Search

Tomato (Solanum lycopersicum L.) is one of the most important vegetables in the world. However, tomato is also susceptible to many viral diseases. Several tobamoviruses, including tomato mosaic virus (ToMV), tomato mottle mosaic virus (ToMMV), and tomato brown rugose fruit virus (ToBRFV), are highly contagious pathogens that could result in significant economic losses if not controlled effectively. Tobamoviruses have been managed relatively well with broad adaptation of tomato cultivars with resistance genes. However, emergence of ToBRFV was shown to break down resistance conferred by the common resistance genes, resulting in serious outbreaks in many countries in Asia, Europe, and North America. The objective of this study was to conduct a comparative analysis of biological properties, including host range and disease resistance of ToMV, ToMMV, and ToBRFV. Results showed that despite many similarities in the host range, there were some unique host plant responses for each of the three viruses. In a comparative evaluation of disease resistance using the same tomato cultivars with or without Tm-22 gene, there was a striking difference in responses from tomato plants with Tm-22 gene inoculated with ToBRFV, ToMV, or ToMMV. Whereas these test plants were resistant to ToMV or ToMMV infection, all test plants were susceptible to ToBRFV. Further, for ToBRFV detection, a sensitive and reliable multiplex real-time reverse transcription (RT)-PCR assay using TaqMan probe with an internal 18S rRNA control was also developed. With simple modifications to RNA extraction and seed soaking, real-time RT-PCR could consistently detect the virus in single infested seed in varied levels of contamination, suggesting its usefulness for seed health assay.

Background Tobamoviruses, including tomato brown rugose fruit virus (ToBRFV) on tomato and pepper, and cucumber green mottle mosaic virus (CGMMV) on cucumber and watermelon, have caused many disease outbreaks around the world in recent years. With seed-borne, mechanical transmission and resistant breaking traits, tobamoviruses pose serious threat to vegetable production worldwide. With the absence of a commercial resistant cultivar, growers are encouraged to take preventative measures to manage those highly contagious viral diseases. However, there is no information available on which disinfectants are effective to deactivate the virus infectivity on contaminated hands, tools and equipment for these emerging tobamoviruses. The purpose of this study was to evaluate a collection of 16 chemical disinfectants for their effectiveness against mechanical transmission of two emerging tobamoviruses, ToBRFV and CGMMV. Methods Bioassay was used to evaluate the efficacy of each disinfectant based on virus infectivity remaining in a prepared virus inoculum after three short exposure times (10 s, 30 s and 60 s) to the disinfectant and inoculated mechanically on three respective test plants (ToBRFV on tomato and CGMMV on watermelon). Percent infection of plants was measured through symptom observation on the test plants and the presence of the virus was confirmed through an enzyme-linked immunosorbent assay with appropriate antibodies. Statistical analysis was performed using one-way ANOVA based on data collected from three independent experiments. Results Through comparative analysis of percent infection of test plants, a similar trend of efficacy among 16 disinfectants was observed between the two pathosystems. Four common disinfectants with broad spectrum activities against two different tobamoviruses were identified. Those effective disinfectants with 90–100% efficacy against both tobamoviruses were 0.5% Lactoferrin, 2% Virocid, and 10% Clorox, plus 2% Virkon against CGMMV and 3% Virkon against ToBRFV. In addition, SP2700 generated a significant effect against CGMMV, but poorly against ToBRFV. Conclusion Identification of common disinfectants against ToBRFV and CGMMV, two emerging tobamoviruses in two different pathosystems suggest their potential broader effects against other tobamoviruses or even other viruses.

A Citrullus amarus mapping population segregating for resistance to Fusarium oxysporum f. sp. niveum race 2 and Papaya ringspot virus was used to identify novel QTL, important for the improvement in watermelon disease resistance. Multiple disease screens of the USDA Citrullus spp. germplasm collection have highlighted the value of Citrullus amarus (citron melon or wild watermelon) as a resource for enhancing modern watermelon cultivars (Citrullus lanatus) with resistance to a broad range of fungal, bacterial and viral diseases of watermelon. We have generated a genetic population of C. amarus segregating for resistance to two important watermelon diseases: Fusarium wilt (caused by the fungus Fusarium oxysporum f. sp. niveum; Fon race 2) and Papaya ringspot virus-watermelon strain (PRSV-W). QTL mapping of Fon race 2 resistance identified seven significant QTLs, with the major QTL representing a novel genetic source of resistance and an opportunity for gene pyramiding. A single QTL was associated with resistance to PRSV-W, which adhered to expectations of a prior study indicating a single-gene recessive inheritance in watermelon. The resistance loci identified here provide valuable genetic resources for introgression into cultivated watermelon for the improvement in disease resistance.

Genome sequences of a novel begomovirus infecting tomato on Guam were obtained using primer-walking and sequencing. The complete genome sequences are 2,750 nucleotides long with a typical monopartite organization and display less than 91% nucleotide sequence identity to other begomoviruses. A provisional name, tomato leaf curl Guam virus (ToLCGuV), is proposed.

Tomato (

Tomato chlorotic spot tospovirus is a species of the genus Orthotospovirus, family Tospoviridae. One of the causal agents of tomato spotted wilt, tomato chlorotic spot virus (TCSV) was first detected in tomato and bell pepper in south Florida in 2012 and is considered an emerging virus to the region. It has caused significant losses to tomato growers in the region since 2014. Field surveys were conducted in tomato fields in Miami-Dade County in the 2015–2016 and 2016–2017 growing seasons. Results of the surveys indicate that TCSV is the predominant virus among the three known orthotospoviruses [tomato spotted wilt virus (TSWV), groundnut ringspot virus (GRSV) and TCSV] present in south Florida. TCSV was detected in 43.8% of symptomatic samples collected in the 2016–2017 season. Mixed infection with two orthotospoviruses ranged from 2.8–6.3%, and 2.0% of the symptomatic samples were infected with all three viruses. The distribution pattern of TCSV-infected plants in a commercial tomato field in Homestead, FL suggested that the initial source of TCSV could be ornamental crops in adjacent nurseries. Up to 56.0% of the tomato plants with symptoms were observed in this field adjacent to ornamental nurseries, whereas the incidence gradually decreased to zero in the other side of the same field. Phylogenetic analysis using partial sequences of TCSV isolates revealed genetic diversity of 2.0% or less at the nucleotide level.

Cucumber green mottle mosaic virus (CGMMV), an emerging tobamovirus, has caused serious disease outbreaks to cucurbit crops in several countries, including the United States. Although CGMMV is seed-borne, the mechanism of its transmission from a contaminated seed to germinating seedling is still not fully understood, and the most suitable seed health assay method has not been well established. To evaluate the mechanism of seed transmissibility, using highly contaminated watermelon seeds collected from CGMMV-infected experimental plants, bioassays were conducted in a greenhouse through seedling grow-out and by mechanical inoculation. Through natural seedling grow-out, we did not observe seed transmission of CGMMV to germinating seedlings. However, efficient transmission of CGMMV was observed using bioassays on melon plants through mechanical inoculation of seed extract prepared from CGMMV-contaminated seeds. Understanding the seed-borne property and the ease of mechanical transmission of CGMMV from a contaminated seed to seedling is an important finding. In comparative evaluation of various laboratory techniques for seed health assays, we found that enzyme-linked immunosorbent assay and loop-mediated isothermal amplification were the most sensitive and reliable methods to detect CGMMV on cucurbit seeds. Because CGMMV is a seed-borne and highly contagious virus, a new infection might not result in a natural seedling grow-out; it could occur through mechanical transmission from contaminated seeds. Therefore, a sensitive seed health test is necessary to ensure CGMMV-free seed lots are used for planting.

[EN] The Cucurbitaceae family (cucurbit) includes several economically important crops, such as melon, cucumber, watermelon, pumpkin, squash and gourds. During the past several years, genomic and genetic data have been rapidly accumulated for cucurbits. To store, mine, analyze, integrate and disseminate these large-scale datasets and to provide a central portal for the cucurbit research and breeding community, we have developed the Cucurbit Genomics Database (CuGenDB; http://cucurbitgenomics.org) using the Tripal toolkit. The database currently contains all available genome and expressed sequence tag (EST) sequences, genetic maps, and transcriptome profiles for cucurbit species, as well as sequence annotations, biochemical pathways and comparative genomic analysis results such as synteny blocks and homologous gene pairs between different cucurbit species. A set of analysis and visualization tools and user-friendly query interfaces have been implemented in the database to facilitate the usage of these large-scale data by the community. In particular, two new tools have been developed in the database, a `SyntenyViewer¿ to view genome synteny between different cucurbit species and an `RNA-Seq¿ module to analyze and visualize gene expression profiles. Both tools have been packed as Tripal extension modules that can be adopted in other genomics databases developed using the Tripal system., USDA National Institute of Food and Agriculture Specialty Crop Research Initiative [2015-51181-24285]; US-Israel Binational Agricultural Research and Development Fund [IS-3333-02, IS-3877-06CR and IS-4223-09C]; USDA Agricultural Research Service, and by SNC Laboratoire ASL, de Ruiter Seeds B.V., Enza Zaden B.V., Gautier Semences S.A., Nunhems B.V., Rijk Zwaan B.V., Sakata Seed Inc, Semillas Fito S.A., Seminis Vegetable Seeds Inc, Syngenta Seeds B.V., Takii and Company Ltd, Vilmorin and Cie S.A. and Zeraim Gedera Ltd, all of them as part of the support to the International Cucurbit Genomics Initiative (ICuGI). Funding for open access charge: USDA National Institute of Food and Agriculture.

Sweet potato leaf curl virus (SPLCV) threatens global sweet potato production. SPLCV is transmitted by Bemisia tabaci or via infected vegetative planting materials, however, SPLCV was suggested to be seed transmissible, which is a characteristic that is disputed for geminiviruses. The objective of this study was to revisit the validity of seed transmission of SPLCV in sweet potato. Using large-scale grow-out of sweet potato seedlings from SPLCV-contaminated seeds over 4 consecutive years, approximately 23,034 sweet potato seedlings of 118 genotype entries were evaluated. All seedlings germinating in a greenhouse under insect-proof conditions or in a growth chamber were free of SPLCV, however, a few seedlings grown in an open bench greenhouse lacking insect exclusion tested positive for SPLCV. Inspection of these seedlings revealed that B. tabaci had infiltrated the greenhouse. Therefore, transmission experiments were conducted using B. tabaci MEAM1, demonstrating successful vector transmission of SPLCV to sweet potato. Additionally, tests on contaminated seed coats and germinating cotyledons demonstrated that SPLCV contaminated a high percentage of seed coats collected from infected maternal plants, but SPLCV was never detected in emerging cotyledons. Based on the results of grow-out experiments, seed coat and cotyledon tests, and vector transmission experiments, we conclude that SPLCV is not seed transmitted in sweet potato.

Cucumber green mottle mosaic virus (CGMMV) is a re-emerging threat to greenhouse cucumber and other Cucurbitaceae crop production worldwide. This seed-borne virus can easily spread from a contaminated seeds to seedlings and to adjacent plants through mechanical contact of the foliage of diseased and healthy plants causing extensive yield losses. Additionally, infection may not be limited to the current crop but may also affect subsequent crops due to the long-term persistence of the virus on contaminated crop residues, greenhouse hard surfaces and soil or soil-less greenhouse substrates. In the present work, three greenhouse experiments were conducted to develop an integrated pest management strategy towards controlling CGMMV in commercial cucumber greenhouses, by implementing an effective sanitization program and using resistant and grafted cucumber varieties. Results of sanitization highlighted that pressure washing and cleansing with an alkaline foam cleanser eliminated CGMMV on some of the most heavily infested areas. However, three successive applications of cleanser and disinfectants were essential to completely eliminate CGMMV on porous and uneven surfaces, such as cement alleyway, tray gutters and floor mats. The screening of 15 cucumber varieties revealed that one Mini (&lsquo, Khassib&rsquo, ) and three Long English (&lsquo, Sepire&rsquo, &lsquo, Bomber&rsquo, and &lsquo, LC13900&prime, ) had reduced or delayed CGMMV infection spread in the greenhouse but were intermediate in yield. The most resistant Mini variety was &lsquo, Katrina&rsquo, This variety showed low CGMMV infection level and high fruit yield. The varieties &lsquo, Jawell&rsquo, RZ 22-551&prime, Sunniwell&rsquo, Bonbon&rsquo, Dee Lite&rsquo, were the most tolerant to CGMMV. They showed a high CGMMV infection level without compromising yield. These results proved the need for new productive cucumber varieties with CGMMV resistance. Grafting experiments showed a yield increase only in the case of grafted &lsquo, Picowell&rsquo, over &lsquo, but no CGMMV resistance, which is a much more desirable result of grafting experiments in order to have economic potential. In all, the current study revealed unique methods of CGMMV management in commercial greenhouses that are recommended to growers for reducing crop losses and improving economic returns.

Cucumber green mottle mosaic virus (CGMMV) is a re-emerging threat to greenhouse cucumber and other Cucurbitaceae crop productions worldwide. This seed-borne virus can easily spread from a contaminated seed to seedlings and to adjacent plants through mechanical contact of the foliage of diseased and healthy plants causing extensive yield losses. Additionally, infection may not be limited to the current crop but may also affect subsequent crops due to the long-term persistence of the virus on contaminated crop residues, greenhouse hard surfaces and soil or soil-less greenhouse substrates. In the present work, three greenhouse trials were conducted to develop an integrated pest management strategy towards controlling CGMMV in commercial cucumber greenhouses, by implementing an effective sanitization program and using resistant and grafted cucumber varieties. Results of sanitization trial highlighted that pressure washing and cleansing with an alkaline foam cleanser has eliminated CGMMV on some of the most heavily infested areas. However, three successive applications of cleanser and disinfectants were essential to completely eliminate CGMMV on porous and uneven surfaces, such as cement alleyway, tray gutter and floor mats. The varietal trial revealed that out of 15 cucumber varieties evaluated, two Mini (‘Katrina’ and ‘Khassib’) and three Long English (‘Sepire’, ‘Bomber’ and ‘LC13900’) had reduced or delayed CGMMV infection spread in the greenhouse but were intermediate in yield. The varieties ‘Sunniwell’ and ‘Bonbon’ were the most tolerant to CGMMV. They showed a high CGMMV infection level without compromising yield. These results proved the need for new productive cucumber varieties with CGMMV resistance. Grafting experiment showed only yield increase in case of grafted ‘Picowell’ over ‘Bonbon’ and not marked CGMMV resistance, which is a much desirable result when the grafting experiments are evaluated for their economic potential. In all, the current experimental trials unfold unique methodologies on CGMMV management in commercial greenhouses that are recommended to the growers to be followed for reducing crop losses and get benefitted on revenue compromise.

Summary The whitefly (Bemisia tabaci), a notorious insect vector, transmits hundreds of viruses causing serious yield losses in a diverse food and fiber crops including beans, cassava, cotton, cucurbits, pepper, sweet potato and tomato, and results in billions of U.S. dollars of economic losses annually worldwide. To investigate the molecular mechanisms regulating gene expression in whitefly that is associated with begomovirus transmission, we conducted small RNA sequencing and compared the microRNA (miRNA) profiles between viruliferous whiteflies feeding on tomato plants infected with a begomovirus, tomato yellow leaf curl virus (TYLCV), and those whiteflies feeding on uninfected plants. We uncovered a comprehensive microRNA genetic regulatory system in whiteflies that may be involved in virus acquisition and transmission. Interestingly, correlating the expression profile of miRNAs and their target transcript expression in our earlier transcriptome study, we found miRNA expression was inversely correlated with predicted target gene expression in over 50% of all cases. This fundamental understanding will help identify new target sequences that could be used to improve RNA interference technology for whitefly control. These analyses could also serve as a model to study gene regulation in other systems involving arthropod transmission of viruses to plants and animals. Abstract The whitefly Bemisia tabaci (Gennadius) is a notorious insect vector that transmits hundreds of plant viruses, affecting food and fiber crops worldwide, and results in the equivalent of billions of U.S. dollars in crop loss annually. To gain a better understanding of the mechanism in virus transmission, we conducted deep sequencing of small RNAs on the whitefly B. tabaci MEAM1 (Middle East-Asia Minor 1) that fed on tomato plants infected with tomato yellow leaf curl virus (TYLCV). Overall, 160 miRNAs were identified, 66 of which were conserved and 94 were B. tabaci-specific. Among the B. tabaci-specific miRNAs, 67 were newly described in the present study. Two miRNAs, with predicted targets encoding a nuclear receptor (Bta05482) and a very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase 2 (Bta10702), respectively, were differentially expressed in whiteflies that fed on TYLCV-infected versus uninfected plants. To better understand the regulatory effects of identified miRNAs and their target genes, we correlated expression profiles of miRNAs and their target transcripts and found that, interestingly, miRNA expression was inversely correlated with the expression of ~50% of the predicted target genes. These analyses could serve as a model to study gene regulation in other systems involving arthropod transmission of viruses to plants and animals.

The complete genome sequence of a U.S. isolate of a Tomato brown rugose fruit virus (ToBRFV) (CA18-01) was obtained through Illumina and MinION sequencing. The U.S. ToBRFV isolate shared a high nucleic acid sequence identity (>99%) with known ToBRFV isolates. Phylogenetic analysis revealed a tight cluster for ToBRFV isolates throughout the world, suggesting a short evolutionary history.

Tomato (Solanum lycopersicum L.) is one of the most important vegetables in the world and Asian countries are the center for hybrid tomato seed production. Seed-borne diseases, if not managed well through effective seed health assay, could seriously hamper the global seed trade. Pepper chat fruit viroid (PCFVd) and Columnea latent viroid (CLVd) are two emerging and economically important pospiviroid species infecting tomato and other solanaceous crops. With their greater sequence diversity from those of other common tomato-infecting pospiviroids, it is necessary to develop a new detection method that could effectively detect PCFVd and CLVd, useful for seed health assay. In the present study, we developed a multiplex real time (quantitative) reverse transcription-polymerase chain reaction (qRT-PCR) to detect PCFVd and CLVd in a single tube, thus to save time and money. Using known viroid-contaminated seeds, this multiplex qRT-PCR could detect CLVd and PCFVd from a single contaminated seed, suggesting its sensitivity for seed health assay. The effectiveness of this newly developed multiplex qRT-PCR for detection of PCFVd and CLVd was validated using field-produced tomato plant tissue or commercial tomato seeds.

Summary Bottle gourd (Lagenaria siceraria) is an important vegetable crop as well as a rootstock for other cucurbit crops. In this study, we report a high-quality 313.4-Mb genome sequence of a bottle gourd inbred line, USVL1VR-Ls, with a scaffold N50 of 8.7 Mb and the longest of 19.0 Mb. About 98.3% of the assembled scaffolds are anchored to the 11 pseudomolecules. Our comparative genomic analysis identifies chromosome-level syntenic relationships between bottle gourd and other cucurbits, as well as lineage-specific gene family expansions in bottle gourd. We reconstruct the genome of the most recent common ancestor of Cucurbitaceae, which reveals that the ancestral Cucurbitaceae karyotypes consists of 12 protochromosomes with 18,534 protogenes. The 12 protochromosomes are largely retained in the modern melon genome, while have undergone different degrees of shuffling events in other investigated cucurbit genomes. The eleven bottle gourd chromosomes derive from the ancestral Cucurbitaceae karyotypes followed by 19 chromosomal fissions and 20 fusions. The bottle gourd genome sequence has facilitated the mapping of a dominant monogenic locus, Prs, conferring Papaya ringspot virus (PRSV) resistance in bottle gourd, to a 317.8-kb region on chromosome 1. We have developed a cleaved amplified polymorphic sequence (CAPS) marker tightly linked to the Prs locus and demonstrated its potential application in marker-assisted selection of PRSV resistance in bottle gourd. This study provides insights into the paleohistory of Cucurbitaceae genome evolution, and the high-quality genome sequence of bottle gourd provides a useful resource for plant comparative genomics studies and cucurbit improvement. This article is protected by copyright. All rights reserved.

Tomato planta macho viroid (TPMVd), including isolates previously designated as Mexican papita viroid (MPVd), causes serious disease on tomatoes in North America. Two predominant variants, sharing 93.8% sequence identity, incited distinct severe (MPVd-S) or mild (MPVd-M) symptoms on tomato. To identify virulence determinant factor, a series of chimeric infectious clones were generated using synthetic DNA approach to progressively replace each structural domain between the two variants. In bioassays on tomato 'Rutgers', three chimeras containing Terminal Left and Pathogenicity (MPVd-H1), Central (MPVd-H2), or Variable (MPVd-H3) of MPVd-S, incited mild to intermediate symptoms. However, a chimera containing Terminal Right (TR) of MPVd-S (MPVd-H4) incited severe symptoms. Only one base-pair mutation in the TR domain between MPVd-M (176U:A185) and MPVd-S (174G:C183) was identified. A reciprocal mutant (MPVd-H5) rendered the chimeric viroid mild on tomato. This single base-pair in the TR domain was determined as the virulence determinant factor for TPMVd.

Tomato spotted wilt tospovirus (TSWV), one of the most important plant viruses, causes yield losses to many crops including tomato. The current disease management for TSWV is based mainly on breeding tomato cultivars containing the Sw-5 locus. Unfortunately, several Sw-5 resistance-breaking strains of TSWV have been identified. Sw-7 is an alternative locus conferring resistance to a broad range of TSWV strains. In an effort to uncover gene networks that are associated with the Sw-7 resistance, we performed a comparative transcriptome profiling and gene expression analysis between a nearly-isogenic Sw-7 line and its susceptible recurrent parent (Fla. 8059) upon infection by TSWV. A total of 1,244 differentially expressed genes were identified throughout a disease progression process involving networks of host resistance genes, RNA silencing/antiviral defense genes, and crucial transcriptional and translational regulators. Notable induced genes in Sw-7 include those involved in callose accumulation, lignin deposition, proteolysis process, transcriptional activation/repression, and phosphorylation. Finally, we investigated potential involvement of PR-5 in the Sw-7 resistance. Interestingly, PR-5 overexpressed plants conferred enhanced resistance, resulting in delay in virus accumulation and symptom expression. These findings will facilitate breeding and genetic engineering efforts to incorporate this new source of resistance in tomato for protection against TSWV.

The whitefy Bemisia tabaci , a species complex consisting of many morphologically indistinguishable species divided into distinct clades, is one of the most globally important agricultural pests and plant virus vectors. Cassava-colonizing B. tabaci transmits viruses that cause cassava mosaic disease (CMD) and cassava brown streak disease (CBSD). Half of all cassava plants in Africa are affected by these viral diseases, resulting in annual production losses of more than US$ 1 billion. Here we report the draft genome of the cassava whitefly B. tabaci Sub-Saharan Africa - East and Central Africa (SSA-ECA), the super-abundant population that has been associated with the rapid spread of viruses causing the pandemics of CMD and CBSD. The SSA-ECA genome assembled from Illumina short reads has a total size of 513.7 Mb and a scaffold N50 length of 497 kb, and contains 15,084 predicted protein-coding genes. Phylogenetic analysis suggests that SSA-ECA diverged from MEAM1 around 5.26 million years ago. A comprehensive genetic analysis of cassava-colonizing B. tabaci in Africa was also conducted, in which a total of 243 whitefly specimens were collected from 18 countries representing all major cassava-growing regions in the continent and genotyped using NextRAD sequencing. Population genomic analyses confirmed the existence of six major populations linked by gene flow and inferred the distribution patterns of these populations across the African continent. The genome of SSA-ECA and the genetic findings provide valuable resources and guidance to facilitate whitefly research and the development of strategies to control cassava viral diseases spread by whiteflies.

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence ( Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Summary Years of selection for desirable fruit quality traits in dessert watermelon (Citrullus lanatus) has resulted in a narrow genetic base in modern cultivars. Development of novel genomic and genetic resources offers great potential to expand genetic diversity and improve important traits in watermelon. Here, we report a high‐quality genome sequence of watermelon cultivar ‘Charleston Gray’, a principal American dessert watermelon, to complement the existing reference genome from ‘97103’, an East Asian cultivar. Comparative analyses between genomes of ‘Charleston Gray’ and ‘97103’ revealed genomic variants that may underlie phenotypic differences between the two cultivars. We then genotyped 1365 watermelon plant introduction (PI) lines maintained at the U.S. National Plant Germplasm System using genotyping‐by‐sequencing (GBS). These PI lines were collected throughout the world and belong to three Citrullus species, C. lanatus, C. mucosospermus and C. amarus. Approximately 25 000 high‐quality single nucleotide polymorphisms (SNPs) were derived from the GBS data using the ‘Charleston Gray’ genome as the reference. Population genomic analyses using these SNPs discovered a close relationship between C. lanatus and C. mucosospermus and identified four major groups in these two species correlated to their geographic locations. Citrullus amarus was found to have a distinct genetic makeup compared to C. lanatus and C. mucosospermus. The SNPs also enabled identification of genomic regions associated with important fruit quality and disease resistance traits through genome‐wide association studies. The high‐quality ‘Charleston Gray’ genome and the genotyping data of this large collection of watermelon accessions provide valuable resources for facilitating watermelon research, breeding and improvement.

Bottle gourd (Lagenaria siceraria (Mol.) Standl.) is an important rootstock in watermelon production in several countries such as Japan, China, and Israel where 60 to 70% of watermelons are grafted (2). We are evaluating bottle gourds for their ability to improve disease resistance when used as rootstock for watermelon (3). In the summer of 2007, symptoms of wilting and crown necrosis appeared on bottle gourd seedlings 1 month after transplanting in a field in Charleston, SC. Infection was observed on commercial cv. Emphasis and four advanced breeding lines. In October of 2007, 35 of 85 plants examined (41%) had stem rot at the crown area just above the soil line where coarse, white mycelia and abundant sclerotia were observed. The fungus tentatively identified as Sclerotium rolfsii produced sclerotia that were white or light to dark brown and measured 0.6 to 2.5 mm in diameter (mean = 1.1 mm). Diseased tissues with sclerotia from four plants were disinfested for 1 min in 0.5% sodium hypochlorite and plated on acidified potato dextrose agar (APDA). Fungal colonies that produced white mycelia and tan-to-brown sclerotia were isolated from four wilted plants. A single PCR product of approximately 680 bp was amplified from DNA extracted from two isolates using the primers ITS1 and ITS4 (4). One PCR product was cloned into the TOPO TA cloning vector (Invitrogen, Carlsbad, CA) and sequenced (GenBank Accession No. EU338381). BLASTN analysis of the sequence in the NCBI databases revealed 99% similarity to the internal transcribed spacer (ITS) sequences of S. rolfsii and Athelia rolfsii (perfect stage of S. rolfsii), confirming that the pathogen was indeed S. rolfsii. Two S. rolfsii isolates were used to test pathogenicity. Each isolate was used to inoculate five young seedlings and five adult (10-week-old) bottle gourd plants. For inoculation, 10 sclerotia obtained from the APDA plates were placed on the surface of the potting soil 0.5 to 1 cm from the collar region of each bottle gourd plant growing in 10-cm pots. Inoculations were done carefully to ensure that the plants were not injured. After inoculation, the plants were maintained at high humidity and 25°C for 3 days and then transferred to laboratory benches. Four young seedlings and three adult noninoculated plants kept under the same conditions served as controls. The pathogenicity test was repeated once with similar results. All inoculated plants developed symptoms of southern blight. The inoculated plants developed symptoms of wilting 4 to 5 days after inoculation and completely wilted within 7 to 10 days. Symptoms of wilting were soon followed by the appearance of white-to-light brown sclerotia on the collar region. No symptoms were observed on the noninoculated plants. S. rolfsii was reisolated from the inoculated plants on APDA. Although southern blight caused by S. rolfsii has been reported on many crop plants in the southern United States, to our knowledge, this disease has not been reported previously on bottle gourd in North America. However, the disease has been reported on bottle gourd in India (1). Identifying sources of resistance to southern blight in bottle gourds may be necessary to make them suitable as rootstocks in areas where S. rolfsii is present. References: (1) K. S. Amin. Indian Phytopathol. 34:253, 1981. (2) R. Cohen et al. Plant Dis. 91:916, 2007. (3) K. S. Ling and A. Levi. HortScience 42:1124, 2007. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Amplifications. Academic Press, San Diego, 1990.

In just a few short years, pepino mosaic disease has quickly become endemic in greenhouse tomatoes around the world. Although three genotypes of Pepino mosaic virus (PepMV) were identified in the United States, genetic composition of PepMV in greenhouse tomato crops in North America has not been determined. In this study, genetic variability and population structure of PepMV were evaluated through nucleotide sequence comparison and phylogenetic analysis of two genomic regions (helicase domain and TGB2-3) derived from 91 cDNA clones that were derived from 31 field-collected samples. These samples were collected from several major greenhouse tomato facilities in five states in the United States and two provinces in Canada. All four major genotypes of PepMV (EU, US1, US2, and CH2) were found in North America. Three distinct genotypes (EU, US1, and US2) were found in mixed infection in samples collected from Arizona and Colorado, two genotypes (EU and CH2) in Texas, and a single genotype (EU) in Alabama and California and the provinces of British Columbia and Ontario in Canada. The complexity of population genetics of PepMV in the United States poses an additional challenge to the greenhouse tomato industry because a tomato cultivar with durable resistance to multiple genotypes of PepMV may be harder to develop.

In early 2008, tomato plants (Solanum lycopersicum) grown in a large greenhouse facility located near Mexico City exhibited general stunting, leaf chlorosis at the top of the diseased plant that later turned bronze or purple, and reduced-sized fruits. Initially, diseased plants were confined to a 5-ha greenhouse, but the disease quickly spread to two additional 5-ha greenhouses in the summer of 2008. By the end of 2008, approximately 5% of tomato plants in 35-ha of greenhouse were infected. Sixteen diseased samples were collected, twelve in 2008 and four in 2009. Bioassays through mechanical inoculation with leaf extracts of diseased samples demonstrated the transmissibility of the causal agent to plants of tomato cvs. Horizon or Rutgers, which expressed symptoms that were similar to those on the source plants. Serological or PCR assays were negative for several commonly occurring greenhouse tomato viruses. However, an expected size product (~196 bp) was consistently detected by reverse transcription (RT)-PCR using pospiviroid-specific primers Pospil-RE and Pospil-FW (4) in all symptomatic samples or from the mechanically inoculated tomato plants. Preliminary analysis with sequences obtained from direct sequencing of amplicons revealed one dominant sequence with 94% identity to Mexican papita viroid (MPVd) (GenBank Accessions Nos. L78454 and L78456–L78463). However, further analysis of the cloned cDNAs indicated a mixed infection of two pospiviroids in two samples. Of 10 cDNA clones analyzed, 9 were MPVd-like sequences and one was sequence of Tomato chlorotic dwarf viroid (TCDVd). Further analysis using full genomic sequences obtained by RT-PCR with previously designed primers (2) or a new set of primers (MTTVd-F: 5′ GGG GAA ACC TGG AGC GAA CTG G, and MTTVd-R: 5′ GGG GAT CCC TGA AGC GCT CCT) revealed genetic diversity in this population. Eight of thirteen cloned cDNAs represented by the 359-nt sequence of isolate Mex8 (GenBank Accession No. GQ131572) had 93 to 94% nucleotide sequence identity to other MPVd isolates (L78454 and L78456–L78463). Five other cDNA clones represented by the 361-nt sequence of isolate HM2 (GenBank Accession No. GQ131573) were 99% identical to a TCDVd isolate recently identified in Arizona (GenBank Accession No. FJ822878) and 96 to 97% identical to TCDVd isolates from other areas (GenBank Accession Nos. AF162131 and AB329668). These results are the first evidence of a mixed infection of two viroids infecting tomatoes in Mexico. MPVd was first identified in Mexico on papita (S. cardiophyllum) in 1996 (1). The origin of TCDVd in this greenhouse was not determined, but TCDVd potentially can be seed transmitted in tomato (3). The close relationship between the Mexican and the U.S. isolates suggests that TCDVd in these two countries may share a common origin, likely from seed. To our knowledge, this is the first report of a natural infection of MPVd and TCDVd on tomatoes in Mexico. References: (1) J. P. Martinez-Soriano et al. Proc. Natl. Acad. Sci. U.S.A. 93:9397, 1996. (2) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (3) R. P. Singh and A. D. Dilworth. Eur. J. Plant Pathol. 123:111, 2009. (4) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

Tomato chlorotic dwarf viroid (TCDVd), a member of the genus Pospivroid, family Pospiviroidae, was first identified on greenhouse tomato (Solanum lycopersicum) in Canada (2). Since then, it has also been reported elsewhere, e.g., on tomato in Colorado (4). During 2006 in Arizona, tomato plants in a large greenhouse facility with continuous tomato production exhibited viroid-like symptoms of plant stunting and chlorosis of the young leaves. Symptomatic plants were often located along the edge of the row, indicating the presence of a mechanical transmissible agent. Approximately 4% of the plants in this greenhouse were symptomatic in 2008. Symptoms were distinctly different from those caused by Pepino mosaic virus (PepMV), a virus that was generally present in this greenhouse and also in our test samples. Other commonly occurring tomato viruses were ruled out by serological, PCR, or reverse transcription (RT)-PCR tests in multiple laboratories. RT-PCR with two sets of universal pospiviroid primers, PospiI-FW/RE and Vid-FW/RE (4), yielded amplicons of the expected sizes of 196 and 360 bp in three samples collected from symptomatic plants. Direct sequencing of the amplicons revealed that the genome was 360 nt and 100% identical to the type TCDVd from Canada (GenBank Accession No. AF162131) (2). Mechanical inoculation with leaf tissue extract from four samples to plants of the tomato ‘Money-Maker’ resulted in the same viroid-like symptoms and TCDVd was confirmed in these plants by RT-PCR and sequencing. In both 2007 and 2008, 18 samples were tested using primers PSTVd-F and PSTVd-R (1), which are capable of amplifying the full TCDVd genome. Analysis of the sequences from the amplicons revealed two genotypes of TCDVd. The first genotype (GenBank Accession No. FJ822877) was identical to the type TCDVd and found in 11 samples from 2007 and one from 2008. The second genotype (GenBank Accession No. FJ822878) was 361 nt, differing from the first by nine nucleotide substitutions, 2 insertions, and 1 deletion. This second genotype was found in 7 and 17 samples from 2007 and 2008, respectively, and showed the highest sequence identity (97%) to a Japanese tomato isolate (AB329668) and a much lower sequence identity (92%) to a U.S. isolate previously identified in Colorado (AY372399) (4). The origin of TCDVd in this outbreak is not clear. The genotype identified first could have been introduced from a neighboring greenhouse where the disease was observed before 2006 and where this genotype also was identified in 2007. The second genotype may have been introduced from infected seed since TCDVd has recently been shown to be seed transmitted in tomato (3). To our knowledge, this is the first report of natural occurrence of TCDVd in Arizona. References: (1) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (2) R. P. Singh et al. J. Gen. Virol. 80:2823, 1999. (3) R. P. Singh and A. D. Dilworth. Eur. J. Plant Pathol. 123:111, 2009. (4) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

The United States Department of Agriculture–Agricultural Research Service sweetpotato (Ipomoea batatas) germplasm collection contains accessions that were initially collected from various countries worldwide. These materials have been maintained and distributed as in vitro plantlets since the mid-1980s. The status of viral infection by the emerging Sweet potato leaf curl virus (SPLCV) and other Begomovirus spp. in this germplasm has yet to be determined. In order to minimize the potential distribution of virus-infected clones, all accessions in the collection were tested for SPLCV using a real-time polymerase chain reaction assay. In total, 47 of 701 accessions of in vitro plantlets tested positive for SPLCV. The presence of SPLCV detected in these materials was confirmed via biological indexing using the indicator plants I. nil and I. muricata. Symptoms appeared more rapidly on I. muricata than on I. nil. Nucleotide polymorphisms among the isolates were evaluated by sequencing the AV1 coat protein gene from 24 SPLCV-infected accessions. The results revealed that the SPLCV isolates shared high sequence identity. Ten nucleotide substitutions were identified, most of which were synonymous changes. Phylogenetic analysis was conducted on those 24 SPLCV isolates in combination with six described SPLCV species and various SPLCV strains from GenBank to evaluate the relationships among viral species or strains. The results from this analysis indicated that most of the AV1 genes derived from previously classified SPLCV species clustered together, some of which formed well-supported monophyletic clades, further supporting the current taxonomy. Overall, identification of SPLCV-infected germplasm will allow approaches to be employed to eliminate the virus from the collection and limit the distribution of infected materials.

Pepino mosaic virus (PepMV) (genus Potexvirus) was first reported in Europe to be infecting greenhouse tomatoes (Solanum lycopersicum) in 2000 (3). Subsequently, it has also been identified in Canada and the United States (1) and has become widespread on greenhouse tomatoes in many countries. In early spring of 2010, symptoms including chlorotic mosaic or chlorotic patches on leaves, necrotic stems, and fruit deformation or marbling were noted. Approximately 50% of plants in a greenhouse in Jocotitlan, Mexico exhibited symptoms. Twenty-three symptomatic samples in four separate collections between April 2010 and January 2011 all tested positive for the presence of PepMV by ELISA and/or Agristrips (BioReba, Switzerland). Two symptomless samples were negative for PepMV. Biological inoculation with the isolate MX10-05 to three Nicotiana benthamiana and three tomato cv. Horizon plants all resulted in chlorotic mosaic symptoms on the systemic leaves and PepMV on the inoculated plants was confirmed by ELISA. To determine the genotype of PepMV in MX10-05, two primer sets targeting different part of the virus genome (separated by 2,744 nt) were selected for reverse transcription (RT)-PCR using total plant RNA extracted with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). A RT-PCR product (840 bp) was obtained using the first primer set (PepMV-Ch2.F541: 5′CATGGAACCAGCTGATGTGA and PepMV-Ch2.R1380: 5′TCTTTGTATATGGTCGCAGC) targeting the 5′ portion of the RNA-dependent RNA polymerase (RdRp) gene. The PCR product was cloned in pCR2.1 using the TOPO TA cloning system (Invitrogen, Carlsbad, CA) and a single clone was sequenced in both directions (Functional Biosciences, Madison, WI). After primer trimming, the 800-bp sequence (GenBank Accession No. JF811600) was shown in BLASTn to have its highest nucleotide sequence identity (99.4%) to the type PepMV-CH2 (DQ000985), 98% to other CH2/US2 isolates, 85% to US1, and 84% to EU. Another RT-PCR product (also 840 bp) was generated using the second primer set (PepMV-Ch2.F4081: 5′AAAAACGCTGTACCCAAAAC and PepMV-Ch2.R4920: 5′CAGAAATGTGTTCAGAGGGG) targeting the 3′ portion of RdRp and TGB1 genes. This second genome segment enables the differentiation of the CH2 and US2 genotypes. The resulting 800 bp (JF811600) had the highest nucleotide sequence identity (99.5%) to the type PepMV CH2, 97% to other CH2 isolates, 83% to US2, and only 81% to the EU genotype. Taken together, these sequence analyses support the identification of MX10-05 as a PepMV-CH2 isolate (2). However, the presence of other PepMV genotypes cannot be excluded once sequences from other isolates are obtained and analyzed. To our knowledge, this is the first report of PepMV on greenhouse tomatoes in Mexico. References: (1). C. J. French et al. Plant Dis. 85:1121, 2001. (2). K.-S. Ling. Virus Genes 34:1, 2007. (3). R. A. A. van der Vlugt et al. Plant Dis. 84:103, 2000.

In January 2011, tomato (Solanum lycopersicum) plants exhibiting stunting, yellow mosaic, short, chlorotic leaves, aborted flowers, and reduced-size fruits, symptoms similar to those exhibited by plants infected by ‘Candidatus Liberibacter solanacearum’ (2), were observed in approximately 5% of tomato plants in greenhouses in Jocotitlan in the State of Mexico, Mexico. Occasional plant recovery was also observed. Tomato plants in this facility were previously shown to be infected by Mexican papita viroid (MPVd), Pepino mosaic virus (PepMV), and aster yellows phytoplasma. Eight symptomatic leaf samples (designated MX11-01 to MX11-08) were collected and screened against selected tomato viruses and pospiviroids by reverse transcription (RT)-PCR using purified plant RNA or for ‘Ca. L. solanacearum’ by PCR using purified plant DNA. As expected, both PepMV and MPVd were detected in these samples. However, two ‘Ca. L. solanacearum’-specific PCR products (1,168 and 669 bp) were also amplified in two samples (MX11-02 and MX11-05) using primers OA2 (2) and OI2c (1) or CL514F/CL514R (3), respectively. Each ‘Ca. L. solanacearum’-specific PCR product was gel purified with Geneclean (Q-Biogene, Carlsbad, CA) and cloned into pCR2.1 using TOPO TA cloning kit (Invitrogen, Carlsbad, CA) and sequenced (Functional Biosciences, Madison, WI). Sequences of 16S rRNA (1,168 bp) in both isolates (GenBank Accession Nos. JF811596 and JF811597) were identical. However, the 669-bp 50S rRNA sequences in these two isolates (GenBank Accession Nos. JF811598 and JF811599) contained two single nucleotide polymorphism (SNP) mutations. BLASTn searches showed that both 16S rRNA and 50S gene sequences in MX11-05 were identical to the ‘Ca. L. solanacearum’ previously identified on potato in Chihuahua (GenBank Accession Nos. FJ829811 and FJ829812) and Saltillo (GenBank Accession Nos. FJ498806 or FJ498807) in eastern Mexico. These ‘Ca. L. solanacearum’ isolates were recently classified as the “b” haplotype (4). Alignment analysis of the ‘Ca. L. solanacearum' 16S rRNA sequences also revealed the conserved SNP mutations (g.212T > G and g.581T > C) in MX11-02 and MX11-05 as previously identified for other “b” haplotype isolates (4). ‘Ca. L. solanacearum’ was first identified in greenhouse tomatoes in 2008 in New Zealand (2). It has also been identified in greenhouse and field tomatoes in the United States. ‘Ca. L. solanacearum’ was previously reported to infect field tomatoes in Sinaloa, Mexico (3), which was recently considered as the “a” haplotype (4). To our knowledge, this is the first report of ‘Ca. L. solanacearum’ naturally infecting tomatoes in Jocotitlan in the State of Mexico, Mexico. The greenhouse tomato ‘Ca. L. solanacearum’ may be transmitted from infected solanaceous plants by potato psyllids (Bactericera cockerelli), which were observed in this facility. References: (1) S. Jagoueix et al. Int. J. Syst. Bacteriol. 44:379, 1994. (2) L. W. Liefting et al. Plant Dis. 93:208, 2009. (3) J. E. Munyaneza et al. Plant Dis. 93:1076, 2009 (4) W. R. Nelson et al. Eur. J. Plant Pathol. 130:5, 2011.

In early 2013, greenhouse cucumber growers in Alberta, Canada, observed virus-like disease symptoms on mini-cucumber (Cucumis sativus) crops (e.g., ‘Picowell’). Two types of symptoms were commonly observed, green mottle mosaic and necrotic spots. In the early infection, young leaves of infected cucumber plants displayed light green mottle and blisters. The infected plants were stunted in growth, with darker green blisters and green mottle mosaic symptoms on mature leaves. Disease incidence varied from one greenhouse to another. In some severe cases, diseased plants were widely distributed inside the greenhouse, resulting in 10 to 15% yield losses based on grower's estimation. Nine symptomatic samples were collected and subjected to total RNA isolation using the TRIzol reagent (Invitrogen, Carlsbad, CA). Laboratory analyses were conducted using real-time RT-PCR systems for Cucumber green mottle mosaic virus (CGMMV) (1), Melon necrotic spot virus (MNSV, Ling, unpublished), and Squash mosaic virus (SqMV) (3). All nine samples were positive for CGMMV and seven of them were in mixed infections with MNSV. Two samples were selected for validation for the presence of CGMMV using conventional RT-PCR (2) with a new primer set (CGMMVMP F1: 5′-ATGTCTCTAAGTAAGGTGTC-3′ and CGMMV3′UTR R1: 5′-TGGGCCCCTACCCGGGG-3′) and two previous online published primer sets, one for CGMMV MP (5′ TAAGTTTGCTAGGTGTGATC-3′, GenBank Accession No. AJ250104 and 5′ ACATAGATGTCTCTAAGTAAG-3′, AJ250105), and another for CGMMV CP (5′ ACCCTCGAAACTAAGCTTTC-3′, AJ243351 and 5′ GAAGAGTCCAGTTCTGTTTC-3′, AJ243352). The expected sizes of RT-PCR products were obtained and sequenced directly. Sequences from these three products overlapped and generated a 1,282-bp contig (KF683202). BLASTn analysis to the NCBI database showed 99% sequence identity to CGMMV isolates identified in Asia, including China (GQ277655, KC852074), India (DQ767631), Korea (AF417243), Myanmar (AB510355), and Taiwan (HQ692886), but only 92% sequence identity to other CGMMV isolates identified in Europe, including Spain (GQ411361) and Russia (GQ495274), and 95% to CGMMV isolate from Israel (KF155231). The strong sequence identity to the CGMMV Asian isolates suggests that the Canadian CGMMV isolate identified in Alberta was likely of Asian origin. In two bioassay experiments using one sample prepared in 0.01 M phosphate buffer, the similar green mottle mosaic symptoms were observed on systemic leaves in the mechanically inoculated plants and the presence of CGMMV, but not MNSV, was confirmed through real-time RT-PCR on four different cucurbits, including three Cucumis sativus cultivars (six plants in ‘Marketer,’ five plants in ‘Poinsett 76,’ six plants in ‘Straight 8’), seven plants of C. melo ‘Athena,’ six plants of C. metulifer (PI201681), and two plants of Citrullus lanatus ‘Charleston Gray.’ To our knowledge, CGMMV has only been reported in Asia, Europe, and the Middle East, and this is the first report of CGMMV in the American continents. CGMMV is highly contagious and is seed borne on cucurbits. With the increasing trend in growing grafted watermelon and other cucurbits in the United States and elsewhere, it is even more important now that a vigilant seed health test program for CGMMV should be implemented. References: (1) H. Chen et al. J. Virol. Methods 149:326, 2008. (2) K.-S. Ling et al. Plant Dis. 92:1683, 2008. (3) K.-S. Ling et al. J. Phytopathol. 159:649, 2011.

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5′-CTCGGTTTTCTGCTTTTC-3′ and JAP886, 5′CGGACAGGCTGGAGAAATCG3′) (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5′-CGTATCTGAGGATGTTGAGT-3′ and JAP888, 5′-GCTAACTCCTTGTTCTTTTG-3′). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5′-AGTATTATGCATCTATAGATTAGCACA-3′ and TCSV-R1, 5′-ACAAATCATCACATTGCCAGGA-′) were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.

Squash mosaic virus (SqMV), a seedborne virus, belongs to the genus Comovirus in the subfamily Comovirinae of the family Secoviridae. SqMV has a bipartite single-stranded RNA genome (RNA1 and RNA2) encapsidated separately with two capsid proteins. With the recent identification of a third genotype in SqMV, a greater genetic diversity with only 88 to 89% sequence identity among them are recognized. With the existence of genetic diversity, a previously developed quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) failed to detect isolates in this new genotype. Therefore, it was necessary to create a new qRT-PCR that would react with all SqMV isolates in three different genotypes. From a multiple sequence alignment of the available SqMV sequences in GenBank, a conserved sequence segment in the 3′ untranslated region of RNA2 was identified for primer and probe design. A new qRT-PCR was developed, which provided broad-spectrum reactions to SqMV isolates, including those from the newly recognized third genotype. To improve the reliability in determining the sample quality and result interpretation, an internal amplification control with an endogenous gene sequence (18S ribosomal RNA) was successfully incorporated to develop a duplex qRT-PCR system that was useful for seed health test.