Search

Kaposi's sarcoma-associated herpes virus (KSHV), also designated human herpesvirus 8 (HHV8), has been detected consistently in Kaposi's sarcoma, body cavity lymphoma and multicentric Castleman's disease, both in human immunodeficiency virus (HIV)-positive and -negative patients. Identification of KSHV/HHV8 DNA sequences in various benign and malignant vascular tumors in HIV-negative patients was reported in one study, but was not confirmed in several other studies. The vascular lesions, other than Kaposi's sarcoma, in which sequences could not be detected have included malignant vascular tumors of serous membranes, infantile capillary hemangiomas, and several benign and malignant vascular tumors of the spleen. We studied 30 primary benign and malignant vascular tumors of the liver; KSHV/HHV8 DNA sequences could not be detected in any. We conclude that this virus plays no role in the etiology of vascular tumors of the liver.

Context.—Reed-Sternberg cells in classic Hodgkin lymphoma are enigmatic and difficult to study because they are so sparse. Tissue microdissection allows for the isolation of single Reed-Sternberg cells. Isolated Reed-Sternberg cells show clonal immunoglobulin gene rearrangement indicating a B-cell origin. Rarely, Reed-Sternberg cells in classic Hodgkin lymphoma express T-cell antigens, suggesting a possible T-cell origin. Objective.—To determine whether there is a difference in genotype between classic Hodgkin lymphoma and classic Hodgkin lymphoma expressing T-cell antigens and to document T-cell clonality. Design.—We studied 4 cases of Hodgkin lymphoma with a characteristic phenotype and immunoreactivity for CD2 and CD3. Single CD30+ Reed-Sternberg cells from each case were isolated by laser capture microdissection for immunoglobulin heavy chain and T-cell receptor-γ genes by polymerase chain reaction studies. Comparative genomic hybridization was performed in all cases. Results.—Two of 4 cases showed clonal rearrangement of the T-cell receptor-γ; none showed immunoglobulin heavy chain rearrangement. Two control cases were negative for T cell receptor-γ but 1 showed immunoglobulin heavy chain rearrangement. Comparative genomic hybridization analysis revealed significant overlap in genomic alteration in Hodgkin lymphoma cases regardless of genotype or phenotype and several regions of imbalance specific to CD3+ Hodgkin lymphoma cases. All patients are alive with no evidence of disease from 10 to 44 months. Conclusions.—Our findings suggest that a T-cell phenotype classic Hodgkin lymphoma can be supported by genotypic studies and that there may be cytogenetic differences between classic Hodgkin lymphoma and Hodgkin lymphoma expressing T-cell antigens.

Thymic-derived, naturally occurring, CD4+CD25+ regulatory T cells (nTreg) are potent suppressors of immune responses. A detailed understanding of which components of the development and activation of pathogenic effector T cells are inhibited by nTreg during the course of T cell-mediated, organ-specific autoimmunity is as yet unknown. We have analyzed the effects of polyclonal nTreg on the development of autoimmune gastritis. The nTreg inhibited the development of disease, but failed to inhibit the migration of effector cells into the gastric lymph node or stomach. Notably, nTreg did not inhibit the expansion of autoreactive T cells in the gastric lymph node. The primary effect of nTreg appeared to be inhibition of differentiation of autoantigen-specific T cells to Th1 effector cells, as reflected by a decrease in Ag-stimulated IFN-γ production and a reduction in T-bet expression.

Determination of monoclonality through an evaluation of immunoglobulin heavy chain (IgH) gene rearrangements is a commonly performed and useful diagnostic assay. Many laboratories that perform this assay do so by the polymerase chain reaction (PCR). To evaluate current methods for performing IgH gene testing, 19 different Association of Molecular Pathology (AMP) member laboratories analyzed 29 blinded B cell and T cell lymphoid neoplasm samples of extracted DNA and formalin-fixed, paraffin-embedded (FFPE) tissue and were asked to complete a technical questionnaire. From this study, it is clear that Southern blot analysis remains the diagnostic gold standard, with a 100% diagnostic sensitivity and specificity. There was, however, remarkable heterogeneity in the performance of, and results obtained from, IgH PCR assays with diagnostic sensitivity ranging from over 90% to as low as 20%, when evaluating the same specimens. Many laboratories overestimate the diagnostic sensitivity of their IgH PCR assay, and there was a significant, and under appreciated, drop-off (from 61.3% to 41.8%) in detection in paired FFPE as compared with fresh/frozen tissues. Fixation has a dramatic impact on the inability to perform the test on FFPE (43.1%)versus DNA already extracted from fresh or frozen tissue (2.8%). A number of variables that affected the outcome of IgH PCR were identified. Strategies that improved the detection of monoclonal IgH rearrangements include: the addition of FRII to the FRIII upstream primer (increasing detection from 57.3% to 73.6%) and the use of the FR3A rather than the FR3 FRIII primer (increasing detection from 54.7% to 69.7%). Although numerous variables (from DNA extraction to PCR product detection) were evaluated, making it difficult to mandate alterations in laboratory practice, these findings ought to prompt diagnostic molecular pathology laboratories to reevaluate their claims of sensitivity, as well as their methodologies. Both pathologists and surgeons need to ensure that not all submitted material is fixed, if there is adequate sample. Importantly, there is a need for greater standardization to reduce the unacceptably high false negative rate of this crucial diagnostic assay.

To evaluate current diagnostic methods used for the evaluation of T cell receptor (TCR) gene rearrangements, 24 different laboratories analyzed 29 lymphoid neoplasm samples of extracted DNA and paraffin-embedded tissue and were asked to complete a technical questionnaire related to the testing. Participating laboratories performed Southern blot and polymerase chain reaction (PCR) testing for rearrangements of the TCRβ chain gene and PCR for the TCRγ chain gene rearrangements. Of 14 laboratories performing TCRβ Southern blot analysis, there was complete agreement in 10 of 14 cases, with some false negative results obtained in 4 cases. No false positive results were obtained by Southern blot analysis. TCRβ PCR analysis was only performed by two laboratories, and only 47.1% of positive samples were detected. Twenty-one laboratory results were obtained for TCRγ PCR. This method showed an overall detection rate of 77.9% for T cell gene rearrangements with a 4.1% false positive rate, as compared to both TCRγ Southern blot analysis results and immunophenotyping. The detection rate for TCRγ PCR, however, significantly differed when extracted DNA samples from frozen tissue were compared to paraffin-embedded tissue (85.4% versus 65.9%;P = 0.0005). Significant differences in true positive results were obtained when laboratories using primers directed against multiple TCRγ variable regions (V1–8 plus one to three other primer sets) were compared to laboratories that used only a single set of TCR primers directed against the V1–8 (P

Background: The t(11;14)(q13;q32) translocation present in the majority of mantle cell lymphomas (MCLs) places the cyclin D1 gene under the control of immunoglobulin transcriptional regulatory elements, causing overexpression of cyclin D1. Quantification of cyclin D1 expression can distinguish MCL from other lymphomas. Methods: A quantitative real-time reverse transcription (RT)-PCR assay was developed for cyclin D1 mRNA suitable for use with RNA extracted from fresh and formalin-fixed, paraffin-embedded tissues. Specimens were amplified in an Applied Biosystems Model 7700 Sequence Detection System in reactions containing primers and probes for cyclin D1 and a control gene, β2-microglobulin. Relative expression of the two genes was standardized against a control MCL cell line, [M02058.][1] Results: The range of cyclin D1 expression among 20 MCLs was substantially higher than that in other lymphomas and reactive lymph nodes. By choosing an optimal cutoff point for assessing overexpression, the sensitivity and specificity of the assay for the diagnosis of MCL in lymph node specimens both approached 100%: Overexpression was detected in 20 of 20 MCLs, but in none of 21 non-mantle-cell lymphomas or 10 reactive lymph nodes. Conclusions: Quantitative real-time RT-PCR for cyclin D1 overexpression provides a rapid diagnostic test with clinical utility in the diagnosis of MCL. [1]: /lookup/external-ref?link_type=GEN&access_num=M02058.&atom=%2Fclinchem%2F47%2F2%2F195.atom

Objective Primary graft failure (PGF) corneal tissues were analyzed for herpes simplex virus (HSV) and varicella–zoster virus (VZV). Design Retrospective, noncomparative case series. Materials Formalin-fixed, paraffin-embedded tissue of 21 donor corneas and 14 recipient corneas of PGF cases, as well as 10 control corneas. Methods Clinical, histologic, immunohistochemical, polymerase chain reaction (PCR), and, in selected cases, transmission electron microscopic characteristics were studied. Main outcome measures Evidence of HSV or VZV in donor tissues. Results Median patient age was 65 years, and median donor age was 48 years. Donor cornea parameters, including endothelial cell counts, death-to-preservation time, and time in storage, were generally within accepted standards. Stromal edema was found in all 21 donor corneas with PGF. Eighteen donor corneas demonstrated severely reduced or absent endothelium and mild to moderate lymphocytic infiltration without necrosis. Three donor corneas (14%) had necrotizing stromal keratitis (NSK) with keratic precipitates. Positive immunohistochemical staining of keratocytes for HSV was present in two of two donor corneas with NSK and was negative in 18 other donor corneas. Polymerase chain reaction analysis revealed the DNA of HSV type 1 (HSV1) in all donor corneas with NSK and in four donor corneas without NSK (33%). Recipient corneal tissue was negative for HSV1 DNA in three patients with NSK and positive in two of the four other PCR-positive patients. Transmission electron microscopy analysis showed viral particles in two donor corneas with NSK. Polymerase chain reaction analysis revealed no evidence of HSV type 2 or VZV in any cornea. All control corneas were negative for viral DNA. Sixteen corneas remained clear and two had failed after regraft for PGF, with a median follow-up of 3.6 years. Conclusions Herpes simplex virus type 1 DNA was present in 33% of patients of PGF. Herpetic stromal keratitis was found in some failed corneas; the lack of HSV in the paired recipient suggests importation within the donor cornea. The overall prognosis for regrafting after PGF is good.

Two cases of extraosseous Ewing's sarcoma/peripheral neuroectodermal tumor arising in unusual, superficial sites are reported. One tumor involved the vaginal wall of a 35-year-old woman, and the other neoplasm arose in the dermis of the vulva in a 28-year-old woman. The tumors showed characteristic microscopic features of Ewing's sarcoma/peripheral neuroectodermal tumor with nodular monotonous proliferations of undifferentiated, small, round, hyperchromatic cells with a low mitotic index. Rare rosette-like formations were apparent only in the vulvar neoplasm. The tumors displayed intense immunoreactivity in a membranous pattern for CD99, the cell surface glycoprotein encoded by the MIC2 gene. Genetically, the tumors expressed the EWS/FLI-1 chimeric transcript, derived from the t(11;22)(q24;q12) chromosomal translocation. Both patients had localized disease treated with wide local excision; one received postoperative chemotherapy, and the other received chemotherapy and radiotherapy. To date, 18 and 19 months after diagnosis, neither patient has had clinical evidence of local recurrence or metastasis. To our knowledge, these are the first reported cases of vaginal and vulvar Ewing's sarcoma/peripheral neuroectodermal tumor, confirmed with molecular genetic analysis, in the English literature.

Objective Cases of uveal lymphoid proliferation previously classified as reactive lymphoid hyperplasia (RLH) were studied to correlate pathologic features with clinical outcome. Design Retrospective case series. Participants Ten cases of RLH of the uvea on file at the Armed Forces Institute of Pathology with sufficient formalin-fixed, paraffin-embedded tissue for analysis. Methods Clinical, histologic, immunohistochemical, and molecular (polymerase chain reaction [PCR]) characteristics of uveal lymphoid proliferations were studied. Main outcome measures Morphologic, immunohistochemical, and PCR characteristics of study cases. Results Patient age ranged from 40 to 73 years at time of enucleation, with a mean age of 55 years. Retinal detachment was noted clinically in nine patients and glaucoma in eight. All patients were treated with enucleation, and three received radiotherapy. Histologically, two cases were interpreted as RLH and eight were well-differentiated small-cell lymphoma (WDSCL). Systemic lymphoid infiltrate developed in two patients, but there were no deaths with a mean follow-up of 9.9 years. Mature lymphocytes were noted in the iris and angle structures; the atypical cells of uveal lymphoma were found in the choroid and ciliary body. Eight cases were monoclonal by B-cell and T-cell markers and/or immunoglobulin light chain restriction. Amplifiable DNA was present in 6 of 10 cases by PCR. Three cases monoclonal by cell markers were also monoclonal by PCR, but two cases monoclonal by cell markers could not be confirmed by PCR. Lymphoid follicles with germinal centers were found in two cases of RLH and five cases of WDSCL. Nine specimens demonstrated extraocular lymphoid involvement of the episclera and orbit; most appeared more benign morphologically than the choroidal infiltrates. Extraocular infiltrates of WDSCL were monoclonal by immunohistochemistry in five cases, polyclonal in one case, and indeterminate in two cases. Conclusions Most cases (8 of 10) previously described as RLH were low-grade B-cell lymphomas histologically and by immunohistochemistry. PCR results agreed with histologic diagnosis in four of six cases. Open-angle glaucoma was common and related mostly to lymphocytic infiltration of the angle structures. Extraocular involvement is common but may not be representative of the choroidal lesion. Prognosis is excellent in low-grade uveal lymphoid neoplasia.

Background : Clonal rearrangement of genes encoding the immunoglobulins (Ig) and T-cell antigen receptors (TCR) are considered to be useful markers for the diagnosis of lymphoma and for determining the clonal origins of B- and T-cell populations in lymphoid neoplasms. Methods and Results : Polymerase chain reaction-based clonality assays for TCR γ , TCRβ, and immunoglobulin (Ig) heavy chain (IgH) gene rearrangements were evaluated for diagnostic sensitivity and specificity in 569 formalin-fixed, paraffin-embedded (FFPE) tissues. Combined TCRβ and TCRγ assays enhanced the routine detection of TCR clonality to 90% of all peripheral T-cell lymphoma (PTCL) cases. IgH clonality was detected in 59% of 241 peripheral T-cell lymphoma (BCL) cases and 6% of 169 PTCL cases. Of 452 lymphomas, 5% could not be classified phenotypically as B or T lineage after immunohistochemical and clonality studies. Of all BCL cases analyzed, 24% had detectable TCRβ and/or TCR γ clonality. Of these BCL with biclonal results, 47% were extranodal lymphomas from skin and various tissues. Conclusions : Clonality assays were useful for distinguishing reactive or benign lymph nodes from neoplastic lymphoid infiltrates in most cases. The inclusion of TCRβ and TCR γ assays in the assessment of lymphomas results in a significant increase in the sensitivity of clonality detection, but is of limited utility in assessing the T- or B-cell phenotype of the tumor.

Background: RNA is extensively degraded by routine formalin fixation to fragments averaging 200 nucleotides (nt). Several methods for the recovery of amplifiable RNA from formalin-fixed, paraffin-embedded tissue have been described; however, a universally accepted approach in a clinical molecular diagnostic laboratory has not yet emerged. Methods and Results: Amplifiable RNA can be recovered with high efficiency from all types of formalin-fixed, paraffin-embedded tissue using proteinase K digestion, either a phenol-chloroform or an acidic guanidinium thiocyanate-phenol chloroform extraction step, and isopropanol precipitation in the presence of glycogen. Designing primers to detect a small target was critical for consistent RNA amplification in the following assays, with the target size indicated: hepatitis C virus, 169nt; morbillivirus, 78 nt; influenza virus, 113 nt; the npm-alk fusion product resulting from t(2;5) translocation, 175 nt; and the bcr-abl fusion product resulting from t(9;22) translocation, 93 or 168 nt. Conclusions: With use of beta-2-microglobulin as the control messenger RNA target for assessing the recovery of amplifiable RNA from human tissue, amplifiable RNA was recovered from 216 of 225 blocks (96%). In a series of veterinary specimens, which were largely postmortem and moderately to severely autolyzed, 158 of 199 blocks (79%) yielded amplifiable RNA using a beta-actin target. Amplifiable influenza RNA has been recovered from archival paraffin blocks as old as 79 years.

The presence of soluble dextrans, methylcellulose and polyethylene glycol polymers incorporated into vertical sodium dodecyl sulfate (SDS)-polyacrylamide slabs during electrophoresis can have a pronounced effect on protein separations. The effects of various standard and inverse gradients of polymers on the electrophoretic mobility of marker proteins in 10% T, 2.66% C Laemmli-style SDS gels, and the effects of simultaneous pore size and polymer gradients were investigated. These experiments demonstrate that the inclusion of polymers is a new, additional parameter that can be useful in resolving complex mixtures of proteins.

B50 is a murine melanoma-associated antigen found in tight association with B700, a melanoma-specific antigen. B700-like molecules are produced by all melanomas tested to date, including those of murine, human, swine and hamster origin. We have used rabbit antibodies to B50 to determine whether B50 expression is also restricted to melanomas. The results demonstrate that B50 is a commonly occurring protein, or is immunologically cross-reactive to a commonly occurring protein; 29 of 29 cell lines tested bound anti-B50 antibodies. N-terminal amino acid sequence analysis indicates that B50 has significant homology to the Ro/SS-A antigen of human systemic lupus erythematosus and to calcium binding proteins; hence B50 is likely to be an RNA and/or calcium-binding protein.

The peripheral primitive neuroectodermal tumor/Ewing's sarcoma family tumor (pPNET/ESFT) group includes small round cell tumors of the bone, soft tissue, and nerve with morphological attributes of the germinal neuroepithelium. Peripheral PNETs/ESFTs also occur within the craniospinal vault, a region including the central nervous system, the meninges, and the cranial and spinal nerve roots. Gene rearrangements between the EWS gene on chromosome 22q12 and members of the ETS gene family are common in and specific to pPNETs/ESFTs. Another defining characteristic of pPNETs/ESFTs is their membranous expression of the MIC2 gene product. We describe 2 cases of pPNETs within the craniospinal vault. An intradural tumor arising from the nerve roots of the cauda equina was discovered in a 32-year-old man presenting with radiculopathic back pain and lower-extremity weakness. An intracranial pPNET that mimicked a meningioma was found in a 21-year-old man presenting with headache and visual disturbances. MIC2 gene product expression and EWS/ETS gene rearrangement were detected in both case patients. The literature with regard to pPNETs/ESFTs arising within the craniospinal vault is reviewed.

Determination of monoclonality through an evaluation of immunoglobulin heavy chain (IgH) gene rearrangements is a commonly performed and useful diagnostic assay. Many laboratories that perform this assay do so by the polymerase chain reaction (PCR). To evaluate current methods for performing IgH gene testing, 19 different Association of Molecular Pathology (AMP) member laboratories analyzed 29 blinded B cell and T cell lymphoid neoplasm samples of extracted DNA and formalin-fixed, paraffin-embedded (FFPE) tissue and were asked to complete a technical questionnaire. From this study, it is clear that Southern blot analysis remains the diagnostic gold standard, with a 100% diagnostic sensitivity and specificity. There was, however, remarkable heterogeneity in the performance of, and results obtained from, IgH PCR assays with diagnostic sensitivity ranging from over 90% to as low as 20%, when evaluating the same specimens. Many laboratories overestimate the diagnostic sensitivity of their IgH PCR assay, and there was a significant, and under appreciated, drop-off (from 61.3% to 41.8%) in detection in paired FFPE as compared with fresh/frozen tissues. Fixation has a dramatic impact on the inability to perform the test on FFPE (43.1%) versus DNA already extracted from fresh or frozen tissue (2.8%). A number of variables that affected the outcome of IgH PCR were identified. Strategies that improved the detection of monoclonal IgH rearrangements include: the addition of FRII to the FRIII upstream primer (increasing detection from 57.3% to 73.6%) and the use of the FR3A rather than the FR3 FRIII primer (increasing detection from 54.7% to 69.7%). Although numerous variables (from DNA extraction to PCR product detection) were evaluated, making it difficult to mandate alterations in laboratory practice, these findings ought to prompt diagnostic molecular pathology laboratories to reevaluate their claims of sensitivity, as well as their methodologies. Both pathologists and surgeons need to ensure that not all submitted material is fixed, if there is adequate sample. Importantly, there is a need for greater standardization to reduce the unacceptably high false negative rate of this crucial diagnostic assay.

Synovial sarcomas comprise approximately 5% of soft tissue sarcomas and occur primarily in young adults. The t(X;18) (p11.2;q11.2) has been demonstrated to be highly characteristic of synovial sarcomas, and the resulting SYT-SSX fusion transcripts have been shown to be useful diagnostic markers. We have developed a real-time, reverse transcriptase-polymerase chain reaction (RT-PCR) multiplex assay for the identification of the primary fusion transcript types (SYT-SSX1 and SYT-SSX2) from formalin-fixed, paraffin-embedded (FFPE) tissues. Twenty-nine of 30 (96.7%) histologically diagnosed FFPE synovial sarcomas were positive for the presence of either the SYT-SSX1 or SYT-SSX2 fusion transcripts. Ten of 16 (62.5%) and five of 16 (31.25%) monophasic fibrous synovial sarcomas were positive for SYT-SSX1 and SYT-SSX2, respectively. One of 16 (6.25%) monophasic fibrous synovial sarcomas was negative for either SYT-SSX fusion transcript. Twelve of 14 (85.7%) and 2 of 14 (14.3%) biphasic synovial sarcomas were positive for SYT-SSX1 and SYT-SSX2, respectively. All 13 non-synovial sarcomas tested were negative for SYT-SSX1 and SYT-SSX2 fusion transcripts. This method is a relatively simple and rapid procedure for the detection of the t(X;18)(p11.2;q11.2).

Epstein-Barr virus (EBV) has been strongly linked with African Burkitt’s lymphoma and nasopharyngeal carcinoma (NPC) and has recently been associated with breast cancer (1). Nine studies of EBV in breast cancer with the use of different methods (1–9) present conflicting results. In the current study, microdissected ductal breast carcinomas were tested for EBV. Only one of 115 cases was positive. This finding stands in contrast to results of studies of ductal carcinoma showing up to 48% EBV positivity by polymerase chain reaction (PCR). Bonnet et al. (1) found 51 of 100 breast cancers of all types to be PCR positive for EBV. EBV positivity was also shown by Southern blot analysis and immunostain in a subset of cases, but in situ hybridization (ISH) for EBER was negative. A similar pattern has been observed previously (2). Our study included 115 breast cancers, chosen for having microdissectable normal, as well as intraductal, invasive, or metastatic tumor components. Intraductal carcinoma specimens were obtained from 84 patients, invasive tumor in 106 patients, metastases in 50 patients, and recurrences in six. Normal lymph node or other normal tissue was also collected, for a total of 361 samples (10). Institutional approval was received for the conduct of the study. Samples were analyzed by 5!nuclease PCR for the EBNA1 gene. Primers were CTGGAAATGGCCTAGGAGAGAA (nucleotides 637–658; GenBank S45894) and TCCATGGTTATCACCCCCTC (nucleotides 709– 728), and the probe was FAM-AGACACATCTGGACCAGAAGGCTCCGTAMRA (nucleotides 662–687). PCR was performed in 50 !L with 200-nm primers and a 100-nm probe. Cycling conditions were as follows: 50 °C for 2 minutes and 95 °C for 10 minutes, followed by 50 cycles at 95 °C for 15 seconds and 60 °C for 1 minute. The assay detected a single viral copy when titrated against dilutions of a quantified EBV DNA control (Advanced Biotechnologies, Columbia, MD). DNA amplifiability was assessed with the use of the HER2 gene as a control. Primers were ATGCAGATTGCCAAGGTATGC (nucleotides 977–997; GenBank M12036) and GGAAGCACCCATGTAGACCTTCT (nucleotides 1098–1120), and the probe was VIC-CCGGAGCAAACC C C T A T G T C C A C A A T A M R A (nucleotides 1021–1045). A kit was used for EBER ISH (Biogenex, San Ramon CA). Immunostaining for LMP1 was performed with monoclonal antibody clones CS1–4 (DAKO A/S, Glostrup, Denmark). Amplifiable DNA was obtained from 278 (77%) of 361 samples. Of these, only six samples were positive for EBNA1. EBV-positive blocks were analyzed by EBER ISH and LMP1 immunohistochemistry. Three were lymph nodes—two from cases without metastases and one from a case with metastatic carcinoma. All of these contained occasional EBERand LMP1-positive lymphocytes; the metastatic tumor itself was negative for both EBER and LMP1. The other three positive specimens were from one patient. In this case, both EBER and LMP1 staining demonstrated that EBV was present in 50%–75% of normal ductal epithelium, as well as in the intraductal and invasive carcinoma components. The expected nuclear location of EBERs was observed (11,12). LMP1 staining was predominantly nuclear, in contrast to positive controls showing typical membrane staining (13,14). The predominant human EBV is the B95.8 strain. Variant strains may be responsible for the epithelial tropism of NPC (15). Theoretically, variants might escape PCR detection, but a study of NPC patients with the use of primers in the variable region of EBNA1 still detected EBV in all 50 cases (16). The sensitivity of our assay was confirmed in an ethnically diverse series of NPC patients. For 13 cases with amplifiable DNA, nine (69%) were positive for EBV. Therefore, it is unlikely that our negative results were due to undetectable EBV variants. Most investigations have used fixed tissue; however, two studies (1,3) used fresh frozen tissue and detected EBV by PCR plus either ISH or immunostain in 25%–48% of ductal carcinomas. Luqmani et al. (2) performed PCR on 48 frozen and 12 fixed samples and found them to be positive in 39% and 33%, respectively. This modest gain in sensitivity in fresh tissue is insufficient to explain the discrepancies in the literature. The PCR target is another potential source of variation. Most studies yielding positive results used targets in the long internal repeat (IR1), where PCR is 10 times more sensitive than for the EBER gene (1). While incomplete reporting and differences in methodology or diagnoses prevent strict meta-analysis, aggregate statistics for EBV detection were compiled. For all studies, PCR detected EBV in 23.8% of all patients and histologies. Given the sensitivity of PCR and the persistence of latent lymphocytic infection, this result is unsurprising. Stable, latently infected lymphocytes contain multiple EBV copies (17), and the overall positivity rate in breast cancer is no higher than that often observed in normal tissues (18–23). Microdissection is a unique advantage of this study, thereby reducing benign lymphocyte contamination. The purity of these microdissections from stromal contamination has been demonstrated by loss-of-heterozygosity analyses (10). The other published investigations (1–9) used lysates from whole tumors. One such study (5) demonstrated by ISH that EBV PCR positivity in breast cancer was due to latently infected lymphocytes.

We report a retrospective clinicopathologic study of 108 primary thyroid gland lymphomas (PTLs), classified using the REAL and proposed WHO classification schemes. The patients included 79 women and 29 men, with an average age of 64.3 years. All patients presented with a thyroid mass. The PTLs were classified as marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue (MALT) or MZBL (n = 30), diffuse large B-cell lymphoma (DLBCL) with MZBL (n = 36), DLBCL without MZBL (n = 41), and follicle center lymphoma (FCL; n = 1). Excluding the FCL, features of lymphomas of MALT-type were identified in all groups, despite a follicular architecture in 23% of cases. Lymphocytic thyroiditis (LT) was identified in 94%. Ninety-one percent of patients presented with stage IE or IIE disease, whereas 69% had perithyroidal soft tissue infiltration. All patients were treated with surgical excision followed by adjuvant therapy (76%): chemotherapy (15%), radiation (19%), or a combination of radiation and chemotherapy (42%). Disease-specific survival was 82% at last follow up (mean, 82.8 mos) and 79% at 5 years. Statistically, stages greater than IE, presence of DLBCL, rapid clinical growth, abundant apoptosis, presence of vascular invasion, high mitotic rate, and infiltration of the perithyroidal soft tissue were significantly associated with death with disease. No patients with MZBL or stage IE disease died with disease. In summary, PTLs typically occur in middle- to older-aged individuals as a thyroid mass, with a predilection for females. Despite their histologic heterogeneity and frequent simulation of other lymphoma subtypes, virtually all PTLs are lymphomas of MALT-type arising in the setting of LT. Mixed DLBCL and MZBL are common. Overall, PTLs have a favorable outcome with appropriate therapy, but prognosis depends on both clinical stage and histology. MZBL and stage IE tumors have an excellent prognosis, whereas tumors with a large cell component or DLBCL or stage greater than IE have the greatest potential for a poor outcome.

Nodular lymphoid hyperplasia is a controversial entity in which its existence in the lung has been doubted. The current opinion is that most, if not all, such cases represent extranodal marginal zone B-cell lymphomas masquerading as reactive lesions. We found 14 cases of nodular lymphoid hyperplasia in the files of the Pulmonary Department at the Armed Forces Institute of Pathology from 1974 through 1998. All had clinical histories and hematoxylin-eosin slides. In 12 of 14 with paraffin blocks, we applied immunohistochemical antibodies for CD20, CD3, CD43, CD5, bcl-2, bcl-1, CD45RA, and kappa and lambda immunoglobulin light chains. Molecular genetic analysis was performed on paraffin sections in 10 of 14 by the polymerase chain reaction for rearrangements of the immunoglobulin heavy chain gene and the minor and major break-point regions of the chromosomal translocation t (14;18). There were eight women and six men ranging in age from 19 to 80 years (median, 65 yrs). Most lesions (71%) were incidental findings on routine chest x-rays. Most patients (64%) had a single lesion by chest x-ray whereas the remainder had two to three lesions, except for one patient who had "multiple" lesions. There was associated regional lymphadenopathy in five of 14 cases (36%) which, on biopsy, proved to be reactive follicular hyperplasia. The only treatment was surgical excision. Of the seven patients with follow-up information from 8 months to 6 years (mean, 30 mos), none had clinical recurrence and no patient died of disease. The histology and immunophenotype of the lesions were strikingly similar, including abundant reactive germinal centers, intense interfollicular polyclonal plasmacytosis, and a variable degree of interfollicular fibrosis. No case showed a molecular rearrangement of the immunoglobulin heavy chain gene or the minor or major break-point region of the t (14;18). We conclude that nodular lymphoid hyperplasia of the lung, although rare, does exist and deserves its place in the spectrum of reactive pulmonary lesions that ranges from follicular hyperplasia to diffuse hyperplasia of the bronchus-associated lymphoid tissue (lymphoid interstitial pneumonitis).

Mantle-cell lymphomas are associated with a characteristic chromosomal translocation, t(11;14)(q13;q32). This translocation involves rearrangement of the bcl-1 proto-oncogene from chromosome 11 to the immunoglobulin heavy chain gene on chromosome 14, resulting in an overexpression of cyclin D1 mRNA (also known as bcl-1 and PRAD1). In the current study performed on paraffin-embedded tissue, cyclin D1 mRNA could be detected in 23 of 24 mantle-cell lymphomas by reverse transcription polymerase chain reaction (RT-PCR) whereas only 9 of 24 demonstrated a t(11;14) by PCR. However, we also found that cyclin D1 mRNA could be detected in the majority (11 of 17, 65%) of non-mantle-cell lymphomas and in a minority of atypical lymphoid hyperplasias (3 of 7, 43%). Cyclin D1 mRNA expression was not observed in floridly reactive lymph nodes (0 of 9) or in unstimulated lymph nodes (0 of 20), suggesting that it is a sensitive adjunct marker for malignant lymphoproliferative processes, but not specific for mantle-cell lymphoma. A semiquantitative RT-PCR assay was developed that compared the ratio of cyclin D1 to the constitutively expressed gene beta2-microglobulin. Using this assay on a limited number of our specimens, cyclin D1 overexpression in mantle-cell lymphoma could be reliably distinguished from its expression in other non-Hodgkin's lymphomas. This assay for cyclin D1 expression, designed for formalin-fixed, paraffin-embedded tissue, was a very sensitive and specific marker for mantle-cell lymphoma.

The “Spanish” influenza pandemic killed at least 20 million people in 1918–1919, making it the worst infectious pandemic in history. Understanding the origins of the 1918 virus and the basis for its exceptional virulence may aid in the prediction of future influenza pandemics. RNA from a victim of the 1918 pandemic was isolated from a formalin-fixed, paraffin-embedded, lung tissue sample. Nine fragments of viral RNA were sequenced from the coding regions of hemagglutinin, neuraminidase, nucleoprotein, matrix protein 1, and matrix protein 2. The sequences are consistent with a novel H1N1 influenza A virus that belongs to the subgroup of strains that infect humans and swine, not the avian subgroup.

In previous studies we have demonstrated that water soluble polymers of dextran and methylcellulose, when incorporated into sodium dodecyl sulfate (SDS)-polyacrylamide gels, can be used to sharpen the protein bands. We have extended these studies to enhance the separations in the mid-molecular weight range. Enhanced separation of protein molecular weight markers between 30,000-67,000 was best achieved in SDS-gels containing 2.5% polyvinylpyrrolidone (average molecular weight 10,000).

Pleural fibrosis may complicate several types of non-exudative pleural injury. Although the pathogenesis of such lesions is poorly understood, it is conceivable that mesothelial cells may recruit fibroblasts to sites of pleural damage. In order to test this possibility, conditioned medium from cultured rat mesothelial cells was tested for chemoattractant activity towards RL-87 rat lung fibroblasts. For this purpose, rat pleural or pericardial mesothelial cells were maintained in vitro for 6 to 96 h. Conditioned medium from each source was obtained at defined culture times and tested for chemotactic activity in a 48-well microchemotaxis assembly. A progressive, time-dependent increase in fibroblast chemoattractant activity was detected in both pleural and pericardial mesothelial cell conditioned medium samples. This effect was maximal in 96-h cultures. Checkerboard analysis revealed that the conditioned medium was truly chemotactic for lung fibroblasts. Characterization of the chemoattractant demonstrated that it was a nondialyzable (greater than 16 kD), thermolabile (100 degrees C for 15 min), acid-stable (pH 2.5), trypsin-sensitive, and pepsin-sensitive protein. The chemotaxin was shown to be fibronectin, since activity was abolished, in a dose-dependent manner, by treatment with anti-rat fibronectin antiserum as well as by passage through a gelatin agarose affinity column. This product consisted of two bands on sodium dodecyl sulfate polyacrylamide gel electrophoresis of apparent molecular masses 250 and 220 kD. The secretion of a mesothelial cell-derived fibroblast chemoattractant may play a role in the response of the pleura to injury and in the pathogenesis of pleural fibrosis.

Because little is known about the use of aqueous polymers in polyacrylamide gel electrophoresis, we undertook a feasibility study that enables the discontinuous Laemmli-formulated system of sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis to be performed in a horizontal format by the addition of large-sized aqueous polymers (i.e., dextrans and methylcelluloses). We studied four parameters: the cross-linking agent (bisacrylamide vs AcrylAide) and the polymer concentration, nature, and size. Three concentrations of each polymer were used. The best differentiation between the standard markers and the sharpest bands were obtained using concentrations of 2.5 and 0.06% (w/v) for Dextran T-500 and methylcellulose 4000, respectively. There was no predictable pattern to the variation in the plots of log Mr vs Rf caused by varying the concentration and length of the dextrans; however, the methylcellulose patterns suggest that gel viscosity is important. The results suggest that the combination of 0.06% methylcellulose 4000 polymers with bisacrylamide is a convenient and inexpensive means of performing flatbed Laemmli SDS-polyacrylamide gel electrophoresis.

Limited available evidence indicates that the B700 murine melanoma antigen is related to serum albumin, but potential relationships to other members of the serum albumin protein family have not yet been established. Using specific antibodies raised against each of the members of the albumin family, we have studied cross-reactivity by solid phase enzyme-linked immunosorbent assay and Western immunoblotting. We demonstrate that B700 is serologically cross-reactive to members of the serum albumin family, which includes α-fetoprotein and vitamin D binding protein. Therefore, B700 is part of the serum albumin family of proteins, although the mechanism underlying its specific expression by transformed melanocytes remains unknown.

Previous observations indicated the absence of demonstrable 5'-nucleotidase activity in six of seven cultured murine melanoma cell lines. It could not be determined from those studies whether the enzyme was absent, or whether an inhibitor was present. The current studies indicate that no inhibitor can be demonstrated, therefore the enzyme is absent.