a dose of 3 nmol of AS1 reduced Bmax in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3–30 nmol) did not affect Bmax. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB1 receptor mRNA and of β-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over β-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30 nmol attenuated two functional effects via CB1 receptors, i.e., the facilitatory effect of WIN 55,212–2 on [35S]-GTPγS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212–2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB1 receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB1 receptor-mediated effect in two functional models. [ABSTRACT FROM AUTHOR]

We determined the affinity and/or potency of the novel H receptor antagonist iodoproxyfan at α and 5-HT receptors. Iodoproxyfan and rauwolscine (a reference α ligand) (i) monophasically displacedH-rauwolscine binding to rat brain cortex membranes (pK 6.79 and 8.59); (ii) facilitated the electrically evoked tritium overflow from superfused mouse brain cortex slices preincubated withH-noradrenaline (pEC 6.46 and 7.91) and (iii) produced rightward shifts of the concentration-response curve (CRC) of (unlabelled) noradrenaline for its inhibitory effect on the evoked overflow (pA 6.65 and 7.88). In the guinea-pig ileum, iodoproxyfan 6.3 µmol/l failed to evoke a contraction by itself but depressed the maximum of the CRC of 5-hydroxytryptamine (pD′ 5.24). Tropisetron (a reference 5-HT antagonist) produced rightward shifts of the CRC of 5-hydroxytryptamine (pA 7.84). In conclusion, the affinity/potency of iodoproxyfan at H receptors (range 8.3-9.7 [1]) exceeds that at α receptors by at least 1.5 log units and that at 5-HT receptors by at least 3 log units. [ABSTRACT FROM AUTHOR]

The G i/o protein-coupled histamine H 3 receptor is distributed throughout the central nervous system including areas like cerebral cortex, hippocampus and striatum with the density being highest in the posterior hypothalamus, i.e. the area in which the histaminergic cell bodies are located. In contrast to the other histamine receptor subtypes (H 1 , H 2 and H 4 ), the H 3 receptor is located presynaptically and shows a constitutive activity. In detail, H 3 receptors are involved in the inhibition of histamine release (presynaptic autoreceptor), impulse flow along the histaminergic neurones (somadendritic autoreceptor) and histamine synthesis. Moreover, they occur as inhibitory presynaptic heteroreceptors on serotoninergic, noradrenergic, dopaminergic, glutamatergic, GABAergic and perhaps cholinergic neurones. This review shows for four functions of the brain that the H 3 receptor represents a brake against the wake-promoting, anticonvulsant and anorectic effect of histamine (via postsynaptic H 1 receptors) and its procognitive activity (via postsynaptic H 1 and H 2 receptors). Indeed, H 1 agonists and H 3 inverse agonists elicit essentially the same effects, at least in rodents; these effects are opposite in direction to those elicited by brain-penetrating H 1 receptor antagonists in humans. Although the benefit for H 3 inverse agonists for the symptomatic treatment of dementias is inconclusive, several members of this group have shown a marked potential for the treatment of disorders associated with excessive daytime sleepiness. In March 2016, the European Commission granted a marketing authorisation for pitolisant (Wakix R ) (as the first representative of the H 3 inverse agonists) for the treatment of narcolepsy.

In previous studies, long-term cannabis use led to alterations of the endocannabinoid system including an increase in CB1 and/or CB2 receptor messenger RNA (mRNA) in blood cells and an increase in the serum level of the endocannabinoid 2-arachidonoyl glycerol. However, in those studies, cannabis use was stopped only few days before testing or not interrupted at all. Therefore, one cannot decide whether the alterations are due to long-term cannabis abuse or are confounded by acute effects of cannabis. Blood was sampled from donors that had smoked marijuana ≥20 times in their lives but had abstained from cannabis for ≥6 months (high-frequency users, HFU) and from controls (cannabis use ≤5 times lifetime). CB1 and CB2 mRNA was determined in peripheral mononuclear blood cells using the reverse transcriptase polymerase chain reaction. Serum anandamide level was assayed using electrospray tandem mass spectrometry. CB2 mRNA was increased by 45 % in HFU when compared to controls, whereas CB1 mRNA did not differ. The anandamide level in HFU exceeded that in controls by 90 %. Tobacco smoking could be excluded as a confounding factor. In conclusion, marijuana users that had smoked marijuana ≥20 times in their lives and stopped cannabis use at least 6 months before the study show an increase in CB2 receptor mRNA in the blood and in serum anandamide level. These alterations resemble those obtained for marijuana smokers that had stopped cannabis use only few days before testing and may be implicated in the pathogenesis of disorders associated with long-term cannabis use.

We studied whether cannabinoid CB(1) receptors occur on the sympathetic neurones innervating the guinea-pig atrium and renal cortex. Atrial and cortical kidney pieces preincubated with [(3)H]-noradrenaline were superfused and the electrically (3 Hz)-evoked tritium overflow was examined. The evoked overflow in atrium was inhibited by the cannabinoid agonist WIN 55,212-2 maximally by 35%; its concentration-response curve was shifted to the right by the CB(1) antagonist rimonabant (pA(2) 8.3), which, by itself, did not affect the evoked overflow. The evoked overflow in the renal cortex was not altered by WIN 55,212-2. The muscarinic agonist oxotremorine and prostaglandin E(2) inhibited the evoked overflow maximally by 55 and 65% in atrium and by 80 and 55% in kidney, respectively. Furthermore, the nucleotide sequence of the guinea-pig CB(1) receptor was determined (GenBank DQ355990). The deduced amino acid sequence has a high homology to the corresponding sequence of man (98.7%) and rat or mouse (99.2%). In conclusion, presynaptic CB(1) receptors leading to inhibition of noradrenaline release occur in guinea-pig atrium but not renal cortex. The deduced amino acid sequence of the guinea-pig CB(1) receptor shows a homology of 99% to the CB(1) receptor sequence of rodents and humans.

The mechanism of action of cannabidiol, one of the major constituents of cannabis, is not well understood but a noncompetitive interaction with mu opioid receptors has been suggested on the basis of saturation binding experiments. The aim of the present study was to examine whether cannabidiol is an allosteric modulator at this receptor, using kinetic binding studies, which are particularly sensitive for the measurement of allosteric interactions at G protein-coupled receptors. In addition, we studied whether such a mechanism also extends to the delta opioid receptor. For comparison, (-)-Delta9-tetrahydrocannabinol (THC; another major constituent of cannabis) and rimonabant (a cannabinoid CB1 receptor antagonist) were studied. In mu opioid receptor binding studies on rat cerebral cortex membrane homogenates, the agonist 3H-DAMGO bound to a homogeneous class of binding sites with a KD of 0.68+/-0.02 nM and a Bmax of 203+/-7 fmol/mg protein. The dissociation of 3H-DAMGO induced by naloxone 10 microM (half life time of 7+/-1 min) was accelerated by cannabidiol and THC (at 100 microM, each) by a factor of 12 and 2, respectively. The respective pEC50 values for a half-maximum elevation of the dissociation rate constant k(off) were 4.38 and 4.67; 3H-DAMGO dissociation was not affected by rimonabant 10 microM. In delta opioid receptor binding studies on rat cerebral cortex membrane homogenates, the antagonist 3H-naltrindole bound to a homogeneous class of binding sites with a KD of 0.24+/-0.02 nM and a Bmax of 352+/-22 fmol/mg protein. The dissociation of 3H-naltrindole induced by naltrindole 10 microM (half life time of 119+/-3 min) was accelerated by cannabidiol and THC (at 100 microM, each) by a factor of 2, each. The respective pEC50 values were 4.10 and 5.00; 3H-naltrindole dissociation was not affected by rimonabant 10 microM. The present study shows that cannabidiol is an allosteric modulator at mu and delta opioid receptors. This property is shared by THC but not by rimonabant.