Search

Abstract The rise of Large Language Models (LLMs) like ChatGPT marks a pivotal advancement in artificial intelligence, reshaping the landscape of data analysis and processing. By simulating public opinion, ChatGPT shows promise in facilitating public policy development. However, challenges persist regarding its worldwide applicability and bias across demographics and themes. Our research employs socio-demographic data from the World Values Survey to evaluate ChatGPT’s performance in diverse contexts. Findings indicate significant performance disparities, especially when comparing countries. Models perform better in Western, English-speaking, and developed nations, notably the United States, in comparison to others. Disparities also manifest across demographic groups, showing biases related to gender, ethnicity, age, education, and social class. The study further uncovers thematic biases in political and environmental simulations. These results highlight the need to enhance LLMs’ representativeness and address biases, ensuring their equitable and effective integration into public opinion research alongside conventional methodologies.

Abstract To improve the thermal health state of workers in mines facing heat hazards and enhance cooling capacity utilization efficiency of mine ventilation, this study proposes a suitable air distribution for mine workers’ local cooling, taking into account the characteristics of long-narrow underground space and workers. The suggested air distribution involves harnessing underground cold air jets along with the mine’s crossflow (mainstream ventilation) to create a localized safeguard airflow around the worker’s head-neck, known as jet ventilation in crossflow (JVIC). The flow visualization experiment identified five flow patterns within a confined space. The study explores the impact of the velocity ratio (R) and confinement scale (C) on the evolution of JVIC flow patterns and presents a parametric description of the resulting flow field. Drawing on the microclimate control scope around mine workers’ head-neck, the study defines the effective cooling zone and the ineffective cooling zone as the boundaries for controlling JVIC air distribution within confined mine spaces. This clarifies the applicability of the air distribution form and introduces an evaluation model for assessing the cooling effect and the efficiency of cooling capacity utilization to manage the non-uniform underground environment.

Abstract In plants, the conserved plant-specific photoreceptor UV RESISTANCE LOCUS 8 (UVR8) perceives ultraviolet-B (UV-B) light and mediates UV-B-induced photomorphogenesis and stress acclimation. In this study, we reveal that UV-B light treatment shortens seedlings, increases stem thickness, and enhances UV-B stress tolerance in rice (Oryza sativa) via its two UV-B photoreceptors OsUVR8a and OsUVR8b. Although the rice and Arabidopsis (Arabidopsis thaliana) UVR8 (AtUVR8) photoreceptors all form monomers in response to UV-B light, OsUVR8a, and OsUVR8b function is only partially conserved with respect to AtUVR8 in UV-B-induced photomorphogenesis and stress acclimation. UV-B light and CONSTITUTIVELY PHOTOMORPHOGENIC 1 (COP1) promote the nuclear accumulation of AtUVR8; by contrast, OsUVR8a and OsUVR8b constitutively localize to the nucleus via their own nuclear localization signals, independently of UV-B light and the RING-finger mutation of OsCOP1. We show that OsCOP1 negatively regulates UV-B responses, and shows weak interaction with OsUVR8s, which is ascribed to the N terminus of OsCOP1, which is conserved in several monocots. Furthermore, transcriptome analysis demonstrates that UV-B-responsive gene expression differs globally between Arabidopsis and rice, illuminating the evolutionary divergence of UV-B light signaling pathways between monocot and dicot plants.

Abstract The use of college entrance exams for facilitating admission decisions become controversial, and the central argument is around the fairness of test scores. The Kuwait University English Aptitude Test (KUEAT) is a high-stakes test, but very few studies have examined the psychometric quality of the scores for this national-level assessment. This study illustrates how measurement approaches can be used to examine the fairness issues in educational testing. Through a modern view of fairness, we assess the internal and external bias of KUEAT scores using differential item functioning analysis and differential prediction analysis, respectively, and provide a comprehensive fairness argument for KUEAT scores. The analysis for examining the internal evidence of bias was based on 1790 examinees’ KUEAT scores in November 2018. KUEAT scores and first-year college GPAs of 4033 students enrolled in KU were used for assessing the external evidence of bias. Results revealed many items showing differential item functioning across student subpopulation groups (i.e., nationality, gender, high school majors, and high school types). Meanwhile, KUEAT scores also predicted college performance differentially by different student subgroups (i.e., nationality, high school majors, and high school types). Discussion and implications on the fairness issues of college entrance tests in Kuwait are provided.

Abstract Background Pure red cell aplasia (PRCA) in neuromyelitis optica spectrum disorder (NMOSD) has not been reported before. This study presents a patient with NMOSD who developed PRCA. Case presentation A 54-year-old female was admitted in January 2023 for dysuria and progressive numbness and weakness of lower limbs. She had difficulty standing and walking in a straight line. Both lower limbs were positive for the Babinski and Chaddock signs. MRI showed abnormal signals in the spinal cord. Aquaporin-4-IgG (AQP-4-IgG) was positive (1:320), and NMOSD was confirmed. Intravenous immunoglobulin and methylprednisolone were given, and the symptoms improved. She received maintenance treatment with methylprednisolone tablets, and the dosage was gradually reduced. She was readmitted for fatigue, palpitations, and shortness of breath in May 2023. Bone marrow aspiration and biopsy showed elevated erythroid precursors and erythroid hypoplasia, with normal megakaryocytes and myeloid precursors. Chest CT showed no mediastinal lymph node enlargement or thymoma. PRCA secondary to NMOSD was diagnosed. Recombinant human erythropoietin was given. Her condition improved after 1.5 months, as indicated by blood cell count and imaging. Conclusions This case suggests that PRCA can be secondary to NMOSD. A comprehensive immune function and bone marrow evaluation might be necessary if abnormal blood cells are found while managing NMOSD.

Abstract Currently, deep learning methods for low‐light image enhancement tasks mainly focus on the illumination of images, while neglecting the problems of image noise and feature loss. To address this issue, this paper proposes a novel low‐light image enhancement network called DAF‐Retinex, based on the Retinex‐Net. To address the issue of image noise, different from traditional image denoise methods, this paper utilizes a fully convolutional neural network to denoise the reflection component, additionally, a denoising loss function is introduced to suppress noise. For preserving image details and extracting features, this paper creatively introduces self‐calibrated convolutions into low‐light image enhancement tasks, furthermore, a feature augmented attention block consisting of feature‐guided attention (FGA) is designed for feature learning to effectively enhance image illumination and extract image detail features. Experimental results demonstrate that the proposed algorithm in this paper effectively removes image noise and extracts detailed features, resulting in visually improved outcomes. On public datasets, the average improvement in objective evaluation metrics of image quality such as PSNR, SSIM, and NIQE are 1.13%, 4.12%, and 1.28%, respectively.

Abstract Background Exposure to different concentration levels of fatty acids (FAs) may have an impact on depression. However, previous studies using individual FAs may not reflect the performance of mixtures of various FAs, and the associations of FA patterns with depression remain unclear. Methods We conducted the cross-sectional analysis in 792 adults aged 18 and older with available serum FAs and depression screening data in the National Health and Nutrition Examination Survey (NHANES) 2011–2012. The serum concentrations of thirty FAs were measured using gas chromatography-mass spectrometry and their percentage compositions were subsequently calculated. Depression was defined as the Patient Health Questionnaire-9 score ≥ 10. We employed principal component analysis to derive serum FA patterns. We examined the association between these patterns and depression in the overall population and various subgroups through survey-weighted logistic regression. Results Four distinct patterns of serum FAs were identified: ‘high eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA); low docosatetraenoic acid (DTA) and docosapentaenoic acid (DPA) n-6’, ‘high long-chain saturated FA and long chain FA’, ‘low median-chain saturated FA and myristoleic acid’ and ‘low capric acid and lauric acid; high gamma-linolenic acid (GLA) and stearidonic acid (SDA)’ pattern. Individuals in the high tertile of ‘high EPA and DHA; low DTA and DPA n-6’ pattern score had 0.46 (95% CI: 0.22, 0.93) lower odds of developing depression compared to individuals in the lowest tertile after adjusting for confounders such as age, sex, physical activity and total energy intake, etc. The odds ratio (OR) of depression was increased in the population with the highest tertile of ‘low capric acid and lauric acid; high GLA and SDA’ pattern (OR: 2.45, 95% CI: 1.24, 4.83). In subgroup analyses, we observed that the association between ‘high EPA and DHA; low DTA and DPA n-6’ and depression persisted among specific demographic and lifestyle subgroups, including females, non-Mexican Americans, non-obese, those aged over 60 years, smokers and drinkers. Similarly, ‘low capric acid and lauric acid; high GLA and SDA’ showed stable associations in female, non-Mexican Americans and smokers. Conclusions Serum FA patterns are associated with depression, and their relationships vary across sex, race, BMI, age, smoking and drinking subgroups, highlighting the importance of considering specific FA patterns within these demographic and lifestyle categories. Utilization of combined FA administration may serve as a mitigation measure against depression in these specific populations.

Contrary to the phenomena predicted by advertising research relevant to the elaboration likelihood model, content ads emphasizing non-message elements possess the potential to attract consumers with high elaboration likelihood. This research aims to address the following two questions: (1) why do such consumers develop favorable attitudes toward content ads depicting non-message elements? and (2) do their attitudes toward content ads result in product consumption? In proposing the hypotheses, the current research introduces the novel concept of content reproducibility, defined as the degree to which an ad authentically reflects the original product content. Studies 1 and 2 demonstrate that when the elaboration likelihood is high, consumers form more favorable attitudes toward ads with content reproducibility than toward those without it. This is because elements reproducing content (e.g., characters, storylines, settings, colors, and music) in an ad can serve as arguments. Study 2 indicates that when the elaboration likelihood is high, content reproducibility positively influences purchasing intentions. Our findings theoretically contribute to the literature on the elaboration likelihood model, the content business, and the marketing mix. Additionally, this research offers managerial insights to assist marketers in enhancing ad attitudes and purchasing intentions.

Abstract Cervical cancer is a significant global health issue, its prevalence and prognosis highlighting the importance of early screening for effective prevention. This research aimed to create and validate an artificial intelligence cervical cancer screening (AICCS) system for grading cervical cytology. The AICCS system was trained and validated using various datasets, including retrospective, prospective, and randomized observational trial data, involving a total of 16,056 participants. It utilized two artificial intelligence (AI) models: one for detecting cells at the patch-level and another for classifying whole-slide image (WSIs). The AICCS consistently showed high accuracy in predicting cytology grades across different datasets. In the prospective assessment, it achieved an area under curve (AUC) of 0.947, a sensitivity of 0.946, a specificity of 0.890, and an accuracy of 0.892. Remarkably, the randomized observational trial revealed that the AICCS-assisted cytopathologists had a significantly higher AUC, specificity, and accuracy than cytopathologists alone, with a notable 13.3% enhancement in sensitivity. Thus, AICCS holds promise as an additional tool for accurate and efficient cervical cancer screening.

Abstract Black rot, caused by Xanthomonas campestris pv. campestris (Xcc) significantly affects the production of cabbage and other cruciferous vegetables. Plant antioxidant system plays an important role in pathogen invasion and is one of the main mechanisms underlying resistance to biological stress. Therefore, it is important to study the resistance mechanisms of the cabbage antioxidant system during the early stages of Xcc. In this study, 108 CFU/mL (OD600 = 0.1) Xcc race1 was inoculated on “zhonggan 11” cabbage using the spraying method. The effects of Xcc infection on the antioxidant system before and after Xcc inoculation (0, 1, 3, and 5 d) were studied by physiological indexes determination, transcriptome and metabolome analyses. We concluded that early Xcc infection can destroy the balance of the active oxygen metabolism system, increase the generation of free radicals, and decrease the scavenging ability, leading to membrane lipid peroxidation, resulting in the destruction of the biofilm system and metabolic disorders. In response to Xcc infection, cabbage clears a series of reactive oxygen species (ROS) produced during Xcc infection via various antioxidant pathways. The activities of antioxidant enzymes such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) increased after Xcc infection, and the ROS scavenging rate increased. The biosynthesis of non-obligate antioxidants, such as ascorbic acid (AsA) and glutathione (GSH), is also enhanced after Xcc infection. Moreover, the alkaloid and vitamin contents increased significantly after Xcc infection. We concluded that cabbage could resist Xcc invasion by maintaining the stability of the cell membrane system and improving the biosynthesis of antioxidant substances and enzymes after infection by Xcc. Our results provide theoretical basis and data support for subsequent research on the cruciferous vegetables resistance mechanism and breeding to Xcc.

Abstract CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P

Abstract Evidence suggests associations between COVID-19 patients or vaccines and glycometabolic dysfunction and an even higher risk of the occurrence of diabetes. Herein, we retrospectively analyzed pancreatic lesions in autopsy tissues from 67 SARS-CoV-2 infected non-human primates (NHPs) models and 121 vaccinated and infected NHPs from 2020 to 2023 and COVID-19 patients. Multi-label immunofluorescence revealed direct infection of both exocrine and endocrine pancreatic cells by the virus in NHPs and humans. Minor and limited phenotypic and histopathological changes were observed in adult models. Systemic proteomics and metabolomics results indicated metabolic disorders, mainly enriched in insulin resistance pathways, in infected adult NHPs, along with elevated fasting C-peptide and C-peptide/glucose ratio levels. Furthermore, in elder COVID-19 NHPs, SARS-CoV-2 infection causes loss of beta (β) cells and lower expressed-insulin in situ characterized by islet amyloidosis and necrosis, activation of α-SMA and aggravated fibrosis consisting of lower collagen in serum, an increase of pancreatic inflammation and stress markers, ICAM-1 and G3BP1, along with more severe glycometabolic dysfunction. In contrast, vaccination maintained glucose homeostasis by activating insulin receptor α and insulin receptor β. Overall, the cumulative risk of diabetes post-COVID-19 is closely tied to age, suggesting more attention should be paid to blood sugar management in elderly COVID-19 patients.

Abstract The increasing depth of mine excavation presents greater challenges in mine ventilation and in managing cooling energy consumption. Therefore, there is an urgent need for comprehensive research on jet ventilation influenced by low-speed crossflows. This study investigated the impact of flow velocity ratios (R) and jet exit diameters (d) on flow-field distribution and flow characteristics through velocity measurements and smoke flow visualization experiments. The results of the study revealed two distinct types of air lakes formed by jet ventilation in crossflow (JVIC), with one being wall-attached and the other suspended. Notably, a significant secondary flow phenomenon was observed in the near-field near the upper wall. Additionally, the deflection angle (θ j) of JVIC decreases as R and d/D increase, leading to the formation and movement of a semi-confined point (SP) and a confined point (CP) in the -x direction. Moreover, the wall confinement effect diminishes the jet’s diffusion and deflection ability in the -z direction, leading to increased penetration in the x direction. Before the formation of the SP, the deflection section of the jet lengthens, followed by a rapid shortening upon its formation. Finally, the study further developed empirical equations for the jet axial trajectory and diffusion width.

Objective: This study extracts atherosclerosis indices from six channels of Cunkou and discusses the data distribution, aims to explore the connection between cardiology of modern medicine (MM) and traditional Chinese medicine (TCM) pulse diagnosis. Methods: We use a device capable of simultaneously collecting the pulse signals of the Cun, Guan and Chi to test the population participating in routine physical examinations. Firstly, we collected pressure pulse waves from six channels of Cunkou of 1045 healthy subjects (578 men and 467 women, average age=37.99±16.02 years). Secondly, we extracted the two most common arteriosclerosis indices pulse transit time (PTT) and Augmentation index (AIx) from six-channel pulse waves. Lastly, T-test and correlation test were taken to analyze the differences and relevance of the atherosclerosis indices extracted from six channels of Cunkou. Results: When analyzing AIx and PTT at different wrist, it was found that AIx of left wrist is significantly higher than that of right wrist (P0.05). In addition, regardless of gender, when the specific channel is not considered, AIx and PTT of each wrist are significantly correlated with age (P

Introduction Sentinel lymph node biopsy (SLNB) is a standard procedure for patients with clinically assessed negative axillary lymph nodes (cN0) during early-stage breast cancer (EBC). However, the majority of EBC patients have a negative pathological confirmation of the sentinel lymph node (SLN), and axillary surgery is inevitably associated with postoperative complications. Considering that SLNB has no therapeutic benefit, this trial aims to determine the safety of omitting SLNB in patients with cN0 early invasive breast cancer.Methods and analysis The OMSLNB trial is a prospective, single-arm, non-inferiority, phase II, open-label study design involving female breast cancer patients with a tumor of ≤3 cm in diameter, who are considered axillary lymph-node-negative based on two or more radiological examinations, including axillary lymph node ultrasonography. Eligible patients will avoid axillary surgery but will undergo breast surgery, which is not limited to breast-conserving surgery. The trial begins in 2023 and is scheduled to end in 2027. The primary endpoint is 3 year invasive disease-free survival (iDFS). The secondary endpoints include the incidence of breast cancer-related lymphoedema, patient-reported outcomes, locoregional recurrence, local recurrence and regional recurrence. It is expected that the 3 year iDFS in patients undergoing SLNB is about 90%, combined with a non-inferiority cut-off of 5%, 80% power, 95% CIs, 0.05 test level, and 10% loss to follow-up rate, the planned enrollment is 311 patients. All enrolled patients will be included in the intention-to-treat analysis.Ethics and dissemination This trial was approved by the Ethics Committee of the First Affiliated Hospital of Nanjing Medical University (No.2023-SR-193). All participants must provide written informed consent to be eligible. The protocol will be described in a peer-reviewed manuscript, and the results will be published in scientific journals and/or at academic conferences.Trial registration number NCT05935150.

Abstract Macrophages are versatile immune cells with remarkable plasticity, enabling them to adapt to diverse tissue microenvironments and perform various functions. Traditionally categorized into classically activated (M1) and alternatively activated (M2) phenotypes, recent advances have revealed a spectrum of macrophage activation states that extend beyond this dichotomy. The complex interplay of signaling pathways, transcriptional regulators, and epigenetic modifications orchestrates macrophage polarization, allowing them to respond to various stimuli dynamically. Here, we provide a comprehensive overview of the signaling cascades governing macrophage plasticity, focusing on the roles of Toll‐like receptors, signal transducer and activator of transcription proteins, nuclear receptors, and microRNAs. We also discuss the emerging concepts of macrophage metabolic reprogramming and trained immunity, contributing to their functional adaptability. Macrophage plasticity plays a pivotal role in tissue repair and regeneration, with macrophages coordinating inflammation, angiogenesis, and matrix remodeling to restore tissue homeostasis. By harnessing the potential of macrophage plasticity, novel therapeutic strategies targeting macrophage polarization could be developed for various diseases, including chronic wounds, fibrotic disorders, and inflammatory conditions. Ultimately, a deeper understanding of the molecular mechanisms underpinning macrophage plasticity will pave the way for innovative regenerative medicine and tissue engineering approaches.

Background and purpose: Parkinson's disease (PD) causes a decline in motor function, cognitive decline, and impacts the mental health of patients. Due to the high cost and side effects of conventional treatments, the medical community has begun to explore safer and more cost-effective alternative therapies. In this context, arts therapies have gained increasing attention as innovative treatments. This review plans to explore the role and potential of various arts therapies in the rehabilitation of PD patients by analyzing existing literature and case studies. Methods: This review comprehensively searched the literature in several databases, including PubMed, Embase, Cochrane Library, Web of Science, and China National Knowledge Infrastructure, to assess the effectiveness of different arts therapies in the rehabilitation of patients with PD. Results: From 3440 articles screened, 16 met the inclusion criteria. These studies included a variety of therapies, including music, meditation, yoga, art, dance, theatre, video games and play therapy. These different types of arts therapies had a positive impact on the motor, psychological and cognitive rehabilitation of PD patients, respectively. Conclusion: The existing literature highlights the great potential of arts therapies in the rehabilitation of people with PD, further confirming the efficacy of arts therapies in enhancing the motor, psychological and cognitive rehabilitation process of people with PD. In addition, this review identifies research gaps in the use of color therapy in PD rehabilitation and highlights the need for further exploration of various arts therapies modalities.

Bone defect disease seriously endangers human health and affects beauty and function. In the past five years, the three dimension (3D) printed radially graded triply periodic minimal surface (TPMS) porous scaffold has become a new solution for repairing bone defects. This review discusses 3D printing technologies and applications for TPMS scaffolds. To this end, the microstructural effects of 3D printed TPMS scaffolds on bone regeneration were reviewed and the structural characteristics of TPMS, which can promote bone regeneration, were introduced. Finally, the challenges and prospects of using TPMS scaffolds to treat bone defects were presented. This review is expected to stimulate the interest of bone tissue engineers in radially graded TPMS scaffolds and provide a reliable solution for the clinical treatment of personalised bone defects.

One of the major challenges arising in internet of military things (IoMT) is accommodating massive connectivity while providing guaranteed quality of service (QoS) in terms of ultra-high reliability. In this regard, this paper presents a class of code-domain nonorthogonal multiple accesses (NOMAs) for uplink ultra reliable networking of massive IoMT based on tactical datalink such as Link-16 and joint tactical information distribution system (JTIDS). In the considered scenario, a satellite equipped with Nr antennas servers K devices including vehicles, drones, ships, sensors, handset radios, etc. Nonorthogonal coded modulation, a special form of multiple input multiple output (MIMO)-NOMA is proposed. The discussion starts with evaluating the output signal to interference-plus-noise (SINR) of receiver filter, leading to the unveiling of a closed-form expression for overloading systems as the number of users is significantly larger than the number of devices admitted such that massive connectivity is rendered. The expression allows for the development of simple yet successful interference suppression based on power allocation and phase shaping techniques that maximizes the sum rate since it is equivalent to fixed-point programming as can be proved. The proposed design is exemplified by nonlinear modulation schemes such as minimum shift keying (MSK) and Gaussian MSK (GMSK), two pivotal modulation formats in IoMT standards such as Link-16 and JITDS. Numerical results show that near capacity performance is offered. Fortunately, the performance is obtained using simple forward error corrections (FECs) of higher coding rate than existing schemes do, while the transmit power is reduced by 6 dB. The proposed design finds wide applications not only in IoMT but also in deep space communications, where ultra reliability and massive connectivity is a keen concern.

Abstract Background As the second largest leafy vegetable, cabbage (Brassica oleracea L. var. capitata) is grown globally, and the characteristics of the different varieties, forms, and colors of cabbage may differ. In this study, five analysis methods—variance analysis, correlation analysis, cluster analysis, principal component analysis, and comprehensive ranking—were used to evaluate the quality indices (soluble protein, soluble sugar, and nitrate), antioxidant content (vitamin C, polyphenols, and flavonoids), and mineral (K, Ca, Mg, Cu, Fe, Mn, and Zn) content of 159 varieties of four forms (green spherical, green oblate, purple spherical, and green cow heart) of cabbage. Results The results showed that there are significant differences among different forms and varieties of cabbage. Compared to the other three forms, the purple spherical cabbage had the highest flavonoid, K, Mg, Cu, Mn, and Zn content. A scatter plot of the principal component analysis showed that the purple spherical and green cow heart cabbage varieties were distributed to the same quadrant, indicating that their quality indices and mineral contents were highly consistent, while those of the green spherical and oblate varieties were irregularly distributed. Overall, the green spherical cabbage ranked first, followed by the green cow heart, green oblate, and purple spherical varieties. Conclusions Our results provide a theoretical basis for the cultivation and high-quality breeding of cabbage.

Abstract CircLRIG1, a newly discovered circRNA, has yet to have its potential function and biological processes reported. This study explored the role of circLRIG1 in the development and progression of bladder carcinoma and its potential molecular mechanisms. Techniques such as qRT-PCR, Western blot, various cellular assays, and in vivo models were used to investigate mRNA and protein levels, cell behavior, molecular interactions, and tumor growth. The results showed that both circLRIG1 and LRIG1 were significantly reduced in bladder carcinoma tissues and cell lines. Low circLRIG1 expression was associated with poor patient prognosis. Overexpressing circLRIG1 inhibited bladder carcinoma cell growth, migration, and invasion, promoted apoptosis, and decreased tumor growth and metastasis in vivo. Importantly, circLRIG1 was found to sponge miR-214-3p, enhancing LRIG1 expression, and its overexpression also modulated protein levels of E-cadherin, N-cadherin, Vimentin, and LRIG1. Similar effects were observed with LRIG1 overexpression. Notably, a positive correlation was found between circLRIG1 and LRIG1 expression in bladder carcinoma tissues. Additionally, the tumor-suppressing effect of circLRIG1 was reversed by overexpressing miR-214-3p or silencing LRIG1. The study concludes that circLRIG1 suppresses bladder carcinoma progression by enhancing LRIG1 expression via sponging miR-214-3p, providing a potential strategy for early diagnosis and treatment of bladder carcinoma.

Abstract Importance The first meta-analysis focused only on gonadotropin-releasing hormone (GnRH) antagonists, which helped determine the effect of delay trigger on pregnancy outcomes. Objective To evaluate the impact of delay trigger compared with standard trigger in normal responders undergoing GnRH antagonist protocol in improving pregnancy outcomes. Methods Studies published before April 2023 in PubMed, EMBASE, Cochrane Library, Web of Science, CNKI, Wanfang, VIP and CBM databases were searched. Randomized controlled trials (RCTs) and cohort studies conducted in normal responders reporting the efficacy of delay trigger using GnRH antagonist protocol were included. Data were combined to calculate mean differences (MD) for continuous variables and odd ratios (OR) for categorical variables with their corresponding 95% confidence intervals (CIs). Heterogeneity was assessed using Cochran’s Q test. Results Endpoints, including clinical pregnancy rate (CPR), live birth rate (LBR), the number of oocyte retrievals and embryos, and fertilization rate, were analyzed. Six (6) clinical studies (4 RCTs and 2 cohort studies) with 1,360 subjects were included. The pooled results showed that the number of oocyte retrievals (MD: 1.20, 95% CI: 1.10, 1.30, p

Abstract Background Thyroid eye disease (TED) is highly correlated with dysregulated immunoendocrine status. The insular cortex was found to regulate peripheral inflammation and immunomodulation in mice. This study aimed to explore whether the insular cortex in patients with TED played a modulatory role including the aberrant brain functional alteration and its association with immunoendocrine status. Methods This study included 34 active patients (AP), 30 inactive patients (IP) with TED, and 45 healthy controls (HC) matched for age, sex, and educational level. Comprehensive clinical details (especially immunoendocrine markers) and resting-state functional magnetic resonance imaging data were collected from each participant. The amplitude of low-frequency fluctuation (ALFF) was used to probe the aberrant alterations of local neural activity. The seed-based functional connectivity (FC) analysis was used to explore the relationship between the insular cortex and each voxel throughout the whole brain. The correlation analysis was conducted to assess the association between insular neurobiomarkers and immunoendocrine parameters. Results When compared with the IP and HC groups, the AP group displayed significantly higher ALFF values in the right insular cortex (INS.R) and lower FC values between the INS.R and the bilateral cerebellum. None of the neurobiomarkers differed between the IP and HC groups. Besides, correlations between insular neurobiomarkers and immunoendocrine markers (free thyroxine, the proportion of T cells, and natural killer cells) were identified in both AP and IP groups. Conclusions This study was novel in reporting that the dysregulation of the insular cortex activity in TED was associated with abnormal peripheral immunoendocrine status. The insular cortex might play a key role in central–peripheral system interaction in TED. Further research is crucial to enhance our understanding of the central–peripheral system interaction mechanisms involved in autoimmune diseases.

Abstract Background The aim of this study was to identify the risk factors for postoperative delirium (POD) in elderly patients undergoing heart valve surgery with cardiopulmonary bypass (CPB). Methods Elderly patients undergoing elective heart valve surgery with CPB in The First Affiliated Hospital of Wenzhou Medical University between March 2022 and March 2023 were selected for this investigation. They were divided into a POD group and a non-POD group. Their baseline information was collected and recorded, and the patients were subjected to neurocognitive function assessment using the Mini-Mental State Examination and the Montreal Cognitive Assessment scales before surgery. We also recorded their intraoperative indicators such as duration of surgery, duration of CPB, duration of aortic cross-clamp, blood transfusion, and postoperative indicators such as duration of mechanical ventilation, postoperative 24-hour drainage volume, and pain score. Regional cerebral oxygen saturation was monitored intraoperatively by near-infrared spectroscopy based INVOS5100C Regional Oximeter. Patients were assessed for the occurrence of POD using Confusion Assessment Method for the Intensive Care Unit, and logistic regression analysis of risk factors for POD was performed. Results The study finally included 132 patients, with 47 patients in the POD group and 85 ones in the non-POD group. There were no significant differences in baseline information and preoperative indicators between the two groups. However, marked differences were identified in duration of surgery, duration of CPB, duration of aortic cross-clamp, duration of postoperative mechanical ventilation, postoperative length of stay in cardiac intensive care unit, postoperative length of hospital stay, intraoperative blood transfusion, postoperative pain score, and postoperative 24-hour drainage volume between the two groups (p 285 min (OR, 1.021 [95% CI, 1.008–1.035]; p = 0.002), duration of postoperative mechanical ventilation > 23.5 h (OR, 6.210 [95% CI, 1.619–23.815]; p = 0.008), and postoperative CCU stay > 3.5 d (OR, 3.927 [95% CI, 1.046–14.735]; p = 0.043) were independent risk factors of the occurrence of POD while change of rScO2 at T1>50.5 (OR, 0.832 [95% CI 0.736–0.941]; p = 0.003) was a protective factor for POD. Conclusion Duration of surgery duration of postoperative mechanical ventilation and postoperative CCU stay are risk factors for POD while change of rScO2 at T1 is a protective factor for POD in elderly patients undergoing heart valve surgery with CPB.

Abstract Deep learning‐based‐image denoising methods have recently achieved excellent performance by learning non‐linear mapping in the spatial domain. However, these methods fail to address the noise without specific distribution because they only use features of the spatial domain. Meanwhile, existing methods that utilize features in the frequency domain fail to combine the detailed information of both domains properly for effective reconstruction and demonstrate poor generalization. Therefore, a novel adaptive fusion dual‐domain network (AFDN) is introduced for single image restoration. Different from deep learning‐based methods, which operate on the spatial or dual‐domains in a certain order, the proposed AFDN combine the spatial‐domain image and corresponding frequency‐domain image as the input and use the interlacing dual‐domain module with flexible adaptability to learn the relationship between spatial and frequency domains. In experimental results, the AFDN is compared with several state‐of‐the‐art restoration methods. Quantitative results showed that the AFDN achieves enhanced effects and high index values. The code of this paper will be released at https://github.com/jzw0707/AFDN

AIM: To explore the brain mechanism of acupuncture for children with anisometropic amblyopia using the voxel-mirror homotopic connectivity (VMHC) analysis method of resting functional magnetic resonance imaging (rs-fMRI) technology based on clinical effectiveness. METHODS: Eighty children with anisometropic monocular amblyopia were randomly divided into two groups: control (40 cases, 1 case of shedding) and acupuncture (40 cases, 1 case of shedding) groups. The control group was treated with glasses, red flash, grating, and visual stimulations, with each procedure conducted for 5min per time. Based on routine treatment, the acupuncture group underwent acupuncture of “regulating qi and unblocking meridians to bright eyes”, Jingming (BL1), Cuanzhu (BL2), Guangming (GB37), Fengchi (GB20) acupoints were taken on both sides, with the needle kept for 30min each time. Both groups were treated once every other day, three times per week, for a total of 4wk. After the treatment, the overall curative effect of the two groups and the latency and amplitude changes of P100 wave of pattern visual-evoked potential were counted. At the same time, nine children with left eye amblyopia were randomly selected from the two groups and were scanned with rs-fMRI before and after treatment. The differences in the brain regions between the two groups were compared and analyzed with VMHC. RESULTS: Chi-square test showed a notable difference in the total efficiency rate between the acupuncture (94.87%) and control groups (79.49%). Regarding the P100 wave latency and amplitude, the acupuncture group had significantly shorter latency and higher amplitude of P100 wave than the control group. Moreover, the VMHC values of the bilateral temporal lobe, superior temporal gyrus, and middle temporal gyrus were notably increased in the acupuncture group after treatment. CONCLUSION: Acupuncture combined with conventional treatment can significantly improve the corrected visual acuity and optic nerve conduction in children with anisometropic amblyopia. Compared with the conventional treatment, the regulation of acupuncture on the functional activities of the relevant brain areas in the anterior cerebellum may be an effective acupuncture mechanism for anisometropic amblyopia.

Photovoltaic (PV) power forecasting is essential for secure operation of a power system. Effective prediction of PV power can improve new energy consumption capacity, help power system planning, promote development of smart grids, and ultimately support construction of smart energy cities. However, different from centralized PV power forecasts, three critical challenges are encountered in distributed PV power forecasting: 1) lack of on-site meteorological observation, 2) leveraging extraneous data to enhance forecasting performance, 3) spatial-temporal modelling methods of meteorological information around the distributed PV stations. To address these issues, we propose a Graph Spatial-Temporal Attention Neural Network (GSTANN) to predict the very short-term power of distributed PV. First, we use satellite remote sensing data covering a specific geographical area to supplement meteorological information for all PV stations. Then, we apply the graph convolution block to model the non-Euclidean local and global spatial dependence and design an attention mechanism to simultaneously derive temporal and spatial correlations. Subsequently, we propose a data fusion module to solve the time misalignment between satellite remote sensing data and surrounding measured on-site data and design a power approximation block to map the conversion from solar irradiance to PV power. Experiments conducted with real-world case study datasets demonstrate that the prediction performance of GSTANN outperforms five state-of-the-art baselines.

Background: To investigate the expression levels and diagnostic value of glial cell line-derived neurotrophic factor (GDNF), carcinoembryonic antigen (CEA) and carbohydrate antigen199 (CA199) in patients with colorectal carcinoma (CRC). Methods: 50 CRC patients at our hospital from Feb. 2020 to Feb. 2021 were chosen as the malignant group, another 50 patients with benign colonic diseases were chosen as the benign group, and 50 healthy people who came to our hospital for physical examination during the same period were considered as the control group. Fasting peripheral venous blood was taken from all research subjects in the morning and tested by a fully-automated electrochemiluminometer to determine the GDNF, CEA and CA199 levels. The sensitivity and specificity of the combined detection of the three indexes for CRC were analyzed, and the receiver operating characteristic (ROC) curve was plotted to record the area under the curve (AUC). Results: The malignant group had remarkably higher CEA and CA199 levels (P

Non-invasive cerebral neuromodulation technologies are essential for the reorganization of cerebral neural networks, which have been widely applied in the field of central neurological diseases, such as stroke, Parkinson’s disease, and mental disorders. Although significant advances have been made in neuromodulation technologies, the identification of optimal neurostimulation parameters including the cortical target, duration, and inhibition or excitation pattern is still limited due to the lack of guidance for neural circuits. Moreover, the neural mechanism underlying neuromodulation for improved behavioral performance remains poorly understood. Recently, advancements in neuroimaging have provided insight into neuromodulation techniques. Functional near-infrared spectroscopy, as a novel non-invasive optical brain imaging method, can detect brain activity by measuring cerebral hemodynamics with the advantages of portability, high motion tolerance, and anti-electromagnetic interference. Coupling functional near-infrared spectroscopy with neuromodulation technologies offers an opportunity to monitor the cortical response, provide real-time feedback, and establish a closed-loop strategy integrating evaluation, feedback, and intervention for neurostimulation, which provides a theoretical basis for development of individualized precise neurorehabilitation. We aimed to summarize the advantages of functional near-infrared spectroscopy and provide an overview of the current research on functional near-infrared spectroscopy in transcranial magnetic stimulation, transcranial electrical stimulation, neurofeedback, and brain-computer interfaces. Furthermore, the future perspectives and directions for the application of functional near-infrared spectroscopy in neuromodulation are summarized. In conclusion, functional near-infrared spectroscopy combined with neuromodulation may promote the optimization of central neural reorganization to achieve better functional recovery from central nervous system diseases.

Abstract Coronavirus disease 2019 (COVID-19) continues to impact global public health. The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has become less virulent as it mutates, prompting China to ease restrictions at the end of 2022. With the complete reopening, a surge in COVID-19 cases has ensued. Therefore, we conducted a study to explore the correlation between plasma antibody levels and baseline conditions or clinical outcomes in severe and critical patients. We collected the basic information of 79 included patients. Enzyme-linked immunosorbent assay (ELISA) tests were performed on plasma samples. The receptor-binding domain (RBD) IgG antibody level of the mild group was significantly higher than that of the severe/critical group (P = 0.00049). And in the severe/critical group, there existed an association between plasma antibody levels and age (P

Deep learning (DL) has been introduced to change detection (CD) due to its powerful feature representation and robust generalization abilities. However, the application of large DL models has high computational complexity and massive storage requirements for achieving good performance. For disaster emergency response and other applications with high timeliness requirements, it is difficult to deploy large DL models on spaceborne edge devices with limited resources to achieve on-board CD processing. To address this limitation, a novel CD based on knowledge distillation (CDKD) method that combines prototypical contrastive distillation and channel-spatial-normalized (CSN) distillation is proposed. PC distillation represents the feature distribution by calculating the differences between the similarities of pixel features and their positive and negative prototypes, and improves the student model's detection ability in changed regions that have similar features to the background by mimicking the relative feature distribution. CSN distillation combines two distillation paradigms, channel normalization and spatial normalization, and guides the student model to comprehensively learn the knowledge contained in the output probabilities of the teacher model to accurately identify changed regions with complex shapes. The effectiveness and reliability of the proposed CDKD method are verified on three public remote sensing CD datasets, and extensive experiments and analyses show that the proposed CDKD method can be used to train lightweight models with comparable performance to that of large models.

Monochamus saltuarius Gebler (Coleoptera, Cerambycidae) serves as the primary carrier of Bursaphelenchus xylophilus (Steiner & Buhrer) (Aphelenchida, Aphelenchoididae) in the middle-temperate zone of China. Pine wilt disease caused by B. xylophilus leads to serious losses to pine forestry around the world. It is necessary to study the biological control of M. saltuarius to effectively prevent the further spread of B. xylophilus. To explore the insect resources that act as natural enemies of M. saltuarius, investigations were conducted on natural enemy insects by splitting Pinus koraiensis Siebold & Zucc (Pinales, Pinaceae) damaged by M. saltuarius and dissecting their trunks in Yingpan Village, Fushun County, Fushun City, Liaoning Province, China, in 2023. A larva of Inocellia (Amurinocellia) calida (H. Aspöck & U. Aspöck) (Raphidioptera, Inocelliidae) was discovered in the trunk of an infested P. koraiensis. Additionally, the feeding habits of I. calida were preliminarily examined under indoor conditions and a description of its morphological characteristics was provided. When placed in an indoor environment, the I. calida larva began pupating after a period of 21 days, during which time it consumed and attacked a total of 23 M. saltuarius larvae. Ultimately, after a pupal period of ten days, the I. calida larva emerged successfully as an adult. This discovery marks the first recorded presence of I. calida in Liaoning Province and the first documentation of I. calida in China, serving as a natural predatory enemy of M. saltuarius.

This study investigates the joint effect of air pollution and different types of green spaces (e.g. mixed forests) on stress levels in South Korea. Two periods were examined: before the COVID-19 pandemic (2017–2019) and during the COVID-19 pandemic (2020–2022). We used 16 total parameters for our Random Forest model. Stress was the dependent variable, and 15 other variables were independent parameters. Our focused independent parameters were PM10 and green spaces (forest types). Our findings show that mixed forests reduce stress, particularly when pollution levels are low. In addition, is associated with increased stress levels, and this relationship became stronger during the COVID-19. These findings indicate that protecting mixed forests and improving air quality may improve people’s mental health. This study provides insights into how cities can be made healthier and happier places to live, particularly during challenging periods such as a pandemic.

To investigate the impact of the effective radiation dose to immune cells (EDIC) and gross tumor volume (GTV) on lymphopenia and survival in patients with locally advanced esophageal squamous cell carcinoma (LAESCC). Between January 2013 and December 2020, 272 LAESCC patients were treated with definitive radiotherapy in two institutions. Based on radiation doses to the lungs, heart, and body region scanned, EDIC was calculated as an equal uniform dose to the total blood considering blood flow and fraction effect. The radiotherapy plan was used to calculate the GTVs. Lymphopenia was graded based on the lowest lymphocyte count during RT. The overall survival (OS), progress-free survival (PFS), and local recurrence-free survival (LRFS) were analyzed statistically. The lowest lymphocyte count was significantly correlated with EDIC (r= −0.389, p < .001) and GTV (r= −0.211, p < .001). Lymphopenia, EDIC, and GTV are risk factors for patients with ESCC. In a Kaplan-Meier analysis with EDIC and GTV as stratification factors, lymphopenia was not associated with OS in the EDIC>12.9 Gy group (p = .294)and EDIC ≤ 12.9 Gy group, and it was also not associated with OS in GTV>68.8 cm3 group (p = .242) and GTV ≤ 68.8 cm3 group(p = .165). GTV and EDIC had an impact on the relationship between lymphopenia and OS in patients with LAESCC undergoing definitive RT. Poorer OS, PFS, and LRFS are correlated with lymphopenia, higher EDIC, and larger GTV.

AbstractAURKA is a threonine or serine kinase that needs to be activated by TPX2, Bora and other factors. AURKA is located on chromosome 20 and is amplified or overexpressed in many human cancers, such as breast cancer. AURKA regulates some basic cellular processes, and this regulation is realized via the phosphorylation of downstream substrates. AURKA can function in either the cytoplasm or the nucleus. It can promote the transcription and expression of oncogenes together with other transcription factors in the nucleus, including FoxM1, C-Myc, and NF-κB. In addition, it also sustains carcinogenic signaling, such as N-Myc and Wnt signaling. This article will focus on the role of AURKA in the nucleus and its carcinogenic characteristics that are independent of its kinase activity to provide a theoretical explanation for mechanisms of resistance to kinase inhibitors and a reference for future research on targeted inhibitors.

Abstract Objective To explore the efficacy and potential mechanism of Fengshi Gutong capsule (FSGTC) in osteoarthritis (OA) inflammation. Methods The impact of FSGTC on laboratory indicators of OA patients was explored using data mining technology and association rule analysis. Then, the OA cell model was constructed by inducing chondrocytes (CHs) with interleukin‐1β (IL‐1β). In the presence of FSGTC intervention, the regulatory mechanism of PACER/COX2/PGE2 in OA‐CH viability and inflammatory responses was evaluated. Results Retrospective data mining showed that FSGTC effectively reduced inflammation indexes (ESR, HCRP) of OA patients. Cell experiments showed that LncRNA PACER (PACER) silencing inhibited the proliferation activity of OA‐CHs, increased the level of COX2 protein, elevated the levels of PGE2, TNF‐α, and IL‐1β, and decreased the levels of IL‐4 and IL‐10 (p

BackgroundCervical squamous cell carcinoma and endocervical adenocarcinoma (CESC) are among the most prevalent gynecologic malignancies globally. The prognosis is abysmal once cervical cancer progresses to lymphatic metastasis. Anoikis, a specialized form of apoptosis induced by loss of cell adhesion to the extracellular matrix, plays a critical role. The prediction model based on anoikis-related genes (ARGs) expression and clinical data could greatly aid clinical decision-making. However, the relationship between ARGs and CESC remains unclear.MethodsARGs curated from the GeneCards and Harmonizome portals were instrumental in delineating CESC subtypes and in developing a prognostic framework for patients afflicted with this condition. We further delved into the intricacies of the immune microenvironment and pathway enrichment across the identified subtypes. Finally, our efforts culminated in the creation of an innovative nomogram that integrates ARGs. The utility of this prognostic tool was underscored by Decision Curve Analysis (DCA), which illuminate its prospective benefits in guiding clinical interventions.ResultsIn our study, We discerned a set of 17 survival-pertinent, anoikis-related differentially expressed genes (DEGs) in CESC, from which nine were meticulously selected for the construction of prognostic models. The derived prognostic risk score was subsequently validated as an autonomous prognostic determinant. Through comprehensive functional analyses, we observed distinct immune profiles and drug response patterns among divergent prognostic stratifications. Further, we integrated the risk scores with the clinicopathological characteristics of CESC to develop a robust nomogram. DCA corroborated the utility of our model, demonstrating its potential to enhance patient outcomes through tailored clinical treatment strategies.ConclusionThe predictive signature, encompassing nine pivotal genes, alongside the meticulously constructed nomogram developed in this research, furnishes clinicians with a sophisticated tool for tailoring treatment strategies to individual patients diagnosed with CESC.

Introduction Schizophrenia, a chronic mental problem, significantly impacts cognition, emotion and social functioning. Conventional pharmacotherapy faces challenges including numerous side effects, low adherence to medication and substantial costs. In this context, group arts therapies (GATs) emerge as a promising complementary approach for symptom alleviation in schizophrenia patients. Nonetheless, the effectiveness and safety of GATs are yet to be firmly established. This study aims to systematically assess the therapeutic impact of all group-based artistic interventions as complementary treatments for schizophrenia, focusing on their potential benefits.Methods and analysis This study will search four English-language databases (PubMed, Web of Science, Cochrane Library and Embase), two Chinese databases (Wanfang Data and China National Knowledge Infrastructure) and three Korean databases (RISS, Korean Citation Index and DBpia) from their inception until October 2023. It will include all randomised controlled trials that compare GATs for schizophrenia with standard rehabilitation methods. The primary outcome is the improvement in patients’ positive and negative symptoms. Methodologies such as bias risk assessment, data synthesis, sensitivity analysis and subgroup analysis will be implemented using Review Manager V.5.4. Study results with high heterogeneity will be merged using a random-effects model (I2>50% or p

Carbon dots (CDs), as a new kind of fluorescent nanomaterials, show great potential for application in several fields due to their unique nano-size effect, easy surface functionalization, controllable photoluminescence, and excellent biocompatibility. Conventional preparation methods for CDs typically involve top-down and bottom-up approaches. Doping is a major step forward in CDs design methodology. Chemical doping includes both non-metal and metal doping, in which non-metal doping is an effective strategy for modulating the fluorescence properties of CDs and improving photocatalytic performance in several areas. In recent years, Metal-doped CDs have aroused the interest of academics as a promising nano-doping technique. This approach has led to improvements in the physicochemical and optical properties of CDs by altering their electron density distribution and bandgap capacity. Additionally, the issues of metal toxicity and utilization have been addressed to a large extent. In this review, we categorize metals into two major groups: transition group metals and rare-earth group metals, and an overview of recent advances in biomedical applications of these two categories, respectively. Meanwhile, the prospects and the challenges of metal-doped CDs for biomedical applications are reviewed and concluded. The aim of this paper is to break through the existing deficiencies of metal-doped CDs and fully exploit their potential. I believe that this review will broaden the insight into the synthesis and biomedical applications of metal-doped CDs.

Background: DIREN is a SHE ethnic medicine with stasis-resolving, hemostasis, clearing heat, and removing toxin effects. It is clinically used in the treatment of gastrointestinal bleeding, such as ulcerative colitis (UC). Aim of the study: Fibrosis is one of the pathological changes in the progression of UC, which can make it challenging to respond to a treatment. We aimed to illuminate the role of DIREN in DSS-induced UC and tried to unveil its related mechanisms from two perspectives: intestinal inflammation and collagen deposition. Materials and methods: A 2.5 % dextran sulfate sodium (DSS) water solution was used to induce colitis in mice. The therapeutic effect of DIREN was assessed using the disease activity index, histopathological score, and colon length. Masson and Sirius Red staining was used to observe the fibrosis in the colon. Apoptosis of colonic epithelial cells was observed by TUNEL immunofluorescence staining. RNA-seq observed differential genes and enrichment pathways. Immunohistochemistry and RT-qPCR were used to detect the expression of molecules related to fibrosis and focal adhesion signaling in colon tissue. Results: The administration of DIREN resulted in a reduction of disease activity index (DAI) in mice with UC while simultaneously promoting an increase in colon length. DIREN mitigated the loss of goblet cells in the colon of UC mice and maintained the integrity of the intestinal mucosa barrier. Masson staining revealed a reduction in colonic fibrosis with DIREN treatment, while Sirius red staining demonstrated a decrease in collagen Ⅰ deposition. DIREN reduced apoptosis of colonic epithelial cells and the expression of genes, such as CDH2, ITGA1, and TGF-β2. Additionally, the results of GSEA analysis of colon tissue transcriptome showed that the differentially expressed genes were enriched in the focal adhesion pathway. DIREN was found to downregulate the protein expression of BAX, N-cadherin, β-catenin, Integrin A1, and Vinculin while upregulating the protein expression of BCL2. Additionally, it led to the co-expression of N-cadherin and α-SMA. Conclusion: DIREN exerts a protective effect against DSS-induced UC by ameliorating colonic fibrosis via regulation of focal adhesion and the WNT/β-catenin signaling pathway, thereby inhibiting fibroblast migration and reducing collagen secretion.

The distinctive three-dimensional architecture, biological functionality, minimal immunogenicity, and inherent biodegradability of small intestinal submucosa extracellular matrix materials have attracted considerable interest and found wide-ranging applications in the domain of tissue regeneration engineering. This article presents a comprehensive examination of the structure and role of small intestinal submucosa, delving into diverse preparation techniques and classifications. Additionally, it proposes approaches for evaluating and modifying SIS scaffolds. Moreover, the advancements of SIS in the regeneration of skin, bone, heart valves, blood vessels, bladder, uterus, and urethra are thoroughly explored, accompanied by their respective future prospects. Consequently, this review enhances our understanding of the applications of SIS in tissue and organ repair and keeps researchers up-to-date with the latest research advancements in this area.

Abstract Background We explored the potential novel anticancer mechanisms of 25‐hydroxyvitamin D (25(OH)D), a vitamin D metabolite with antitumour effects in breast cancer. It is stable in serum and is used to assess vitamin D levels in clinical practice. Transfer RNA‐derived small RNAs are small noncoding RNAs that generate various distinct biological functions, but more research is needed on their role in breast cancer. Methods Small RNA microarrays were used to explore the novel regulatory mechanism of 25(OH)D. High‐throughput RNA‐sequencing technology was used to detect transcriptome changes after 25(OH)D treatment and tRF‐1‐Ser knockdown. RNA pull‐down and high‐performance liquid chromatography–mass spectrometry/mass spectrometry were used to explore the proteins bound to tRF‐1‐Ser. In vitro and in vivo functional experiments were conducted to assess the influence of 25(OH)D and tRF‐1‐Ser on breast cancer. Semi‐quantitative PCR was performed to detect alternative splicing events. Western blot assay and qPCR were used to assess protein and mRNA expression. Results The expression of tRF‐1‐Ser is negatively regulated by 25(OH)D. In our breast cancer (BRCA) clinical samples, we found that the expression of tRF‐1‐Ser was higher in cancer tissues than in paired normal tissues, and was significantly associated with tumour invasion. Moreover, tRF‐1‐Ser inhibits the function of MBNL1 by hindering its nuclear translocation. Functional experiments and transcriptome data revealed that the downregulation of tRF‐1‐Ser plays a vital role in the anticancer effect of 25(OH)D. Conclusions In brief, our research revealed a novel anticancer mechanism of 25(OH)D, unveiled the vital function of tRF‐1‐Ser in BRCA progression, and suggested that tRF‐1‐Ser could emerge as a new therapeutic target for BRCA.

ContextCabozantinib combined with immune checkpoint inhibitors (ICIs) has brought a new therapeutic effect for the medical treatment of renal cell carcinoma (RCC).ObjectivesWe performed a meta-analysis of randomized controlled trials and single-arm trials to evaluate the efficacy and safety of cabozantinib plus ICIs in RCC.MethodsWe extracted data from PubMed, Cochrane, Medline and Embase databases, and rated literature quality through Cochrane risk of bias tool and MINORS. RevMan5.3 software was used to analyze the results of randomized controlled trials and single-arm trials.ResultsA total of 7 studies were included. Treatment with cabozantinib plus ICIs improved PFS [HR 0.75, (95%CI: 0.52, 1.08), p = 0.12] and the OS [HR 0.80, (95%CI: 0.60, 1.07), p = 0.13] in randomized controlled trials. Meanwhile, the result of the ORR in randomized controlled trials was [risk ratio (RR) 1.37, (95%CI: 1.21, 1.54), p < 0.00001] and in single-arm trials was [risk difference (RD) 0.49, (95%CI: 0.26, 0.71), p < 0.0001].ConclusionCabozantinib plus ICIs prolonged the PFS and OS, and improved ORR in patients with RCC. Our recommendation is to use cabozantinib plus ICIs to treat advanced RCC, and to continuous monitor and manage the drug-related adverse events.Systematic Review Registration:identifier CRD42023455878.

Multi-cluster hydraulic fracturing of horizontal wells is a well-adopted technique with high efficiency to increase the production of tight and shale formations. However, the stress shadows among clusters pose challenges to the synchronous propagation of hydraulic fractures during multi-cluster fracturing. In order to explore the fracture propagation mechanism and characteristics under the influence of stress shadow in low-spacing staged multi-cluster fracturing, a three-dimensional hydraulic fracturing model was generated using a lattice-based method. This model considered the impact of geological and engineering parameters on the propagation behavior of multiple fractures in shale formation. A variable pumping approach is adopted, where the fracturing fluid is initially injected at a high rate and then transitioned to a lower rate. Afterward, a method was proposed to quantitatively assess the extent of fracturing in a specific area (i.e., the stimulated area), considering the impact of stress shadow within a single stage. The simulation results demonstrated significant differences in the fracture stimulation area due to the influence of each parameter in the case of uncontrollable geological factors and controllable engineering factors. An increase in both Young’s modulus and stress anisotropy of the reservoir results led to a corresponding increase in the total fracture stimulation area. As the principal stress orientation increased, the fracture stimulation area gradually decreased. In terms of operational parameters, the stimulated area of hydraulic fractures gradually decreased as the fracture spacing increased. With increasing injection rate, the stimulated area initially expanded and then decreased, peaking at an injection rate of 0.04 m3/s. These findings can provide valuable insights into the propagation behavior of multi-cluster hydraulic fractures under uncertain parameters, with significant implications for future engineering applications.

Exploring the creep law of sandstone provides a theoretical basis for evaluating the long-term stability of geotechnical engineering projects in red beds. Based on a conventional triaxial test of sandstone, a progressive loading triaxial creep test is conducted. The deformation characteristics and laws of each sample in different deformation stages are summarized, and the laws relating steady creep rate, stress and time are analyzed. On this basis, a nonlinear viscoelastic‒plastic creep model based on fractional derivative theory and damage theory is established. According to the nonlinear fitting results, the parameter sensitivities are analyzed. The results verify the rationality of the model; this model has a good fitting effect for each creep deformation stage, especially for the accelerated creep stage. The constitutive relationship of the model is simple, clear and easily applicable. The research results provide a reference for studying the long-term stability of geotechnical engineering projects.

Optical remote sensing is crucial in land management, maritime safety, and rescue operations. Currently, high resolution target detection faces the problems including feature loss, false detection, and limited network robustness. To tackle the aforementioned issues, this study introduces a novel MBS-NET model, which is built upon the YOLOv5 structure. The proposed model presents a multi-branch stacking module structure to precisely capture deep target feature information. By introducing a dual-channel attention mechanism module (EGCA) at the model's neck, the proposed method ensures discriminative feature acquisition in crowded objects and vast spatial scenes. Prior to network training, introduce an improved data augmentation strategy to accommodate the multi-scale and directional variations in remote sensing objectives for model detection. Experimental results on the large-scale public DIOR dataset demonstrate that the MBS-NET model introduced in this paper displays exceptional performance and remarkable interpretability in remote sensing scenarios at a large scale. MBS-NET model outperforms YOLOv5 and YOLOv7 models by increasing the accuracy by 5% and 2% respectively. In addition, the recall rate and F1 Score index of MBS-NET model is superior to those of other methods, resulting in significant improvement of detection accuracy and robustness in large scenes.

High resolution satellite images are becoming increasingly available for urban multi-temporal semantic understanding. However, few datasets can be used for land-use/land-cover (LULC) classification, binary change detection (BCD) and semantic change detection (SCD) simultaneously because classification datasets always have one time phase and BCD datasets focus only on the changed location, ignoring the changed classes. Public SCD datasets are rare but much needed. To solve the above problems, a tri-temporal SCD dataset made up of Gaofen-2 (GF-2) remote sensing imagery (with 11 LULC classes and 60 change directions) was built in this study, namely, the Wuhan Urban Semantic Understanding (WUSU) dataset. Popular deep learning based methods for LULC classification, BCD and SCD are tested to verify the reliability of WUSU. A Siamese-based multi-task joint framework with a multi-task joint loss (MJ loss) named ChangeMJ is proposed to restore the object boundaries and obtains the best results in LULC classification, BCD and SCD, compared to the state-of-the-art (SOTA) methods. Finally, a large spatial-scale mapping for Wuhan central urban area is carried out to verify that the WUSU dataset and the ChangeMJ framework have good application values.

Previous studies have utilized regression models to investigate the impact of environmental factors on physical activity. However, such approaches are inadequate for data-driven analysis seeking to identify robust associations from the intricate and multi-variable interactions between physical activity and environmental factors. With the emergence of the concept of the exposome, which encompasses the totality of exposures, this paper explores machine learning models for predicting the percentage of physical inactivity in U.S. counties, while considering 28 social-, economic-, and physical-environmental factors. The aim of this study is to address the research gap and gain insight into the complex associations between environmental exposures and physical activity. Five machine learning models were tested, and the performances were compared to select the best classifier for further investigation. This study used data from the Behavioral Risk Factor Surveillance System (BRFSS) of the Centers for Disease Control and Prevention. The mean population of all counties was 102,841, and the mean percentage of population below 18 years was 22.3%. The partial dependence plot analysis indicated that only one feature – bachelor’s degree – exhibited a close-to-linear relationship with physical inactivity. Motor-vehicle crash death rate and mean temperature showed nonlinear and non-monotonic relationships with the predicted percentage of physical inactivity.