Search

Abstract Background Due to the advancement in high throughput technology, single nucleotide polymorphism (SNP) is routinely being incorporated along with phenotypic information into genetic evaluation. However, this approach often cannot achieve high accuracy for some complex traits. It is possible that SNP markers are not sufficient to predict these traits due to the missing heritability caused by other genetic variations such as microsatellite and copy number variation (CNV), which have been shown to affect disease and complex traits in humans and other species. Results In this study, CNVs were included in a SNP based genomic selection framework. A Nellore cattle dataset consisting of 2230 animals genotyped on BovineHD SNP array was used, and 9 weight and carcass traits were analyzed. A total of six models were implemented and compared based on their prediction accuracy. For comparison, three models including only SNPs were implemented: 1) BayesA model, 2) Bayesian mixture model (BayesB), and 3) a GBLUP model without polygenic effects. The other three models incorporating both SNP and CNV included 4) a Bayesian model similar to BayesA (BayesA+CNV), 5) a Bayesian mixture model (BayesB+CNV), and 6) GBLUP with CNVs modeled as a covariable (GBLUP+CNV). Prediction accuracies were assessed based on Pearson’s correlation between de-regressed EBVs (dEBVs) and direct genomic values (DGVs) in the validation dataset. For BayesA, BayesB and GBLUP, accuracy ranged from 0.12 to 0.62 across the nine traits. A minimal increase in prediction accuracy for some traits was noticed when including CNVs in the model (BayesA+CNV, BayesB+CNV, GBLUP+CNV). Conclusions This study presents the first genomic prediction study integrating CNVs and SNPs in livestock. Combining CNV and SNP marker information proved to be beneficial for genomic prediction of some traits in Nellore cattle.

Adaptation of global food systems to climate change is essential to feed the world. Tropical cattle production, a mainstay of profitability for farmers in the developing world, is dominated by heat, lack of water, poor quality feedstuffs, parasites, and tropical diseases. In these systems European cattle suffer significant stock loss, and the cross breeding of taurine x indicine cattle is unpredictable due to the dilution of adaptation to heat and tropical diseases. We explored the genetic architecture of ten traits of tropical cattle production using genome wide association studies of 4,662 animals varying from 0% to 100% indicine. We show that nine of the ten have genetic architectures that include genes of major effect, and in one case, a single location that accounted for more than 71% of the genetic variation. One genetic region in particular had effects on parasite resistance, yearling weight, body condition score, coat colour and penile sheath score. This region, extending 20 Mb on BTA5, appeared to be under genetic selection possibly through maintenance of haplotypes by breeders. We found that the amount of genetic variation and the genetic correlations between traits did not depend upon the degree of indicine content in the animals. Climate change is expected to expand some conditions of the tropics to more temperate environments, which may impact negatively on global livestock health and production. Our results point to several important genes that have large effects on adaptation that could be introduced into more temperate cattle without detrimental effects on productivity.

Obesity leads to insulin resistance (IR) and type 2 diabetes. In humans, low levels of the hormone prolactin (PRL) correlate with IR, adipose tissue (AT) dysfunction, and increased prevalence of T2D. In obese rats, PRL treatment promotes insulin sensitivity and reduces visceral AT adipocyte hypertrophy. Here, we tested whether elevating PRL levels with the prokinetic and antipsychotic drug sulpiride, an antagonist of dopamine D2 receptors, improves metabolism in high fat diet (HFD)-induced obese male mice. Sulpiride treatment (30 days) reduced hyperglycemia, IR, and the serum and pancreatic levels of triglycerides in obese mice, reduced visceral and subcutaneous AT adipocyte hypertrophy, normalized markers of visceral AT function (PRL receptor, Glut4, insulin receptor and Hif-1α), and increased glycogen stores in skeletal muscle. However, the effects of sulpiride reducing hyperglycemia were also observed in obese prolactin receptor null mice. We conclude that sulpiride reduces obesity-induced hyperglycemia by mechanisms that are independent of prolactin/prolactin receptor activity. These findings support the therapeutic potential of sulpiride against metabolic dysfunction in obesity.

El artículo se propone mostrar, en primer lugar, que el enfoque trascendental a la base de las concepciones de la política deliberativa y hegemónica de Habermas y Laclau-Mouffe, respectivamente, tiene como consecuencia neutralizar el pluralismo de las prácticas políticas, asumiendo una concepción historicista en el sentido que Dipesh Chakravarty ha dado al término, como un proceso unificado destinado a reproducirse en todas partes del mismo modo, en último término eurocentrista. Enseguida, sostener que hay en el modo en que Emil Lask piensa las categorías, una manera de evitar el historicismo. Estas están determinadas temporal e históricamente, y no cabe un reino de la validez autónomo o subsistente por sí mismo, y en el que conocer es tener delante una categoría en una perspectiva, en una disposición o un sesgo, en un giro o aspecto. Esto implica que verdad y diversidad, o verdad y pluralismo, así como verdad, poder y contenidos culturales dejen de ser incompatibles

Objective: To describe the clinical characteristics and outcomes to the treatment of patients with isoniazid-resistant tuberculosis (Hr-TB) in an institution in southwest Colombia. Materials and methods: A retrospective observational study was conducted. Patients with diagnostic confirmation, microbiological isolation, drug susceptibility tests, and evidence of Hr-TB were included. Results: Thirty-two patients with Hr-TB were included between 2006-2018, corresponding to 6% (32/528) of resistance in total cases. 78% were new cases, primary resistance, and 22% previously treated, acquired resistance. The most frequent comorbidity was HIV infection (n = 9). The pattern of Hr-TB showed in 23 (72%) cases with high level, 4 (12%) of low level and 5 (16%) with low and high level. The analysis of treatment results was performed on 22 patients, presenting 50% cure, 41% completed treatment, and 9% death related to tuberculosis. Conclusions: Hr-TB predominates in new cases, which is an obstacle to treatment where susceptibility tests are not performed routinely.

Introduction: Diagnosing extra-pulmonary tuberculosis (EPTB) is a challenge for physicians. It has been suggested that cancer antigen 125 (CA-125), which is produced by mesothelial cells, may be an EPTB diagnostic biomarker. Objective: To describe serum CA-125 levels behavior in patients with TB treated in a referral university hospital located in Cali, Colombia. Materials and methods: A cross-sectional study was conducted in 99 TB patients treated at Fundación Valle del Lili between 2007 and 2016 with CA-125 measurements (U/mL) made before TB treatment was started. Cases were classified as pulmonary TB (PTB) (n=33) or EPTB (n=66). A bivariate analysis was performed to compare the variables of interest (sociodemographic, clinical, and laboratory findings data) between EPTB and PTB groups, and to determine differences between patients with CA-125 positive results and those with negative results in relation to mortality. Results: Elevated CA-125 levels were reported in 55 patients (55.56%), and positive CA-125 results (>35 U/mL) were more frequent in the EPTB group (59.09% vs. 48.48%). In the EPTB group, results were positive in tuberculous serositis cases (100% pericardial TB, 68.42% peritoneal TB, and 66.66% pleural TB), and in 66.66% of miliary TB and spinal TB cases, respectively. Also, 15 TB infection-related deaths were reported in the follow-up period (n=66), of which 13 had a CA-125 positive result, finding a significant difference with those with negative results (p=0.021); however, 47.05% of the surviving patients also had a positive result. Conclusions: Most of tuberculous serositis, miliary TB, and spinal TB cases showed elevated CA-125 levels before starting TB treatment. Therefore, CA-125 may be useful for prognostic purposes in these patients.

Heat stress has a detrimental impact on cattle health, welfare and productivity by affecting gene expression, metabolism and immune response, but little is known on the epigenetic mechanisms mediating the effect of temperature at the cellular and organism level. In this study, we investigated genome-wide DNA methylation in blood samples collected from 5 bulls of the heat stress resilient Nellore breed and 5 bulls of the Angus that are more heat stress susceptible, exposed to the sun and high temperature-high humidity during the summer season of the Brazilian South-East region. The methylomes were analyzed during and after the exposure by Reduced Representation Bisulfite Sequencing, which provided genome-wide single-base resolution methylation profiles. Significant methylation changes between stressful and recovery periods were observed in 819 genes. Among these, 351 were only seen in Angus, 366 were specific to Nellore, and 102 showed significant changes in methylation patterns in both breeds. KEGG and Gene Ontology (GO) enrichment analyses showed that responses were breed-specific. Interestingly, in Nellore significant genes and pathways were mainly involved in stress responses and cellular defense and were under methylated during heat stress, whereas in Angus the response was less focused. These preliminary results suggest that heat challenge induces changes in methylation patterns in specific loci, which should be further scrutinized to assess their role in heat tolerance.

Abstract Background The HLA-B*57:01 allele is associated with a hypersensitivity reaction to abacavir. Due to the lack of knowledge of HLA-B*57:01 prevalence in Colombia, routine screening is not performed and is not recommended by the national guidelines. We aimed to determine the prevalence of HLA-B*57:01 in HIV population from Colombia. Methods This cross-sectional study included naïve HIV-infected adults from 13 cities of the country. The presence of HLA-B*57:01 was determined by using SSP-PCR in blood samples. Prevalence rates were stratified by sex, race, and region of origin. Results HLA-B*57:01 allele prevalence in Colombian HIV-infected individuals was 2.7%. When stratifying for the race, the prevalence was 4% for whites, 2.6% for other race (mainly mestizo), and 1.9% for Afro-Colombians. The prevalence varied from 0% up to 11.4% depending on the department of origin. The highest prevalence rates were found in Caldas (11.4%), Antioquia (5%), Risaralda (4.8%), and Valle del Cauca (4.3%). When distributed by country zones, the central, with a racial predominance of Caucasians and mestizos, was the highest (6.0%, 0R = 4.1, CI 1.2–12.8, p = 0,016). Conclusions The overall prevalence of HLA-B*57:01 in Colombia was lower than the reported rates for other Latin American countries such as Brazil, Costa Rica, and Argentina, but similar in comparison to Chile and Mexico. The diversity in the racial and ethnic heritage shown in our data supports the recommendation to implement routine screening for the HLA-B*57:01 allele before initiation of abacavir-containing antiretroviral therapy in the Colombian HIV management guidelines.

Milk production phenotypes are the main focus of genetic selection in dairy herds, and although there are many genes identified as related to the biology of these traits in pure breeds, little is known about crossbreed animals. This study aimed to identify potential genes associated with the 305-day milk yield in 337 crossbreed Gir × Holstein (Girolando) animals. Milk production records were genotyped for 45,613 single-nucleotide polymorphisms (SNPs). This dataset was used for a genome-wide association study (GWAS) using the 305-day milk yield adjusted for the fixed effects of herd and year and linear and quadratic effects of age at calving (in days) and calving factor averaged per animal. Genes within the significant SNPs were retrieved from the Bos taurus ARS-UCD1.2 assembly (bosTau9) for gene ontology analysis. In summary, the GWAS identified 52 SNPs associated [p ≤ 10–4, false discovery rate (FDR) = 8.77%] with milk production, including NUB1 and SLC24A2, which were previously described as related to milk production traits in cattle. The results suggest that SNPs associated mainly with NUB1 and SLC24A2 could be useful to understand milk production in Girolando and used as predictive markers for selecting genetic predisposition for milk yield in Girolando.

Background: Ending the COVID-19 pandemic is arguably one of the most prominent challenges in recent human history. Following closely the growth dynamics of the disease is one of the pillars toward achieving that goal.Objective: We aimed at developing a simple framework to facilitate the analysis of the growth rate (cases/day) and growth acceleration (cases/day2) of COVID-19 cases in real-time.Methods: The framework was built using the Moving Regression (MR) technique and a Hidden Markov Model (HMM). The dynamics of the pandemic was initially modeled via combinations of four different growth stages: lagging (beginning of the outbreak), exponential (rapid growth), deceleration (growth decay), and stationary (near zero growth). A fifth growth behavior, namely linear growth (constant growth above zero), was further introduced to add more flexibility to the framework. An R Shiny application was developed, which can be accessed at https://theguarani.com.br/ or downloaded from https://github.com/adamtaiti/SARS-CoV-2. The framework was applied to data from the European Center for Disease Prevention and Control (ECDC), which comprised 3,722,128 cases reported worldwide as of May 8th 2020.Results: We found that the impact of public health measures on the prevalence of COVID-19 could be perceived in seemingly real-time by monitoring growth acceleration curves. Restriction to human mobility produced detectable decline in growth acceleration within 1 week, deceleration within ~2 weeks and near-stationary growth within ~6 weeks. Countries exhibiting different permutations of the five growth stages indicated that the evolution of COVID-19 prevalence is more complex and dynamic than previously appreciated.Conclusions: These results corroborate that mass social isolation is a highly effective measure against the dissemination of SARS-CoV-2, as previously suggested. Apart from the analysis of prevalence partitioned by country, the proposed framework is easily applicable to city, state, region and arbitrary territory data, serving as an asset to monitor the local behavior of COVID-19 cases.

To meet the demands of the chemical and pharmaceutical process industry for a combination of high measurement accuracy, product selectivity, and low cost of ownership, the existing measurement and evaluation methods have to be further developed. This paper demonstrates the attempt to combine future Raman photometers with promising evaluation methods. As part of the investigations presented here, a new and easy-to-use evaluation method based on a self-learning algorithm is presented. This method can be applied to various measurement methods and is carried out here using an example of a Raman spectrometer system and an alcohol-water mixture as demonstration fluid. The spectra’s chosen bands can be later transformed to low priced and even more robust Raman photometers. The evaluation method gives more precise results than the evaluation through classical methods like one primarily used in the software package Unscrambler. This technique increases the accuracy of detection and proves the concept of Raman process monitoring for determining concentrations. In the example of alcohol/water, the computation time is less, and it can be applied to continuous column monitoring.

El artículo analiza la concepción de lo político en la obra de Ernesto Laclau desde una mirada pragmática, mostrando que la noción de hegemonía encierra a las prácticas políticas en una ontología de origen semiológico que, pese a sus declaraciones, tiene como resultado una posición esencialista, implicando la impotencia de la práctica política para trascender lo político. La primacía del significante de la semiología es contrastada con los derechos del significado en la concepción pragmática, donde las prácticas establecen el significado de lo político, siendo la función de la filosofía elevarlas a reflexión. Como contrapartida, el enfoque semiológico de Laclau, junto a una concepción oracular de la teoría, asume una idea de decisión cuya consecuencia es que ésta sea reservada a un liderazgo carismático. Palabras clave: la política, lo político, hegemonía, semiología, pragmática, decisión

Navel injuries caused by friction against the pasture can promote infection, reproductive problems and costly treatments in beef cattle raised in extensive systems. A haplotype-based genome-wide association study (GWAS) was performed for visual scores of navel length at yearling in Nellore cattle (Bos indicus) using data from 2,016 animals and 503,088 single nucleotide polymorphism (SNP) markers. The strongest signal (p = 1.01 × 10-9) was found on chromosome 5 spanning positions 47.9–48.2 Mbp. This region contains introns 3 and 4 and exons 4 and 5 of the high mobility group AT-hook 2 gene (HMGA2). Further inspection of the region with whole genome sequence data of 21 Nellore bulls revealed correlations between counts of the significant haplotype and copy number gains of a ∼6.2 kbp segment of intron 3 of HMGA2. Analysis of genome sequences from five African B. indicus and four European Bos taurus breeds revealed that the copy number variant (CNV) is indicine-specific. This intronic CNV was then validated through quantitative polymerase chain reaction (qPCR) using Angus animals as copy neutral controls. Importantly, the CNV was not detectable by means of conventional SNP-based GWAS or SNP probe intensity analyses. Given that HMGA2 affects the expression of the insulin-like growth factor 2 gene (IGF2) together with the pleomorphic adenoma gene 1 (PLAG1), and that the latter has been repeatedly shown to be associated with quantitative traits of economic importance in cattle, these findings highlight the emerging role of variants impacting the insulin-like growth factor pathway to cattle breeding.

Zebu cattle (Bos taurus indicus) are highly adapted to tropical regions. However, females reach puberty after taurine heifers, which affects the economic efficiency of beef cattle breeding in the tropical regions. The aims of this study were to establish associations between the haplotype alleles of the bovine genome and age at first calving (AFC) in the Nelore cattle, and to identify the genes and quantitative trait loci (QTL) related to this phenotype. A total of 2,273 Nelore cattle (995 males and 1,278 females) genotyped using the Illumina BovineHD BeadChip were used in the current study. The association analysis included females with valid first calving records as well as open heifers. Linkage disequilibrium (LD) analysis among the markers was performed using blocks of 5, 10, and 15 markers, which were determined by sliding windows shifting one marker at a time. Then, the haplotype block size to be used in the association study was chosen based on the highest r2 average among the SNPs in the block. The five HapAlleles most strongly associated with the trait (top five) were considered as significant associations. The results of the analysis revealed four genomic regions related to AFC, which overlapped with 20 QTL of the reproductive traits reported previously. Furthermore, there were 19 genes related to reproduction in those regions. In conclusion, the use of haplotypes allowed the detection of chromosomal regions associated with AFC in Nelore cattle, and provided the basis for elucidating the mechanisms underlying this trait.

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (100 to 107 bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF–5’gcgctcaggctgccgacgcaa3’ (6-FAM labeled) and BR–5´accagccattgcggtcggta3’ for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 103 bacteria/mL, while for silver stained 8% poliacrylamide gel it was 105 bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Antecedentes: La carne es un alimento altamente nutritivo y un componente principal de la canasta básica familiar. Los consumidores seleccionan alimentos no solo por su gusto y satisfacción, sino por sus efectos en la nutrición y en la salud humana. Además se conoce muy poco sobre la calidad de carne producida en los sistemas colombianos y su contenido de ácidos grasos. Objetivo: Determinar el contenido y la composición de ácidos grasos en carne de bovinos cebados en distintos sistemas de producción colombianos. Métodos: Se obtuvieron lomos (Longissimus dorsi) de bovinos Cebú provenientes de cuatro sistemas de producción del trópico colombiano: Dos arreglos silvopastoriles (Centro Experimental Cotové, Universidad Nacional de Colombia y Montenegro, Quindío), una pradera mejorada (Montenegro, Quindío) y un sistema de pastoreo tradicional (Montería, Córdoba). Se extrajo grasa de 64 muestras de carne (dos por lomo) en el laboratorio de Química Analítica de la Universidad Nacional de Colombia, en la que se realizó un análisis cuantitativo de ácidos grasos por cromatografía de gases en el laboratorio de Análisis Instrumental de la Universidad Nacional de Colombia, sede Medellín. Los resultados se evaluaron siguiendo un diseño completamente al azar y la separación de medias se realizó por Duncan. Resultados: Hubo diferencias significativas en el contenido de ácido mirístico y palmítico entre el sistema tradicional y la pastura mejorada, siendo ambos mayores en el sistema tradicional. Hubo diferencias significativas en el contenido de ácidos insaturados, siendo el sistema silvopastoril del Quindío y la pradera mejorada, los de mayor relación de ácidos grasos polisaturados: insaturados (0,19). En la relación linoleico: α-linolénico no hubo diferencias entre los sistemas. Conclusión: La composición y el contenido de ácidos grasos variaron en la carne de los sistemas evaluados. Los principales componentes de la grasa fueron el ácido palmítico y el ácido oleico (30,73 y 35, 62 g/100 g de ácidos grasos).

Objetivo: La resistencia a los fármacos antituberculosis es de gran interés en salud pública. La coinfección con virus de la inmunodeficiencia humana (VIH) ha cambiado el comportamiento de dicha enfermedad. El objetivo de nuestro estudio es determinar la prevalencia de la resistencia a fármacos antituberculosis en pacientes coinfectados con tuberculosis (TB)/VIH. Método: Se realizó un estudio retrospectivo a partir de la revisión de los registros clínicos de casos nuevos y fracasos de TB coinfectados con VIH que consultaron a un centro de atención de nivel IV desde 2007 a 2010 y que contaban con pruebas de susceptibilidad. Resultados: Un 52% de los pacientes procedían de Santiago de Cali, y un 8%, de Buenaventura. La TB se presentó de forma extrapulmonar en el 80% de los pacientes. Del 48% de los sujetos que conocían su estado VIH previo al diagnóstico de la TB, el 40% estaban en terapia antirretroviral. El 16% de los casos eran fracasos, entre los cuales se detectó un caso multidrogorresistente. De los casos nuevos, se encontró monorresistencia a la isoniazida del 14%, y una resistencia total del 28%. Conclusiones: Se encontró una mayor prevalencia de resistencia a la esperada en población coinfectada TB/VIH; por lo que es necesario fortalecer el trabajo en equipo entre las entidades públicas y privadas para controlar dicha situación y fomentar el diagnóstico temprano y la realización de pruebas de susceptibilidad a fármacos antituberculosis.Background: Resistance to anti-tuberculosis treatment is a matter of great interest in terms of public health. TB/HIV coinfection changed what was previously known about TB. Our study attempts to determine the prevalence of resistance to TB drugs among a local TB/HIV population. Methods: A retrospective study was conducted, which consisted of a review of the clinical records of new and relapsing cases of TB/HIV coinfected patients, with drug susceptibility tests, who attended an advanced medical care centre in Cali, Colombia, between 2007 and 2010. Results: Just over half (52%) of the patients were native from Cali, and 8% were from Buenaventura. An extra-pulmonary presentation of TB was seen in 80% of the subjects. Almost half (48%) were HIV positive before the diagnosis of tuberculosis was made, 40% of whom were on HAART treatment. Of the total cases, 16% were relapses, including one case of multi-drug resistant (MDR)-TB. Among the new cases, 14% were resistant to isoniazid only, making a total of 28% being resistant to this. Conclusions: There was a higher than expected prevalence of resistance in TB/HIV patients. There is an urgent need to improve the team work between public health organizations and private medical institutions, and this cooperation hould be of great priority, as it is a means to control and promote early diagnosis with drug-susceptibility tests.

Human papillomavirus (HPV) is associated with a wide spectrum of lesions in humans, and it has been linked to oral carcinogenesis. The aim of this study was to investigate the presence of HPV DNA in patients with lip squamous cell carcinoma and to correlate it with clinical characteristics and risk factors. We studied 33 patients with lip squamous cell carcinomas. Of these, 30 were positive for human beta globin gene and tested for HPV DNA, using polymerase chain reaction in two steps (PCR and nPCR) with MY11/MY09 and GP5+/GP6+ primers. HPV DNA was detected in 43.33% of patients analyzed. There was no association with the risk factors analyzed.O papilomavírus humano (HPV) está associado a um largo espectro de lesões em humanos e tem sido ligado à carcinogênese oral. O objetivo deste estudo foi investigar a presença do DNA do HPV em pacientes com carcinoma espinocelular de lábio e correlacioná-la com aspectos clínicos e fatores de risco. Foram estudados 33 pacientes com carcinoma espinocelular de lábio. Destes, 30 pacientes foram positivos para o gene da beta-globina humana e então foram testados para o DNA do HPV com uso da reação em cadeia de polimerase em duas etapas (PCR e nPCR) com os oligonucleotídeos iniciadores MY11/MY09 e GP5+/ GP6+. O DNA do HPV foi detectado em 43,33% dos 30 pacientes analisados. Não houve associação com os fatores de risco analisados.

O objetivo deste estudo foi analisar as propriedades psicométricas da versão em português brasileiro da escala de socialização parental ESPA29 (Musitu & García, 2001). Esta escala permite medir os estilos de socialização parental - autoritativo, autoritário, indulgente e negligente - através de duas dimensões independentes da conduta parental, extraídas do uso que os pais fazem das distintas práticas de socialização. Utilizando uma amostra de 2105 adolescentes brasileiros, com idades entre os 10 e os 18 anos, replicou-se a estrutura de dois fatores - Aceitação/Implicação e Severidade/Imposição - que compõem a escala, mediante a análise fatorial exploratória. Para completar o estudo de replicabilidade, levou-se a cabo a análise da estrutura ortogonal de Procusto, comprovando-se que a estrutura era invariante para o pai e para a mãe.The objective of this study was to analyze the psychometric properties of the Brazilian version of the ESPA29 Parental Socialization Scale (Musitu & García, 2001). This scale allows measuring parental styles - authoritative, authoritarian, indulgent, and negligent - by means of two independent dimensions of parental conduct extracted from parents' use of different socialization practices. Using a sample of 2.105 Brazilian adolescents from 10 to 18 years old, the structure of two factors that define the scale - Acceptance/Implication and Strictness/Imposition - has been replicated using an exploratory factorial analysis. In order to complete a proper replication of the ESPA29 scale structure, the analysis of the orthogonal structure of Procrustes was carried out proving that the structure was invariant for the father as well as for the mother.

Introdução: Recentemente o papilomavírus humano (HPV) tem sido associado à carcinogênese oral. A metodologia empregada na detecção do vírus é uma das maiores causas observadas da grande variabilidade nas taxas de detecção do HPV. Objetivo: Este estudo comparou a sensibilidade de detecção do DNA do HPV em casos de carcinoma epidermoide de lábio utilizando a amplificação do DNA viral por reação em cadeia da polimerase (PCR) ou nPCR. Material e método: Foram utilizadas 33 amostras provenientes de casos de carcinoma epidermoide de lábio. Para as extrações do DNA utilizou-se o sistema QIAamp DNA Mini Kit. Como controle interno utilizou-se o gene da b-globina. Das 33 amostras iniciais, 30 foram positivas para o gene b-globina, sendo utilizadas para detectar o DNA viral. Comparou-se a amplificação do DNA viral pelos métodos da PCR com os oligonucleotídeos MY09/MY11 e nPCR, empregando-se os pares de oligonucleotídeos iniciadores MY09/MY11 e, na segunda etapa, o par GP5+/GP6+. O controle positivo para a presença do DNA do HPV utilizado foi a linhagem de células HeLa e, como controle negativo, a mistura de amplificação sem DNA. A análise dos produtos de PCR e nPCR para HPV foi realizada por eletroforese em gel de poliacrilamida a 8%. Resultados: Utilizando-se o método da PCR, a amplificação do DNA do HPV foi constatada em dois casos. Com a nPCR foi verificada presença de DNA viral em 13 das 30 amostras. Conclusão: Com a utilização da nPCR, a detecção do HPV nos casos estudados aumentou mais de seis vezes.Introduction: Human papillomavirus (HPV) has been currently associated with oral carcinogesis. The methodology applied in virus detection is one of the main reasons for the great variability observed in HPV detection. Objectives: This study compared HPV DNA detection efficiency in lip squamous cell carcinoma samples (SCC) using viral DNA amplification by PCR or nPCR. Methods: Thirty three samples of lip squamous cell carcinoma were selected. DNA extractions were performed with QIAamp DNA minikit. The internal control was b-globin gene. Thirty out of 33 initial samples were positive for b-globin gene, which were employed to detect viral DNA. The amplification of viral DNA was compared by PCR method through MY09/MY11 oligonucleotides and nPCR through MY09/MY11 oligonucleotides in the first stage and GP5+/GP6+ in the second stage. HeLa cells were used as positive control for HPV DNA presence and the amplification mixture without DNA as negative control. The analysis of PCR and nPCR products for HPV DNA was performed through gel electrophoresis in polyacrylamide at 8%. Results: HPV DNA amplification was verified in two cases by the use of PCR method. HPV DNA presence was verified in 13 out of 30 samples by the use of nPCR. Conclusion: HPV DNA detection of lip SCC increased sixfold in the studied cases with the employment of nPCR.

O objetivo deste trabalho foi avaliar o efeito do polimorfismo genético da beta-lactoglobulina, da raça e da sazonalidade sobre as características físico-químicas e estabilidade do leite bovino. Foram selecionados 5 rebanhos da raça Holandesa e 6 da Girolando. Amostras de leite e sangue foram coletadas de 660 vacas Holandesas e 293 Girolandos, num total de 953 amostras, obtidas em duas coletas na estação seca e duas na estação chuvosa. As amostras de leite foram submetidas à análise de acidez titulável, pH, crioscopia, e ao teste de estabilidade ao etanol (70, 76, 80 e 84ºGL). As amostras de sangue foram submetidas à reação em cadeia de polimerase, para determinação do polimorfismo da beta-lactoglobulina em ambas as raças estudadas. Não houve efeito do polimorfismo da beta-lactoglobulina sobre as características físico-químicas do leite. Observou-se efeito de raça (Holandesa e Girolando, respectivamente) sobre a acidez titulável (16,16 e 17,07°D), e da sazonalidade (estações chuvosa e seca, respectivamente) sobre a crioscopia (-0,5411 e -0,5376°H). Nas condições do estudo, observou-se efeito de raça e sazonalidade sobre a estabilidade do leite, com maior instabilidade do leite de Girolando, durante a estação seca. Não houve efeito do polimorfismo da beta-lactoglobulina sobre essa característica.The objective of this study was to evaluate the effect of beta-lactoglobulin polymorphism, breed and seasonality on physico-chemical characteristics and stability of bovine milk. Six Holstein-Zebu (H-Z) and five Holstein dairy herds were selected, of which 660 Holstein and 293 crossbred Holstein-Zebu milk and blood samples were collected, adding up 953 samples, distributed in two collecting periods at rainy and two at dry seasons. Each milk sample was analyzed for titratable acidity, pH, freezing point and milk ethanol stability, at the following ethanol concentrations: 70, 76, 80 and 84ºGL. Individual blood samples were submitted to polymerase chain reaction (PCR) for the determination of beta-lactoglobulin polymorphism. No effect of beta-lactoglobulin polymorphism was observed in physico-chemical characteristics of milk, in both studied breed. Breed effect for Holstein and H-Z, respectively, was observed on titratable acidity (16.16 and 17.07°D, while effect of seasonality (for rainy and dry seasons, respectively) was also observed on freezing point (-0.5411 and -0.5376°H). Effects of breed and seasonality on milk stability were observed (Holstein-Zebu milk was less stable on dry season), however, no effect of beta-lactoglobulin on milk stability was observed.

INTRODUÇÃO: Diversos métodos para extração de DNA a partir de tecidos biológicos inclusos em parafina encontram-se descritos na literatura, sendo o sucesso desse procedimento de grande importância para a realização de métodos moleculares de diagnóstico empregando a reação em cadeia da polimerase (PCR). OBJETIVO: Este estudo avaliou dois métodos de extração de DNA de material parafinado, visando à amplificação do DNA genômico pela técnica da PCR. MATERIAL E MÉTODO: Foram utilizadas 35 amostras de casos de carcinoma epidermóide de assoalho bucal diagnosticados e tratados no Centro de Oncologia Bucal da Universidade Estadual Paulista (Unesp). Os métodos de extração de DNA avaliados incluíram: 1. digestão com proteinase K seguida por purificação com Chelex 100® (BioRad); e 2. sistema QIAamp DNA minikit® (Qiagen). O DNA obtido foi quantificado por espectrofotometria e amplificado pela técnica da PCR, utilizando-se oligonucleotídeos iniciadores para betaglobina. RESULTADOS: A concentração de DNA obtido do material extraído com o primeiro método apresentou média de 120,62 ng/µl com razão entre as leituras das absorbâncias 260/280 variando de 0,8 a 1,41. Para as amostras extraídas com o segundo procedimento, o rendimento médio foi de 67,38 ng/µl, no entanto a razão 260/280 variou entre 1,11 e 2,53. O material foi submetido à PCR e, das 35 amostras extraídas com cada método, respectivamente, 29 e 30 apresentaram sinal positivo. CONCLUSÃO: Os dois métodos utilizados para obtenção de DNA de material parafinado apresentaram desempenho semelhante, revelando que ambos têm potencial para auxiliar na prática da biologia molecular diagnóstica, assim como no estudo diagnóstico retrospectivo em material parafinizado.BACKGROUND: There are several methods for DNA extraction from formalin-fixed paraffin-embedded tissues reported in the literature. High success rate on this procedure is important for the use of molecular diagnostic methods based on the polymerase chain reaction (PCR). OBJECTIVE: Two methods of DNA extraction from paraffin-embedded samples were tested aiming at PCR amplification of genomic DNA. MATERIAL AND METHOD: Thirty-five samples were obtained from patients with squamous cell carcinoma of mouth floor treated at the Oral Oncology Center in Universidade Estadual Paulista. The DNA extraction methods included: 1. proteinase K digestion followed by Chelex 100® (BioRad) purification and 2. QIAamp DNA minikit® system (Qiagen). Purified DNA was quantified by spectrophometry and a beta-globin gene fragment was amplified using PCR. RESULTS: The DNA concentration from samples applied to the first method presented an average of 120.62 ng/µl and absorbance ratio 260/280 varying between 0.8 and 1.41. From the samples extracted using the second procedure, the mean DNA concentration was 67.38 ng/µl, with absorbance ratio varying between 1.11 and 2.53. DNA samples were submitted to PCR and from 35 samples extracted with both methods, respectively, 29 and 30 were successfully amplified for the beta-globin gene. CONCLUSION: Both methods used to obtain genomic DNA from formalin-fixed paraffin-embedded tissues presented similar performance, revealing their potential to be included in diagnosis of molecular biology, as well as in retrospective studies using archived paraffin-embedded samples.

Globalization promotes dynamic expansion in postmodern culture, thus new axiological parameters. The advent of globalization to Tlaxcala, traditionalist society hyper-identitary, takes it by surprise and causes some changes for which it was not prepared; impacts its fundamental structures: political, social, communicative, religious and causes cracks in the interactions, for example, in families forged from vintage times. Whole picture can be presented as changes in the classic schemes construction of subjectivities, status, roles, values, motivations, are being corrupted, new types appear, from the techno-hermit locked in the walls of a bedroom connected to the communicational gadgetry, to virtual hypersocial passing day ever palpated connected beings. And all this while, in the same house, adults try to stanch old links.

We used four microsatellite loci (Fca08, Fca45, Fca77 and Fca96) from the domestic cat, Felis catus, to investigate genetic variability in specimens of Herpailurus yagouaroundi (jaguarundi, otter cat, eyra), Puma concolor (cougar, mountain lion, puma) and Panthera onca (jaguar) held in various Brazilian zoos. Samples of DNA from the cats were PCR amplified and then sequenced before being analyzed using the CERVUS program. Our results show a mean polymorphic information content (PIC) of 0.83 for H. yagouaroundi, 0.66 for P. concolor and 0.69 for P. onca and a mean of 10.3 alleles for the Fca08 locus, 5.3 for Fca 45, 9 for Fca 77 and 14 for Fca 96. These results indicate a relatively high level of genetic diversity for the specimens studied.

The main goal of our research was to search for SSRs in the Eucalyptus EST FORESTs database (using a software for mining SSR-motifs). With this objective, we created a database for cataloging Eucalyptus EST-derived SSRs, and developed a bioinformatics tool, named Satellyptus, for finding and analyzing microsatellites in the Eucalyptus EST database. The search for microsatellites in the FORESTs database containing 71,115 Eucalyptus EST sequences (52.09 Mb) revealed 20,530 SSRs in 15,621 ESTs. The SSR abundance detected on the Eucalyptus ESTs database (29% or one microsatellite every four sequences) is considered very high for plants. Amongst the categories of SSR motifs, the dimeric (37%) and trimeric ones (33%) predominated. The AG/CT motif was the most frequent (35.15%) followed by the trimeric CCG/CGG (12.81%). From a random sample of 1,217 sequences, 343 microsatellites in 265 SSR-containing sequences were identified. Approximately 48% of these ESTs containing microsatellites were homologous to proteins with known biological function. Most of the microsatellites detected in Eucalyptus ESTs were positioned at either the 5’ or 3’ end. Our next priority involves the design of flanking primers for codominant SSR loci, which could lead to the development of a set of microsatellite-based markers suitable for marker-assisted Eucalyptus breeding programs.

The reproductive performance of bulls has a high impact on the beef cattle industry. Scrotal circumference (SC) is the most recorded reproductive trait in beef herds, and is used as a major selection criterion to improve precocity and fertility. The characterization of genomic regions affecting SC can contribute to the identification of diagnostic markers for reproductive performance and uncover molecular mechanisms underlying complex aspects of bovine reproductive biology. In this paper, we report a genome-wide scan for chromosome segments explaining differences in SC, using data of 861 Nellore bulls (Bos indicus) genotyped for over 777,000 single nucleotide polymorphisms. Loci that excel from the genome background were identified on chromosomes 4, 6, 7, 10, 14, 18 and 21. The majority of these regions were previously found to be associated with reproductive and body size traits in cattle. The signal on chromosome 14 replicates the pleiotropic quantitative trait locus encompassing PLAG1 that affects male fertility in cattle and stature in several species. Based on intensive literature mining, SP4, MAGEL2, SH3RF2, PDE5A and SNAI2 are proposed as novel candidate genes for SC, as they affect growth and testicular size in other animal models. These findings contribute to linking reproductive phenotypes to gene functions, and may offer new insights on the molecular biology of male fertility.

Robust detection of prostatic cancer is a challenge due to the multitude of variants and their representation in MR images. We propose a pattern recognition system with an incremental learning ensemble algorithm using support vector machines (SVM) tackling this problem employing multimodal MR images and a texture-based information strategy. The proposed system integrates anatomic, texture, and functional features. The data set was preprocessed using B-Spline interpolation, bias field correction and intensity standardization. First- and second-order angular independent statistical approaches and rotation invariant local phase quantization (RI-LPQ) were utilized to quantify texture information. An incremental learning ensemble SVM was implemented to suit working conditions in medical applications and to improve effectiveness and robustness of the system. The probability estimation of cancer structures was calculated using SVM and the corresponding optimization was carried out with a heuristic method together with a 3-fold cross-validation methodology. We achieved an average sensitivity of 0.844 ± 0.068 and a specificity of 0.780 ± 0.038, which yielded superior or similar performance to current state of the art using a total database of only 41 slices from twelve patients with histological confirmed information, including cancerous, unhealthy non-cancerous and healthy prostate tissue. Our results show the feasibility of an ensemble SVM being able to learn additional information from new data while preserving previously acquired knowledge and preventing unlearning. The use of texture descriptors provides more salient discriminative patterns than the functional information used. Furthermore, the system improves selection of information, efficiency and robustness of the classification. The generated probability map enables radiologists to have a lower variability in diagnosis, decrease false negative rates and reduce the time to recognize and delineate structures in the prostate.

As the methodologies available for the detection of positive selection from genomic data vary in terms of assumptions and execution, weak correlations are expected among them. However, if there is any given signal that is consistently supported across different methodologies, it is strong evidence that the locus has been under past selection. In this paper, a straightforward frequentist approach based on the Stouffer Method to combine P-values across different tests for evidence of recent positive selection in common variations, as well as strategies for extracting biological information from the detected signals, were described and applied to high density single nucleotide polymorphism (SNP) data generated from dairy and beef cattle (taurine and indicine). The ancestral Bovinae allele state of over 440,000 SNP is also reported. Using this combination of methods, highly significant (P

Este estudo pretendeu avaliar o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Leptospira pomona em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com Leptospira pomona em escalas que variavam de 10(0) a 10(7) bactérias/ml e submetidas à extração de DNA pelo método de fenol/clorofórmio. Após a reação de PCR, a visualização dos fragmentos foi realizada em três tipos de eletroforese: agarose 2% sob luz UV, acrilamida 8% corado com prata e eletroforese capilar fluorescente. A detecção de DNA de Leptospira pomona em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10² bactérias/ml. Nos métodos de eletroforese em agarose 2%, observou-se limite de detecção de 10(4) bactérias/ml e em gel de poliacrilamida 8% o limite de detecção foi de 10² bactérias/ml. A eletroforese capilar demonstrou ser uma alternativa eficaz e rápida na detecção de DNA de Leptospira em sêmen bovino podendo ser uma valiosa ferramenta para controle de qualidade do sêmen produzido em centrais de inseminação artificial dada a facilidade de automação desse processo.

O aperfeiçoamento das técnicas que objetivam a exploração do potencial reprodutivo das fêmeas requer a compreensão mais ampla dos mecanismos de controle de desenvolvimento folicular. Uma alternativa de estudo nesta esfera, é a quantificação da expressão relativa de genes envolvidos nos processos de recrutamento, seleção e desenvolvimento folicular, pelo emprego da técnica de transcrição - reversa associado a reação em cadeia pela polimerase (RT - PCR). O presente trabalho objetivou quantificar a expressão relativa dos genes insulin-like growth factor I (IGF-I) e do receptor do hormônio folículo estimulante (FSHR), tendo como controle interno o gene da gliceraldeído 3-fosfato desidrogenase (GAPDH). Foram utilizados ovários bovinos de animais de matadouro em diferentes fases do ciclo estral. O RNA total dos folículos e tecido ovarianos foi purificado por TRIZOL. As reações de RT-PCR foram realizadas com o "kit" SuperScriptTM First-Strand. Os produtos de PCR foram analisados em gel de agarose e as bandas submetidas à análise densitométrica. Todos os genes foram amplificados observando-se a curva exponencial de amplificação, a validação do método foi realizada através de análise de regressão, sendo estabelecido o coeficiente de amplificação (E). A expressão relativa de mRNA para cada gene de interesse foi calculada pela fórmula estabelecida por Prelle et al.12. Em todos os tecidos analisados, todos os genes foram expressos, sobressaltando-se diferenças nos diferentes ciclos estudados. Com relação os dados referentes ao coeficiente de amplificação (E), observou-se tanto para gene controle (GAPDH), como para o gene IGF-I concordância nos valores encontrados para as diferentes classes analisadas. Quanto ao gene IGF-I, a interpretação dos achados para a expressão relativa de mRNA pode está relacionada ao caráter constitutivo dessa proteína ou devido os transcritos não serem dependentes dos níveis de FSH. Observou-se diferenças na expressão relativa de mRNA de FSHR entre as classes de tecidos analisados, o que pode ser explicado pela variação do número de receptores nas células da granulosa nas diferentes fases do ciclo estral. Pode-se perceber a partir desse estudo que a técnica de RT-PCR semi quantitativo é de grande importância biotecnológica, possibilitando auxílio na compreensão da dinâmica folicular. Entretanto esses estudos devem ser ampliados com outros genes para melhor compreensão das etapas fisiológicas envolvidas na foliculogênese.

Os efeitos das temperaturas de imersão em nitrogênio líquido e dos métodos de remoção dos crioprotetores foram avaliados em mórulas de camundongos congeladas em etilenoglicol (E), propilenoglicol (P) e glicerol (G). Os embriões foram equilibrados em E (1,5M), P (1,5M) ou G (1,4M) por 10 minutos e envasados em palhetas de 0,25 ml com crioprotetor nas três colunas (E1, P1 G1) ou PBS nas colunas das extremidades (E2, P2). As palhetas foram resfriadas a 0,5ºC/minuto até -25 ou -30ºC e imersas em nitrogênio líquido. A descongelação dos embriões foi feita em água a 22ºC por 20 segundos. O crioprotetor dos embriões congelados em glicerol (Gl) foi removido em 3 etapas, dos congelados em etilenoglicol e propilenoglicol com crioprotetor nas 3 colunas (El e Pl) removido diretamente em PBS e dos congelados em etilenoglicol e propilenoglicol com PBS nas colunas das extremidades (E2, P2), após mistura das três colunas dentro da palheta, em PBS. Não houve influência da temperatura de imersão sobre o desenvolvimento embrionário in vitro, observando maior taxa (p < 0,0001) para El (69,2%) que para E2 (60,3%), Gl (51,9%) e a combinação P1 e P2 (46,9%). Para o desenvolvimento in vivo, a taxa de fetos foi menor (p < 0,07) para o grupo E1-25 do que para o Controle; Gl-30ºC; El-30ºC e E2-25ºC. Pode-se concluir que in vitro o melhor crioprotetor foi o etilenoglicol com remoção direta em PBS e que in vivo o etilenoglicol e o glicerol foram semelhantes a -30ºC.

Embriões de camundongos foram congelados em 10% de glicerol adicionado de várias concentrações de sacarose e/ou 0,1% de geléia real, nas velocidades de 0,3ºC ou 0,5ºC/minuto até -24ºC ou -32ºC e descongelados em água a 22ºC durante 20 segundos. A diluição dos crioprotetores foi realizada em três etapas e o cultivo dos embriões no meio de Whitten em estufa com 5% de CO2, 100% de umidade e 37ºC por 72 horas. O desenvolvimento in vitro até blastocisto variou entre 56,6% e 93,4%, mostrando que 10% de sacarose + 10% de glicerol foi eficiente na congelação. Blastocistos expandidos oriundos de embriões congelados até -24 ou -32ºC à velocidade de 0,3ºC/minuto em soluções contendo 10% de glicerol + 10% de sacarose; 10% de glicerol + 10% de sacarose + 0,1% de geléia real; 10% de glicerol + 0,1% de geléia real ou 10% de glicerol, transferidos para receptoras pseudoprenhes, apresentaram, respectivamente, taxas de fetos viáveis de 28,1% e 13,6%, 48,7% e 31,9%, 28,6% e 13,2%, 20,0% e 42,4%. Embriões congelados até -24ºC ou -32ºC a 0,5ºC/minuto nas soluções de 10% de glicerol + 10% de sacarose ou 10% de glicerol + 10% de sacarose + 0,1% de geléia real apresentaram, respectivamente, taxas de fetos viáveis de 29,0% e 15,3%, 48,8% e 32,0%. Adição de sacarose e de geléia real ao meio de congelação contendo 10% de glicerol proporcionou maiores taxas de fetos viáveis a 0,3ºC e 0,5ºC/minuto e imersão em nitrogênio líquido a -24ºC.

Considerando a importância do sêmen na transmissão da leptospira bovina, foi realizado o presente estudo que teve como objetivo aplicar a reação em cadeia pela polimerase (PCR) para a detecção de leptospiras em sêmen bovino experimentalmente contaminado. A reação de PCR foi capaz de amplificar um fragmento de DNA específico de 330 pares de bases a partir de cultivos puros de 26 sorovares de Leptospira spp. A contaminação experimental de sêmen com Leptospira interrogans serovar hardjo revelou que a técnica de PCR conseguiu detectar 10 bactérias/ml, concentração sensivelmente mais baixa que as 1.000 bactérias/ml detectadas através do cultivo microbiológico. Os resultados observados revelam o grande potencial da reação de PCR para a detecção de Leptospira spp. em sêmen bovino, notadamente em centrais de inseminação artificial.

Analisaram-se 10 bovinos da raça Holandesa, descendentes da linhagem Ivanhoe. Submeteram-se os DNAs, purificados a partir de leucócitos destes animais, à técnica de Polymerase Chain Reaction (PCR) e posterior digestão com as enzimas de restrição Hae III e Taq I. Estabeleceu-se, desta maneira, o diagnóstico genômico da Deficiência de Adesão de Leucócitos Bovinos (BLAD). Os exames revelaram que 2 animais eram portadores e 8, normais. A partir do desenvolvimento da metodologia de PCR, tornou-se disponível um método rápido, prático e eficiente para a seleção de touros em Centrais de Inseminação Artificial, por meio da detecção de animais portadores e normais.

Analisaram-se 12 eqüinos da raça Quarto de Milha, descendentes da linhagem Impressive. Submeteram-se os DNAs, purificados a partir de leucócitos destes animais, à técnica de Polymerase Chain Reaction (PCR) e posterior digestão com a enzima de restrição Taq I. Estabeleceu-se, dessa maneira, o diagnóstico genômico da Paralisia Hipercalêmica Periódica (HYPP). Os exames revelaram que 9 animais eram portadores heterozigotos (N/H) e 3, normais homozigotos (N/N). A partir do desenvolvimento da metodologia de PCR tornou-se possível diagnosticar o problema e propor maneiras de controle do alastramento desse gene defectivo na população por meio da detecção de animais portadores e normais.

Antecedentes: La carne es un alimento altamente nutritivo y un componente principal de la canasta básica familiar. Los consumidores seleccionan alimentos no solo por su gusto y satisfacción, sino por sus efectos en la nutrición y en la salud humana. Además se conoce muy poco sobre la calidad de carne producida en los sistemas colombianos y su contenido de ácidos grasos. Objetivos: Determinar el contenido y la composición de ácidos grasos en carne de bovinos cebados en distintos sistemas de producción colombianos. Métodos: Se obtuvieron lomos (Longissimus dorsi) de bovinos Cebú provenientes de cuatro sistemas de producción del trópico colombiano: Dos arreglos silvopastoriles (Centro Experimental Cotové, Universidad Nacional de Colombia y Montenegro, Quindío), una pradera mejorada (Montenegro, Quindío) y un sistema de pastoreo tradicional (Montería, Córdoba). Se extrajo grasa de 64 muestras de carne (dos por lomo) en el laboratorio de Química Analítica de la Universidad Nacional de Colombia, en la que se realizó un análisis cuantitativo de ácidos grasos por cromatografía de gases en el laboratorio de Análisis Instrumental de la Universidad Nacional de Colombia, sede Medellín. Los resultados se evaluaron siguiendo un diseño completamente al azar y la separación de medias se realizó por Duncan. Resultados: Hubo diferencias significativas en el contenido de ácido mirístico y palmítico entre el sistema tradicional y la pastura mejorada, siendo ambos mayores en el sistema tradicional. Hubo diferencias significativas en el contenido de ácidos insaturados, siendo el sistema silvopastoril del Quindío y la pradera mejorada, los de mayor relación de ácidos grasos polisaturados: insaturados (0,19). En la relación linoleico: α-linolénico no hubo diferencias entre los sistemas. Conclusiones: La composición y el contenido de ácidos grasos variaron en la carne de los sistemas evaluados. Los principales componentes de la grasa fueron el ácido palmítico y el ácido oleico (30,73 y 35, 62 g/100 g de ácidos grasos).

Resumen Se presenta el caso de un paciente de 71 años, quien desarrolló cefalea en 2 ocasiones relacionada con la exposición a amoxicilina. Se documentó mediante punción lumbar una inflamación linfocítica con cultivos negativos; por tanto, se enfocó como meningitis aséptica y en el contexto clínico de posible origen medicamentoso. Este se ha considerado un diagnóstico de exclusión. Los hallazgos a nivel del líquido cefalorraquídeo son variables; los síntomas y signos de irritación meníngea son menos predominantes. Es importante tener presente este diagnóstico diferencial al haber descartado otras etiologías. Suspender el medicamento sospechoso y realizar un seguimiento estricto del paciente puede evitar que sea abordado mediante procedimientos diagnósticos y tratamientos infructuosos y, en algunos casos, perjudiciales. Dado que es un medicamento de uso frecuente y para múltiples indicaciones, es importante tener presente este efecto colateral.

ABSTRACT Introduction: Studies conducted during the last years, using new technologies for viral detection, permit to consider human papillomavirus (HPV) an etiologic factor for cervical cancer. Besides the relation to genital regions, other anatomic sites have been associated with HPV, including head and neck regions. Objectives: To investigate the prevalence of HPV infection in 35 samples from paraffin-embedded tissues using polymerase chain reaction (PCR)-deoxyribonucleic acid (DNA) amplification, and correlate it with demographic, clinical, and morphological factors and prognosis. Materials and methods: All samples were first amplified with human β-globin gene primers. Samples with positive amplification were subjected to HPV-DNA detection with general GP5 and GP6 primers. Results Only 30 samples were amplified for the β-globin gene. No floor of mouth squamous cell carcinoma cases showed amplification of HPV DNA. Discussion: The absence of HPV-DNA amplification does not suggest that this virus is absent from the process of oral carcinogenesis, since the selected sample is not in the risk group for the development of oral cancer associated with HPV infection. Conclusions: No correlation was found between HPV infection and floor of mouth carcinogenesis, however further studies are necessary.

Las críticas efectuadas a la llamada teoría crítico-reproductivista de la educación formal, en sus distintas versiones, han puesto de manifiesto las dificultades de esa teoría para explicar la complejidad de la realidad escolar. Se ha señalado con razón que no deja espacio para las contradicciones y conflictos, poniendo énfasis exclusivamente en su eficacia como medio de imposición ideológica223. No obstante estas y otras pertinentes observaciones sobre los límites de la teoría reproductivista de la educación, no se ha formulado una teoría alternativa. En ese sentido es ejemplar el trabajo de D. Saviani224 que constituyendo un excelente análisis de las dificultades que afrontan las distintas teorías de la escuela, termina reconociendo lo poco que se ha avanzado en la construcción de una concepción que supere la disyuntiva ilusión (que caracteriza a las teorías no críticas) —impotencia (derivada de las teorías crítico-reproductivistas).