Search

Insufficient invasion of trophoblast cells is one of the important causes of preeclampsia (PE). Circular RNA (circRNA) has been proven to regulate the biological functions of trophoblast cells and mediate the progression of PE. The expression of circ_0085296, microRNA (miR)-942-5p, and thrombospondin 2 (THBS2) was detected by quantitative real-time PCR. In addition, the interaction between miR-942-5p and circ_0085296 or THBS2 was confirmed by dual-luciferase reporter assay and RIP assay. Our data showed that circ_0085296 was upregulated in the placental tissues of PE patients. Silenced circ_0085296 could enhance the proliferation, migration, invasion, and angiogenesis of HTR-8/SVneo cells. Besides, circ_0085296 was found to act as miR-942-5p sponge. Function analysis results suggested that miR-942-5p inhibitor reversed the positive regulation of circ_0085296 knockdown on the biological functions of HTR-8/SVneo cells. Moreover, THBS2 was a target of miR-942-5p, and its overexpression also reversed the promotion effect of miR-942-5p on the proliferation, migration, invasion, and angiogenesis of HTR-8/SVneo cells. Also, circ_0085296 was discovered to positively regulate THBS2 by sponging miR-942-5p. To sum up, our results revealed that circ_0085296 could inhibit trophoblast cells proliferation, migration, invasion, and angiogenesis by regulating miR-942-5p/THBS2, confirming that circ_0085296 might be a potential therapeutic target for PE.

Sponge gourd (Luffa cylindrica) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes (Rotylenchulus) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 μm (352.8 to 436.7 μm), stylet = 18.6 ± 0.5 μm (17.6 to 19.4 μm), tail length= 25.9 ± 2.2 μm (20.1 to 29.9 μm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 μm (368.1 to 463.9 μm), stylet = 12.8 ± 0.8 μm (11.2 to 14.1 μm), tail length= 26.3 ± 1.8 μm (24.3 to 29.4 μm), spicule = 20.6 ± 0.9 μm (19.6 to 22.7 μm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for R. reniformis (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) and D2-D3 region of the 28S rRNA gene sequence (787 bp, MT328542) showed more than 99% identity with several R. reniformis sequences deposited in the GenBank database (e.g., MT209977, KP018557, GU003947; KJ755184, MT225542, HM131858). In greenhouse pathogenicity tests, 12 two-leaf stage sponge gourd seedlings (cv. Zaoxiu 6) maintained in 14-cm-diameter and 12-cm-height pots with sterilized commercial soil (pH 5.5-7.0; organic matter 35%), were inoculated with 500 mixed vermiform stage nematodes of R. reniformis extracted from the infested field soil samples per plant. Eight non-inoculated seedlings were used as controls. After 60 days, all inoculated plants exhibited slight symptoms of root browning compared with the control. The nematode reproduction factor (final population/initial population) was 12.4. No nematodes and root browning were observed on control plants. R. reniformis has been reported on sponge gourd in Shanghai, Fujian, Guangdong, and Hainan provinces of China (Ding et al., 2015). To our knowledge, this is the first report of R. reniformis infecting sponge gourd in Yunnan Province, China. Yunnan Province is one of the biggest sponge gourd producing areas in China. Since R. reniformis is a highly pathogenic nematode and damages sponge gourd, control measures should be taken to avoid its spread to other regions or host crops in China.

Nesfatin-1 is a neuropeptide produced in the hypothalamus. It is known that Nesfatin-1 is involved in food uptake, fat storage, and other metabolic regulation. We hypothesized that Nesfatin-1 may play a role in cardiovascular tissue. Free fatty acids (FFAs) are known to be the risk factor for cardiovascular diseases. FFA-mediated endothelial dysfunction is the critical mechanism of many cardiovascular disorders. The present study explores the protective effects of Nesfatin-1 on FFA-induced endothelial inflammation and the underlying mechanism. We found that significantly increased lactate dehydrogenase release and production of inflammatory factors were observed in FFA-treated human aortic endothelial cells (HAECs), accompanied by the enhanced attachment of U937 monocytes to HAECs and upregulated cell adhesion molecule vascular cell adhesion molecule-1, which were dramatically reversed by the treatment with Nesfatin-1. In addition, the promoted level of nuclear regulator NF-κB p65 and transcriptional function of NF-κB in FFA-treated HAECs were greatly suppressed by HAECs. Growth Factor Independent 1 Transcriptional Repressor 1 (Gfi1), an important negative regulator of NF-κB activity, was significantly downregulated in HAECs by FFAs and was upregulated by Nesfatin-1. Lastly, the inhibitory effects of Nesfatin-1 against FFA-induced NF-κB activation and adhesion of U937 monocytes to HAECs were abolished by the knockdown of Gfi1. In conclusion, our data reveal that Nesfatin-1 inhibited FFA-induced endothelial inflammation mediated by the Gfi1/NF-κB signaling pathway.

Although running causes inevitable stress to the joints, data regarding its effect on the cartilage of the knee are conflicting. This systematic review and meta-analysis aimed to evaluate the effect of running on knee joint cartilage.PubMed, EMBASE, SportDiscus, and Cochrane Library databases were searched to identify randomized controlled trials (RCTs) and cohort studies. The outcome indicators were cartilage oligomeric matrix protein (COMP), cartilage volume and thickness, and T2.A total of two RCTs and 13 cohort studies were included. There was no significant difference in cartilage volume between the running and control groups (MD, -115.88 U/I; 95% CI, -320.03 to 88.27; p = 0.27). However, running would decrease cartilage thickness (MD, -0.09 mm; 95%CI, -0.18 to -0.01; p = 0.03) and T2 (MD, -2.78 ms; 95% CI, -4.12 to -1.45; p 0.001). Subgroup analysis demonstrated that COMP immediately or at 0.5 h after running was significantly increased, but there were no significant changes at 1 h or 2 h.Running has advantages in promoting nutrition penetrating into the cartilage as well as squeezing out the metabolic substance, such as water. Our study found that running had a short-term adverse effect on COMP and did not affect cartilage volume or thickness.