Search

Anti-thymocyte globulin (ATG) is an important prophylactic drug against acute graft-versus-host disease (aGVHD) after haploidentical hematopoietic stem cell transplantation (haplo-HSCT). This study analyzed the pharmacokinetics of rabbit ATG 2.5 mg/kg and its effect against aGVHD in 24 patients undergoing unmanipulated haplo-HSCT. All patients had hematological malignancies not in remission. The median absolute lymphocyte count (ALC) before rabbit ATG administration was 9.5/µL (range 0-41/µL). The grade ≥ II aGVHD group had a significantly lower median rabbit ATG concentration on days 0 (C

The synthesis of 1,1-difluoro-1-alkenes was achieved by the treatment of dithioesters and thioketones with trimethylsilyl 2-fluorosulfonyl-2,2-difluoroacetate in the presence of a proton sponge cat...

Non‑alcoholic steatohepatitis (NASH) is a pathological condition of the liver in which hepatocyte steatosis, invasion of inflammatory cells and hepatic injury occur without alcohol abuse. Despite the known risk of liver cancer and liver fibrosis that may progress to liver cirrhosis that exists with NASH, an understanding of related gene expression and associated functional changes remains insufficient. The present study used a mouse model of NASH induced by a high‑fat diet to examine gene expression in the liver and to search for transcripts that could predict early liver fibrosis in the future. Mice fed a high‑fat diet for 2 weeks showed typical NASH liver histology by hematoxylin and eosin staining, and increased fibrosis was confirmed by Sirius red staining after 6 weeks. Functional changes associated with liver damage, liver inflammation, liver steatosis and liver fibrosis were predicted by toxicological ontology analysis using Ingenuity Pathways Analysis. Downregulated microRNA (miR)‑21 and upregulated

Ponatinib is a third-generation tyrosine kinase inhibitor (TKI) reported to show a higher efficacy for adult Philadelphia chromosome-positive acute lymphoblastic leukemia (Ph+ALL) than other TKIs. However, few studies describe ponatinib for pediatric Ph+ALL; therefore, the efficacy, safety, and optimal dosage have not been determined. Here, we report a 3-year-old girl with Ph+ALL treated by a ponatinib-containing regimen with therapeutic drug monitoring in the plasma and cerebrospinal fluid (CSF). In our case, a ponatinib-containing regimen was able to keep minimal residual disease negative, and the pharmacokinetics (PKs) of plasma ponatinib resembled that previously reported in adults. Penetration to the CSF was extremely limited. Thus, ponatinib was feasible and effective for a child with Ph+ALL, although the plasma concentration of ponatinib varied significantly throughout the treatment. The appropriate dosage should be confirmed in a prospective trial, including a detailed PK study.

Methylmercury (MeHg) is a chemical substance that causes adverse effects on fetal development. However, the molecular mechanisms by which environmental MeHg affects fetal development have not been clarified. Recently, it has been suggested that the toxic effects of chemicals on fetal development are related alterations in epigenetics, such as DNA methylation and histone modification. In order to analyze the epigenetic effects of low-level MeHg exposure on neuronal development, we evaluated neuronal development both in vivo and in vitro. Pregnant mice (C57BL/6J) were orally administrated 3 mg/kg of MeHg once daily from embryonic day 12-14. Fetuses were removed on embryonic day 19 and brain tissues were collected. LUHMES cells were treated with 1 nM of MeHg for 6 days and collected on the last day of treatment. In both in vivo and in vitro samples, MeHg significantly suppressed neurite outgrowth. Decreased acetylated histone H3 (AcH3) levels and increased histone deacetylase (HDAC) 3 and HDAC6 levels were observed in response to MeHg treatment in both in vivo and in vitro experiments. In addition, increased DNA methylation and DNA methyltransferase 1 (DNMT1) levels were observed in both in vivo and in vitro experiments. The inhibition of neurite outgrowth resulting from MeHg exposure was restored by co-treatment with DNMT inhibitor or HDAC inhibitors. Our results suggest that neurological effects such as reduced neurite outgrowth due to low-level MeHg exposure result from epigenetic changes, including a decrease in AcH3 via increased HDAC levels and an increase in DNA methylation via increased DNMT1 levels.

Spontaneous intracranial hypotension (SIH) is caused by cerebrospinal fluid (CSF) leakage. Patients with SIH experience postural headaches, nausea, etc., due to CSF hypovolemia. Imaging studies and clinical examinations, such as radioisotope (RI) scintigraphy, are useful for diagnosing SIH. However, 20-30% of patients do not show typical morphology and clinical test results. We previously reported that CSF contains transferrin (Tf) isoforms: “brain-type” Tf derived from the choroid plexus and “serum-type” Tf derived from blood. We showed that both isoforms increased in the CSF of patients with SIH by Western blotting. In the present study, we demonstrate that conventional ELISA for quantifying total Tf is useful for diagnosing SIH more accurately than Western blotting. In addition, SIH with chronic subdural hematoma (CSDH) was also accurately diagnosed. Total Tf in the CSF can serve as a useful biomarker for diagnosing SIH with or without CSDH.

Prolonged neurological symptoms such as "brain fog" and cognitive impairment have occurred after coronavirus disease 2019 (COVID-19) infection. In this report, we describe impaired consciousness caused by cefepime hydrochloride (CFPM) in a patient with cognitive sequalae of COVID-19. A 56-year-old male patient was diagnosed with penile abscess after COVID-19 infection, and a blood culture detected two drug-resistant Pseudomonas aeruginosa strains. Therefore, CFPM 2 g × twice/day was administered on day 71 after intensive care unit admission. Approximately 48 h after CFPM administration, the patient showed disturbances in consciousness. Contrast-enhanced computed tomography, magnetic resonance imaging, and spinal fluid examination revealed no obvious abnormalities. Therefore, CFPM-induced neurotoxicity was suspected. CFPM was discontinued and ceftazidime 2 g × three times/day was initiated. The patient's consciousness improved 30 h after the final administration of CFPM. Serum CFPM concentrations were 14.2, 21.7, 21.7, and 11.9 μg/mL on days 1, 2, and 3 after the initiation of CFPM and on the day after CFPM was discontinued, respectively. In conclusion, intensivists should pay attention to new neurological symptoms such as CFPM-induced encephalopathy in patients with prolonged neurological symptoms after COVID-19 infection.

Busulfan (Bu) has been used in combination with fludarabine (Flu; BuFlu) or cyclophosphamide (Cy; BuCy) as conditioning for allogeneic hematopoietic stem cell transplantation (HSCT). This multi-institutional prospective study compared pharmacokinetic (PK) parameters of Bu between BuFlu and BuCy. Plasma Bu concentrations were measured by high-performance liquid chromatography at the first dose of the first and fourth days of intravenous Bu administrations (total of 16 doses of 0.8 mg/kg). Thirty-seven patients were evaluable (BuFlu, N = 18; BuCy, N = 19). The median age was significantly higher in BuFlu. In BuFlu, the median area under the blood concentration–time curve of Bu on the fourth day was 1183 μmol min/L (range 808–1509), which was significantly higher than that on the first day [1095 μmol min/L (range 822–1453), P

Patients who undergo renal replacement therapy often exhibit a high plasma linezolid concentration. Linezolid is metabolized via oxidation. Nafamostat mesilate has antioxidant effects and is frequently used as an anticoagulant during renal replacement therapy. We aimed to investigate the effect of nafamostat mesilate on plasma linezolid concentration. We examined whether the co-administration of linezolid and nafamostat had any effect on plasma linezolid concentration. Mice were randomly allocated to two groups (n = 18/group): linezolid (100 mg kg-1 , subcutaneous injection) + nafamostat (30 mg kg-1 , intraperitoneal injection) and linezolid + saline. At 5 hours, the linezolid concentration was significantly higher in the linezolid + nafamostat co-administration group than that in the linezolid + saline group (20.6 ± 9.8 vs 3.6 ± 1.2 μg/mL, respectively P < .001). The antioxidant effects of nafamostat may inhibit linezolid metabolism, resulting in the adverse event of high linezolid concentration if both are administered concurrently during renal replacement therapy.

Background A treatment strategy is needed for hemodialysis-dependent patients with end-stage renal disease who have relapsed/refractory diffuse large B-cell lymphoma (DLBCL). We examined the feasibility of salvage chemotherapy followed by autologous stem-cell transplantation (ASCT) and busulfan as a conditioning regimen. Patients and Methods We provided a patient with refractory DLBCL who was receiving hemodialysis with modified salvage chemotherapies that were based on the mechanism of drug pharmacokinetics and an evaluation of the pharmacokinetics of busulfan. After chemotherapy, the patient underwent ASCT. Results The regimen was successfully administered without adverse events. Conclusion Chemotherapy followed by ASCT using a conditioning regimen of reduced melphalan and pharmacokinetically targeted busulfan is a promising strategy for treating patients with relapsed or refractory DLBCL who also have end-stage renal disease and are receiving hemodialysis.

Background Itraconazole (ITCZ) is used to treat pulmonary aspergillosis, but findings regarding the range of effective plasma concentrations are often contradictory. This study attempted to determine effective plasma concentrations of ITCZ and its active metabolite hydroxyitraconazole (OH-ITCZ) by retrospectively analyzing their relationships to clinical efficacy. Methods The study included 34 patients with pulmonary aspergillosis treated using ITCZ (mean age, 70 years). Each patient was treated with 200 mg ITCZ once daily (mean duration of treatment: 384 days). Plasma concentrations of ITCZ and OH-ITCZ at trough levels from 7 to 889 days after the start of treatment were determined using high-performance liquid chromatography. Clinical efficacy was assessed through the improvement clinical symptoms. Results Fifteen patients were classified as effective group and the other 19 patients as non-effective group. Mean (±standard deviation) ITCZ trough plasma concentration was significantly higher in effective group (1254 ± 924 ng/mL) than in non-effective group (260 ± 296 ng/mL). Mean OH-ITCZ plasma concentration was significantly higher in effective group (1830 ± 1031 ng/mL) than in non-effective group (530 ± 592 ng/mL). Receiver operating characteristic curve analysis revealed the optimal cutoff for ITCZ trough plasma concentration was 517 ng/mL, and 86.7% of effective group showed concentrations exceeding this value. The optimal cutoff for total ITCZ + OH-ITCZ plasma concentration was 1025 ng/mL, and 93.3% of effective group showed a concentration exceeding this value. Conclusions Our findings indicate that effective plasma concentration ranges for the treatment of pulmonary aspergillosis begin at an ITCZ trough plasma concentration of 500 ng/mL and a total ITCZ + OH-ITCZ plasma concentration of 1000 ng/mL.

Introduction: Renal replacement therapy (RRT) is widely used in the treatment of septic acute kidney injury. However, little is known about how the adsorption properties of hemofilters used in RRT affect antibiotic concentration. Because a cytokine-adsorption membrane is frequently used in RRT, it is important to determine the antibiotic adsorption capacity of this membrane. Objective: The present study aimed to investigate the antibiotic adsorption capacity of different hemofilter membranes by in vitro experiments using 2 antibacterial agents (linezolid and doripenem). Methods: We performed experimental hemofiltration in vitro using polyacrylonitrile (AN69ST), polymethylmethacrylate (PMMA), and polysulfone (PS) hemofilters for 1,440 min. The test solution was a 1,000-mL substitution fluid containing 30 µg/mL linezolid and 120 µg/mL doripenem. We measured drug concentrations at the inlet, outlet, and filtrate ports of the hemofilters for 1,440 min and calculated the sieving coefficient (SC) and adsorption rate (Ra) of the drugs onto the hemofilters. Results: The amount of linezolid adsorbed onto AN69ST, PMMA, and PS membranes was decreased relative to that in the control group at 15 min (p < 0.05). However, no SC for linezolid was obtained thereafter. The Ra of linezolid onto AN69ST, PMMA, and PS membranes was higher than that in the control group (p < 0.05). In contrast, no significant differences were observed in the concentrations and Ra values of doripenem adsorbed onto AN69ST, PMMA, and PS membranes compared with those in the control group. Conclusions: Doripenem was not adsorbed onto PMMA, PS, and AN69ST membranes. Linezolid was adsorbed onto PMMA, PS, and AN69ST membranes, but only temporarily, and this did not affect drug bioavailability.

Antiseizure prophylaxis is required during busulfan administration for hematopoietic stem cell transplantation. However, antiseizure agents such as benzodiazepines and phenytoin may produce adverse effects through interaction with other drugs. We retrospectively assessed the prophylactic efficacy and safety of levetiracetam and clonazepam against busulfan-induced seizures between 2013 and 2018. Thirty patients (after 2015) received levetiracetam, and 13 patients (before 2015) received clonazepam in this study. Levetiracetam was well-tolerated and had a significantly lower frequency of adverse effects, such as somnolence, compared with clonazepam, although two patients in the levetiracetam group experienced seizures. Levetiracetam is a feasible option for preventing busulfan-induced seizures.

Background Therapeutic drug monitoring for busulfan is important to prevent adverse events and improve outcomes in stem cell transplantation. We investigated intravenous busulfan pharmacokinetics and evaluated the utility of limited sampling strategy (LSS) as a simple method to estimate the area under the concentration-time curve (AUC). Procedure The study comprised 87 busulfan measurements in 54 children who received intravenous busulfan between August 2015 and May 2020. AUCs were calculated from three to five blood sampling points in each patient, and the correlation between AUC and plasma concentrations (ng/mL) at 1, 2, 3, 4, and 6 h after initiating busulfan infusion (C1 , C2 , C3 , C4 , and C6 , respectively). Results By one-point sampling strategy, the most relevant predicted AUC was based on C6 (r2 = 0.789; precision, 11.0%) in all patients. The predicted AUC based on C6 was acceptable (r2 = 0.937; precision, 5.9%) for adolescent patients weighing >23 kg, but the correlation was poor in infants and young children weighing ≤ 23 kg (r2 = 0.782; precision, 11.4%). By two-point sampling strategy, the predicted AUC based on C3 and C6 showed the most relevant concentrations (r2 = 0.943; precision, 6.4%), even in infants and young children, whereas the predicted AUC based on C3 and C6 was acceptable (r2 = 0.963; precision, 5.7%). Conclusions The AUC of busulfan can be predicted based on C6 in adolescent patients. However, there was substantial interindividual variation in busulfan pharmacokinetics in infants and young children, in whom two-point LSS was necessary for accurate AUC prediction.

Glycan engineering of antibodies has received considerable attention. Although various endo-β- N-acetylglucosaminidase mutants have been developed for glycan remodeling, a side reaction has been reported between glycan oxazoline and amino groups. In this study, we performed a detailed characterization for antibody products obtained through enzymatic and nonenzymatic reactions with the aim of maximizing the efficiency of the glycosylation reaction with fewer side products. The reactions were monitored by an ultraperformance liquid chromatography system using an amide-based wide-pore column. The products were characterized by liquid chromatography coupled with tandem mass spectrometry. The side reactions were suppressed by adding glycan oxazoline in a stepwise manner under slightly acidic conditions. Through a combination of an azide-carrying glycan transfer reaction under optimized conditions and a bio-orthogonal reaction, a potent cytotoxic agent monomethyl auristatin E was site-specifically conjugated at N-glycosylated Asn297 with a drug-to-antibody ratio of 4. The prepared antibody-drug conjugate exhibited cytotoxicity against HER2-expressing cells.

Purpose To determine the intraocular penetration of amphotericin B (AMPH-B) after an intravenously injection of liposomal amphotericin B (L-AMB) in inflamed human eyes. Methods Seven eyes of 5 patients with fungal eye diseases (endophthalmitis in 6 eyes and keratitis in 1 eye) were treated with intravenous injections of 100–250 mg/day of L-AMB. Samples of blood, corneal button, aqueous humor, and vitreous humor were collected and assessed for AMPH-B. Results The AMPH-B level in the cornea (604.0 μg/g) of the case with fungal keratitis exceeded the minimum inhibitory concentration. However, the levels in the aqueous and vitreous humors of the cases with fungal endophthalmitis were lower, e.g., 0.02 ± 0.01 μg/ml (0.09% of serum level) in the aqueous humor and 0.05 ± 0.08 μg/ml (0.17% of serum level) in the vitreous humor. Conclusions The AMPH-B levels administered intravenously were very low in the aqueous and vitreous humors. Our findings indicate that intravenous L-AMB can be considered only for patients with mild endogenous fungal endophthalmitis, e.g., isolated chorioretinitis without vitreous extensions.

We experienced a rare case of ureteropelvic junction disruption (UPJD) as a seat belt injury. A 19-year-old female was transferred after a car accident while wearing a seat belt. Computed tomography showed multiple fractures including Chance fracture dislocation of the first lumbar spine and right renal laceration with partial infarction. Emergency posterior spinal fusion was performed. The next day, computed tomography revealed right perirenal contrast extravasation, and right UPJD was confirmed with retrograde urography and ureteroscopy. Ureteropelvic reanastomosis was performed. Computed tomography of excretory phase or repeat evaluation is recommended to prevent delayed diagnosis of UPJD including seat belt injury.

Allogeneic hematopoietic stem cell transplantation (HSCT) is performed as a curative treatment for children with nonmalignant diseases, such as bone marrow failure syndromes and primary immunodeficiencies. Because graft-versus-host-disease (GVHD) is a major factor affecting survival probability and quality of life after HSCT, the availability of HLA-matched donors restricts the application of HSCT. Recently, HSCT with post-transplantation cyclophosphamide (PTCy) has emerged as a potent method to prevent GVHD after HSCT from HLA-haploidentical donors, and some studies have suggested the safety of PTCy-HSCT for nonmalignant diseases. We conducted a prospective clinical trial aiming to help confirm the safety of HSCT and further reduction of GVHD using a combination of PTCy and low-dose antithymocyte globulin (ATG) from HLA-mismatched related donors for children with nonmalignant diseases. Six patients underwent HSCT and achieved engraftment at a median of 14.5 days, and no patient developed severe acute GVHD. All patients had sustained donor chimerism without developing chronic GVHD at the last follow-up. In conclusion, HSCT with PTCy and low-dose ATG from an HLA-mismatched related donor were feasible to control GVHD for nonmalignant diseases in the children involved in our study. © 2020 American Society for Transplantation and Cellular Therapy. Published by Elsevier Inc.

Siglec-7 is a human CD33-like siglec, and is localised predominantly on human natural killer (NK) cells and monocytes. Siglec-7 is considered to function as an immunoreceptor in a sialic acid-dependent manner. However, the underlying mechanisms linking sialic acid-binding and function remain unknown. Here, to gain new insights into the ligand-binding properties of Siglec-7, we carried out in silico analysis and site-directed mutagenesis, and found a new sialic acid-binding region (site 2 containing R67) in addition to the well-known primary ligand-binding region (site 1 containing R124). This was supported by equilibrium dialysis, STD-NMR experiments, and inhibition analysis of GD3-binding toward Siglec-7 using synthetic sialoglycoconjugates and a comprehensive set of ganglioside-based glycoconjugates. Our results suggest that the two ligand-binding sites are potentially controlled by each other due to the flexible conformation of the C-C′ loop of Siglec-7.

Busulfan (Bu) has been used in combination with fludarabine (Flu; BuFlu) or cyclophosphamide (Cy; BuCy) as conditioning for allogeneic hematopoietic stem cell transplantation (HSCT). This multi-institutional prospective study compared pharmacokinetic (PK) parameters of Bu between BuFlu and BuCy. Plasma Bu concentrations were measured by high-performance liquid chromatography at the first dose of the first and fourth days of intravenous Bu administrations (total of 16 doses of 0.8 mg/kg). Thirty-seven patients were evaluable (BuFlu, N = 18; BuCy, N = 19). The median age was significantly higher in BuFlu. In BuFlu, the median area under the blood concentration-time curve of Bu on the fourth day was 1183 μmol min/L (range 808-1509), which was significantly higher than that on the first day [1095 μmol min/L (range 822-1453), P 0.01]. In contrast, such differences were not observed in BuCy. Consistently, there was a significant decrease in the clearance of Bu on the fourth day as compared with the first day in BuFlu. These results suggest that the PK of Bu was altered during the co-administration of Flu, which was not the case with Cy. A large-scale study is required to evaluate the significance of the differences in the PK of Bu between the conditionings on HSCT outcomes.

An optimal pretransplant conditioning regimen for allogeneic hematopoietic stem cell transplantation (allo-HSCT) in older adults has not been established. Three prospective multicenter phase II studies were conducted, in which 142 patients older than 54 years (median age, 61 years; range 55–70 years) with acute myeloid leukemia (AML) or myelodysplastic syndrome (MDS) received a myeloablative dose of intravenous busulfan (ivBu, 12.8 mg/kg) along with fludarabine (180 mg/m2) ± low dose total body irradiation for allo-HSCT between September 2009 and February 2013. A total of 103 AML and 39 MDS patients including 21 related bone marrow (BM) or peripheral blood (PB), 50 unrelated BM, and 71 unrelated cord blood (UCB) transplantation were enrolled. Grade 3 or greater toxicities were observed in 105 patients. Neutrophil engraftment was achieved in 70 out of the 71 related PB/BM or unrelated BM recipients, and 61 out of the 71 UCB recipients. The cumulative incidence rates of relapse and non-relapse mortality after 2 years were 24.0 and 24.1%, respectively. The overall and event-free survival rates at 2 years were 53.3 and 47.4%, respectively. The myeloablative dose of ivBu was well tolerated without increased toxicity-related mortality in older adults who underwent allo-HSCT with any donor source.

Methylmercury (MeHg) is the causative substance of Minamata disease, which is associated with various neurological disorders such as sensory disturbance and ataxia. It has been suggested low-level dietary intake of MeHg from MeHg-containing fish during gestation adversely affects the fetus. In our study, we investigated the toxicological effects of MeHg exposure on neuronal differentiation focusing on epigenetics. We used human fetal brain-derived immortalized cells (LUHMES cells) as a human neuronal differentiation model. Cell viability, neuronal, and catecholamine markers in LUHMES cells were assessed after exposure to MeHg (0–1000 nM) for 6 days (from day 2 to day 8 of neuronal differentiation). Cell viability on day 8 was not affected by exposure to 1 nM MeHg for 6 days. mRNA levels of AADC, DBH, TUJ1, and SYN1 also were unaffected by MeHg exposure. In contrast, levels of TH, the rate-limiting enzyme for dopamine synthesis, were significantly decreased after MeHg exposure. Acetylated histone H3, acetylated histone H3 lysine 9, and tri-methyl histone H3 lysine 9 levels at the TH gene promoter were not altered by MeHg exposure. However, tri-methylation of histone H3 lysine 27 levels, related to transcriptional repression, were significantly increased at the TH gene promotor after MeHg exposure. In summary, MeHg exposure during neuronal differentiation led to epigenetic changes that repressed TH gene expression. This study provides useful insights into the toxicological mechanisms underlying the effects of developmental MeHg exposure during neuronal differentiation.

Background Dasatinib has shown promising anti-leukemic activity against chronic myeloid leukemia (CML). However, patients receiving dasatinib frequently require dose reductions and treatment interruptions (treatment alteration). Methods We prospectively analyzed the frequency and significance of treatment alteration during dasatinib therapy in patients with CML. In all patients, trough plasma concentrations of dasatinib (Cmin) at steady state were assessed on day 28 of therapy. Results 28% of patients had their doses reduced at a median of 42 days, and 25% of patients had temporarily interrupted at a median of 54 days after treatment initiation. The overall dasatinib treatment alteration-free rate at 1 year was 66%. Age was significantly correlated with Cmin on day 28 (p = 0.014), and the correlation remained significant after adjusting dasatinib dose (g), body weight (kg) (Cmin/D/W) (p = 0.026). In the univariate analysis, deep molecular response, advanced PS, higher Cmin/D/W were associated with a significantly higher risk of treatment alteration (HR 4.19, 95% CI: 1.06–16.60, p = 0.041; HR 5.26, 95% CI: 1.33–20.80, p = 0.018; and HR 10.15, 95% CI: 2.55–40.48, p = 0.001, respectively). In the multivariate analysis, advanced PS and higher Cmin/D/W were correlated with the incidence of treatment alteration (HR 4.78, 95% CI: 1.01–22.70, p = 0.049; HR 6.17, 95% CI: 1.17–32.50, respectively). Conclusion Current data demonstrate that patients treated with dasatinib who displayed a high Cmin/D/W value and/or advanced PS were at a high risk for altered treatment.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Osteopontin (OPN) is an extracellular glycosylated phosphoprotein that promotes cell adhesion by interacting with several integrin receptors. We previously reported that an OPN mutant lacking five O -glycosylation sites (Thr 134 /Thr 138 /Thr 143 /Thr 147 /Thr 152 ) in the threonine/proline-rich region increased cell adhesion activity and phosphorylation compared to the wild type. However, the role of O -glycosylation in cell adhesion activity and phosphorylation of OPN remains to be clarified. Here, we show that site-specific O -glycosylation in the threonine/proline-rich region of OPN affects its cell adhesion activity and phosphorylation independently and/or synergistically. Using site-directed mutagenesis, we found that OPN mutants with substitution sets of Thr 134 /Thr 138 or Thr 143 /Thr 147 /Thr 152 had decreased and increased cell adhesion activity, respectively. In contrast, the introduction of a single mutation into the O -glycosylation sites had no effect on OPN cell adhesion activity. An adhesion assay using function-blocking antibodies against αvβ3 and β1 integrins, as well as αvβ3 integrin-overexpressing A549 cells, revealed that site-specific O -glycosylation affected the association of OPN with the two integrins. Phosphorylation analyses using phos-tag and LC-MS/MS indicated that phosphorylation levels and sites were influenced by the O -glycosylation status, although the number of O -glycosylation sites was not correlated to the phosphorylation level in OPN. Furthermore, a correlation analysis between phosphorylation level and cell adhesion activity in OPN mutants with the site-specific O -glycosylation showed that they were not always correlated. These results provide conclusive evidence of a novel regulatory mechanism of cell adhesion activity and phosphorylation of OPN by site-specific O -glycosylation.

In contrast to a single human carboxylesterase 2 (CES2) isozyme (hCE2), three CES2 genes have been identified in cynomolgus monkeys: mfCES2A, mfCES2B, and mfCES2C. Although mfCES2A protein is expressed in several organs, mfCES2B is a pseudogene and the phenotype of the mfCES2C gene has not yet been clarified in tissues. In previous studies, we detected an unidentified esterase in the region of CES2 mobility upon nondenaturing PAGE analysis of monkey intestinal microsomes, which showed immunoreactivity for anti-mfCES2A antibody. The aim of the present study was to identify this unidentified esterase from monkey small intestine. The esterase was separated on nondenaturing PAGE gel and digested in-gel with trypsin. The amino acid sequences of fragmented peptides were analyzed by tandem mass spectrometry. The unidentified esterase was shown to be identical to mfCES2C (XP_015298642.1, predicted from the genome sequence data). mfCES2C consists of 559 amino acid residues and shows approximately 90% homology with mfCES2A (561 amino acid residues). In contrast to the ubiquitous expression of mfCES2A, mfCES2C is only expressed in the small intestine, kidney, and skin. The hydrolytic properties of recombinant mfCES2C, expressed in HEK293 cells, with respect to p-nitrophenyl derivatives, 4-methylumbelliferyl acetate, and irinotecan were similar to those of recombinant mfCES2A. However, mfCES2C showed a hydrolase activity for O-n-valeryl propranolol higher than mfCES2A. It is concluded that the previously unidentified monkey intestinal CES2 is mfCES2C, which shows different hydrolytic properties to mfCES2A, depending on the substrate. SIGNIFICANCE STATEMENT In the present research, we determined that mfCES2C, a novel monkey CES2 isozyme, is expressed in the small intestine and kidney of the cynomolgus monkey. Interestingly, mfCES2C showed a relatively wide substrate specificity for ester-containing compounds. These findings may, in early stages of drug development, support the use of in vitro–to–in vivo extrapolation for the intestinal hydrolysis of ester drugs in the cynomolgus monkey.

We present a patient with virus-associated hemorrhagic cystitis who underwent kidney and allogenic hematopoietic stem cell transplantations (allo-HSCT). Six months post-allo-HSCT, adenovirus hemorrhagic cystitis occurred, which has been in remission after a single dose of intravesical cidofovir. This might cause prolonged neutropenia and nephrotoxicity, suggesting cidofovir absorption in the blood.

Background Cyst infection is a common and serious complication of autosomal dominant polycystic kidney disease (ADPKD) that is often refractory. Carbapenems are frequently needed to treat to patients with refractory cyst infection, but little is known about the penetration of newer water-soluble carbapenems into cysts. This study investigated the penetration of meropenem (MEPM) into infected cysts in patients with ADPKD. Methods Between August 2013 and January 2014, 10 ADPKD patients (14 infected cysts) receiving MEPM at Toranomon Hospital underwent drainage of infected cysts and definite cyst infection was confirmed through detection of neutrophils by cyst fluid analysis. The serum concentration of MEPM was measured just after intravenous administration and was compared with that in fluid aspirated from infected cysts. Results In the patients undergoing cyst drainage, the mean serum MEPM concentration was 35.2 ± 12.2 μg/mL (range: 19.7 to 59.2 μg/mL, while the mean cyst fluid concentration of MEPM in the drained liver cysts (n = 12) or kidney cysts (n = 2) was 3.03 ± 2.6 μg/mL (range: 0 to 7.3 μg/mL). In addition, the mean cyst fluid/serum MEPM concentration ratio was 9.46 ± 7.19% (range: 0 to 18.8%). There was no relationship between the cyst fluid concentration of MEPM and the time until drainage after MEPM administration or between the cyst fluid/serum MEPM concentration ratio and the time until drainage. Conclusion These findings suggest that MEPM shows poor penetration into infected cysts in ADPKD patients. Trial registration This study was registered with the University Hospital Medical Information Network (UMIN) as “Penetration of meropenem into cysts in patients with autosomal dominant polycystic kidney disease (ADPKD)”, UMIN ID 000011292 on July 26th, 2013. Electronic supplementary material The online version of this article (10.1186/s12882-018-1067-2) contains supplementary material, which is available to authorized users.

Background The objective of the present retrospective study was to evaluate the effect of ponatinib administration as maintenance therapy on the outcomes after allogeneic hematopoietic stem cell transplantation in patients with Philadelphia chromosome-positive acute lymphoblastic leukemia. Patients and Methods We retrospectively analyzed the data from 34 consecutive patients treated at our institution from January 2008 to June 2019. We had administered post-transplant tyrosine kinase inhibitors preemptively before December 2017. Thereafter, we had initiated the prophylactic use of post-transplant ponatinib. The initial ponatinib dose was 15 mg/d. Ponatinib plasma trough levels were measured using the liquid chromatography-tandem mass spectrometry method 8 days after the first administration and subsequently. Results Nine patients received ponatinib maintenance. The 2-year overall survival and leukemia-free survival in the ponatinib maintenance group tended to be better than that in the non–ponatinib group (100% vs. 70.5%, P = .10; and 100% vs. 50.8%, P = .02, respectively). In the first 7 of the 9 consecutive patients, the median plasma concentration after ponatinib administration (15 mg/d) was 15.6 ng/mL (range, 4.8-23.3 ng/mL). Although the treatment schedule for 1 patient was altered because of adverse effects (elevation of serum amylase and neutropenia), ponatinib administration was continued for all the patients, except for 1 patient with molecular relapse. One patient developed a transient elevation of serum lipase. No patient presented with any arterial occlusive events. Conclusion Our results have indicated that the strategy of ponatinib maintenance after allogeneic hematopoietic stem cell transplantation is safe, efficacious, and promising.