Search

Accurate determination of the inverse kinematics for the drilling arm of a drilling and anchoring robot is crucial in achieving automatic support in coal mine roadways. Addressing issues such as poor accuracy, limited real-time performance, and susceptibility to local optima, this study presents a novel approach for solving the inverse kinematics problem of an unconventional mechanical arm by combining Monte Carlo random sampling method and Newton iteration method. Initially, a kinematics model is established based on the structure of the drilling arm, and individual coordinate systems are defined for each joint to enable forward kinematics solutions. The Monte Carlo method is employed to determine the motion space of the drill boom. By subdividing the motion space into smaller cubes with a defined step size, a mapping relationship is established between the spatial coordinates of these cubes and the corresponding joint variable values. Using the transformation matrix associated with a given target space point, an index function is employed to identify the relevant small cubes. The points within these cubes, which are closest to the target space point, are calculated, and their corresponding joint variable values are used as initial values. The Newton iteration method is then introduced, utilizing the iterative formula for multivariate functions to determine the variation of each joint variable. The inverse kinematics solution for the unconventional manipulator is obtained through iterative cycles. The simulation results show that, compared with Newton-Raphson iterative method based on random initial values and the particle swarm optimization algorithm, the corresponding average angle error of the calculation results of this method is reduced by 64.98% and 57.34%, and the average time consumption is reduced by 35.90% and 22.33%, respectively, thereby enhancing solution accuracy and real-time performance. The feasibility and effectiveness of the proposed Monte Carlo and Newton iteration method for solving the inverse kinematics problem in unconventional manipulators are verified. Overall, this research provides evidence supporting the practicality and efficiency of the proposed Monte Carlo random sampling method and Newton iteration method for accurate inverse kinematics solutions in unconventional manipulators.

Aiming at the problems of low intelligence of current tunneling equipment, difficulty in describing over-excavation, under-excavation and abnormal collision in tunneling process, and difficulty in adapting traditional automatic cutting and memory cutting technology to complex geological conditions, a digital twin-driven virtual teaching memory cutting control method for cantilever roadheader is proposed. By analyzing the research situation of digital twin technology in the field of intelligent coal mining, the overall scheme of memory cutting control system of cantilever roadheader driven by digital twin is designed, and the key technology of memory cutting of cantilever roadheader under complex working conditions is studied. Firstly, the characteristics of digital twin and virtual reality technology are fully utilized to study the virtual teaching strategy under complex working conditions. Based on the Unity3D platform, the virtual twin model of the working face and equipment with the same size of the corresponding entity, the kinematics model of the cutting unit and the virtual collision detection model are established. The virtual model movement is controlled through the intelligent interactive interface at the virtual end, and the teaching trajectory is designed and optimized according to the worker’s experience, so that it can be used as the target expected trajectory of trajectory tracking to make up for the excessive dependence on the worker’s experience caused by the traditional underground manual teaching due to the harsh working conditions. Secondly, in order to improve the quality of section forming, the control method of teaching trajectory tracking and reproduction in memory automatic cutting stage is studied. The dynamic model of cutting part is established by Lagrange method, and the tracking control accuracy of end effector to teaching trajectory is improved by combining iterative learning with sliding mode control. Finally, the simulation control platform of the memory cutting of the cantilever roadheader is built. Through the real-time data transmission and interaction between the virtual space and the physical space and between the modules, the three-dimensional visual simulation of the memory cutting virtual teaching and trajectory tracking control process is completed in the virtual space, and then the memory automatic cutting trajectory tracking control command is generated and sent to the end effector of the physical entity of the cantilever roadheader to drive it to carry out the section forming cutting according to the teaching trajectory. At the same time, the physical sensor collects the pose data of the cantilever roadheader fuselage and the cutting arm, and reversely drives the virtual model to move synchronously. The closed-loop control of robot virtual model and physical entity is realized. On this basis, the virtual and real synchronization of the system, the motion consistency between the virtual prototype and the physical prototype, and the trajectory tracking and reproduction control accuracy are verified. The experimental results show that the system data transmission delay is low, which can ensure the virtual and real consistency and synchronization, and the trajectory tracking control accuracy meets the actual use requirements. This method provides a new idea for memory cutting and intelligent control of tunneling equipment.

Rock bolting is a commonly used method for stabilizing the surrounding rock in coal-mine roadways. It involves installing rock bolts after drilling, which penetrate unstable rock layers, binding loose rocks together, enhancing the stability of the surrounding rock, and controlling its deformation. Although recent progress in drilling and anchoring equipment has significantly enhanced the efficiency of roof support in coal mines and improved safety measures, how to deal with drilling rigs’ misalignment with the through-hole center remains a big issue, which may potentially compromise the quality of drilling and consequently affect the effectiveness of bolt support or even result in failure. To address this challenge, this article presents a robotic teleoperation system alongside a hybrid visual servo control strategy. Addressing the demand for high precision and efficiency in aligning the drilling rigs with the center of the drilling hole, a hybrid control strategy is introduced combining position-based and image-based visual servo control. The former facilitates an effective approach to the target area, while the latter ensures high-precision alignment with the center of the drilling hole. The robot teleoperation system employs the binocular vision measurement system to accurately determine the position and orientation of the drilling-hole center, which serves as the designated target position for the drilling rig. Leveraging the displacement and angle sensor information installed on each joint of the manipulator, the system utilizes the kinematic model of the manipulator to compute the spatial position of the end-effector. It dynamically adjusts the spatial pose of the end-effector in real time, aligning it with the target position relative to its current location. Additionally, it utilizes monocular vision information to fine-tune the movement speed and direction of the end-effector, ensuring rapid and precise alignment with the target drilling-hole center. Experimental results demonstrate that this method can control the maximum alignment error within 7 mm, significantly enhancing the alignment accuracy compared to manual control. Compared with the manual control method, the average error of this method is reduced by 41.2%, and the average duration is reduced by 4.3 s. This study paves a new path for high-precision drilling and anchoring of tunnel roofs, thereby improving the quality and efficiency of roof support while mitigating the challenges associated with significant errors and compromised safety during manual control processes.

Abstract The underground coal mine production of the fully mechanized mining face exists many problems, such as poor operating environment, high accident rate and so on. Recently, the intelligent autonomous coal mining is gradually replacing the traditional mining process. The artificial intelligence technology is an active research area and is expect to identify and warn the underground abnormal conditions for intelligent longwall mining. It is inseparable from the construction of datasets, but the downhole dataset is still blank at present. This work develops an image dataset of underground longwall mining face (DsLMF+), which consists of 138004 images with annotation 6 categories of mine personnel, hydraulic support guard plate, large coal, towline, miners’ behaviour and mine safety helmet. All the labels of dataset are publicly available in YOLO format and COCO format. The availability and accuracy of the datasets were reviewed by experts in coal mine field. The dataset is open access and aims to support further research and advancement of the intelligent identification and classification of abnormal conditions for underground mining.

The implementation of roof bolt support within a coal mine roadway has the capacity to bolster the stability of the encompassing rock strata and thereby mitigate the potential for accidents. To enhance the automation of support operations, this paper introduces a binocular vision positioning method for drilling holes, which relies on the adaptive adjustment of parameters. Through the establishment of a predictive model, the correlation between the radius of the target circular hole in the image and the shooting distance is ascertained. Based on the structural model of the anchor drilling robot and the related sensing data, the shooting distance range is defined. Exploiting the geometric constraints inherent to adjacent anchor holes, the precise identification of anchor holes is detected by a Hough transformer with an adaptive parameter-adjusted method. On this basis, the matching of the anchor hole contour is realized by using linear slope and geometric constraints, and the spatial coordinates of the anchor hole center in the camera coordinate system are determined based on the binocular vision positioning principle. The outcomes of the experiments reveal that the method attains a positioning accuracy of 95.2%, with an absolute error of around 1.52 mm. When compared with manual operation, this technique distinctly enhances drilling accuracy and augments support efficiency.

In view of the insufficient characteristics and depth acquisition difficulties encountered in the process of uniocular vision measurement, the posture measurement scheme of tunneling equipment based on uniocular vision was proposed in this study. The positioning process of coal mine tunneling equipment based on monocular vision was proposed to extract the environmental features and match the features, and the RANSAC algorithm was used to eliminate the pair of mismatching points. This was done to solve the optimized matching pair and realize the pose estimation of the camera. The pose solution model based on the triangulation depth calculation method was proposed, and the PNP solution method was adopted based on the three-dimensional spatial point coordinates so as to improve the visual measurement accuracy and stability and lay the foundation for the 3D reconstruction of the roadway. This was done to simulate the downhole environment to build an experimental verification platform for monocular visual positioning. The experimental results showed that the position measurement accuracy of the uniocular visual roadheader positioning method within 60 mm and 1.3° could realize the accurate registration of the point cloud in the global coordinate system. The time required for the whole monocular visual positioning was only 179 ms, so it had good real-time performance.

The Central Plains Urban Agglomeration (CPUA) is a link of economic development to connect the eastern part and western part in China. Current research on urban agglomeration integration mainly uses urban properties’ data. This paper conducts an evaluation method for urban agglomeration integration based on multivariate big data. This method mainly applies eigenvector centrality to assess the integrated situation of the CPUA from four dimensions (internet connection, industrial economy, public service and coordinated governance). The data of this research mainly includes cell phone signaling data, Baidu index, industrial investment data and statistical data for planning. The main innovations and contributions of this research is that (i) on the theoretical aspect, this research proposed an index indicator evaluation system for integration of urban agglomerations based on Analytic Hierarchy Process (AHP) and expert rating. It contributes for the further development of regional integration and other related theories; (ii) on the practical aspect, this study, taking the CPUA as example, presents an assessment approach that uses multivariate big data to measure the current integrated situation of urban agglomeration. This method provides decision-making support for the development of urban agglomeration integration.

ABSTRACT: Probiotics are increasingly used as starter cultures to produce fermented dairy products; however, few studies have investigated the role of probiotics in milk fermentation metabolism. The current study aimed to investigate whether adding Bifidobacterium animalis ssp. lactis Probio-M8 (Probio-M8) as a starter culture strain could improve milk fermentation by comparing the physicochemical characteristics and metabolomes of fermented milks produced by a commercial starter culture with and without Probio-M8. Our results showed that adding Probio-M8 shortened the milk fermentation time and improved the fermented milk texture and stability. Metabolomics analyses revealed that adding Probio-M8 affected mostly organic acid, AA, and fatty acid metabolism in milk fermentation. Targeted quantitative analyses revealed significant increases in various metabolites related to the sensory quality, nutritive value, and health benefits of the probiotic fermented milk, including 5 organic acids (acetic acid, lactic acid, citric acid, succinic acid, and tartaric acid), 5 EAA (valine, arginine, leucine, isoleucine, and lysine), glutamic acid, and 2 essential fatty acids (α-linolenic acid and docosahexaenoic acid). Thus, applying probiotics in milk fermentation is desirable. This study has generated useful information for developing novel functional dairy products.

Abstract Background Genetic disorders often manifest as abnormal fetal or childhood development. Copy number variations (CNVs) represent a significant genetic mechanism underlying such disorders. Despite their importance, the effectiveness of clinical exome sequencing (CES) in detecting CNVs, particularly small ones, remains incompletely understood. We aimed to evaluate the detection of both large and small CNVs using CES in a substantial clinical cohort, including parent–offspring trios and proband only analysis. Methods We conducted a retrospective analysis of CES data from 2428 families, collected from 2018 to 2021. Detected CNV were categorized as large or small, and various validation techniques including chromosome microarray (CMA), Multiplex ligation-dependent probe amplification assay (MLPA), and/or PCR-based methods, were employed for cross-validation. Results Our CNV discovery pipeline identified 171 CNV events in 154 cases, resulting in an overall detection rate of 6.3%. Validation was performed on 113 CNVs from 103 cases to assess CES reliability. The overall concordance rate between CES and other validation methods was 88.49% (100/113). Specifically, CES demonstrated complete consistency in detecting large CNV. However, for small CNVs, consistency rates were 81.08% (30/37) for deletions and 73.91% (17/23) for duplications. Conclusion CES demonstrated high sensitivity and reliability in CNV detection. It emerges as an economical and dependable option for the clinical CNV detection in cases of developmental abnormalities, especially fetal structural abnormalities.

In order to study the functions and mechanisms of the postbiotics derived from composite probiotics, this study focused on the postbiotics produced by the co fermentation of Lacticaseibacillus paracasei ProSci-101 and Bifidobacterium adolescentis B8589. Metabolomics techniques were used to analyze the beneficial metabolites of the postbiotics. The results showed that the antibacterial and antioxidant abilities of the postbiotics derived from composite probiotics were significantly (P

Recent advancements in high-order topological insulators have heralded new opportunities for the innovation and utilization of optical devices. This paper presents a composite asymmetric C4 photonic crystal to achieve multifunctional, robust topological states. Through detailed analysis of the fine changes in the topological bandgap induced by distortion parameters, we facilitate the realization of topological edge states in wavelength division multiplexing applications. We utilize both trivial and nontrivial properties of the topological bandgap to precisely manipulate zero-dimensional angular states, one-dimensional topological boundary states, and two-dimensional body states. Through simulations and experimental results, our advanced asymmetric C4 photonic crystal structure demonstrates superior robustness for the transmission of topological edge states. Our research paves the way for the deployment of more robust topological boundary state transmission systems and advances the application potential of higher-order topological states.

Merging bound states in the continuum (BICs) and avoided crossing of resonances (ACR) are promising theoretical approaches to greatly enhance the quality (Q) factors of quasi-BICs in reciprocal space. We observe the phenomena of merging BICs and ACR in millimeter-sized C4v symmetry photonic crystal structures. The ACR at Γ point is obtained in the variation of the structural parameter. In off-Γ region, the merging BICs at arbitrary locations are observed in the experimental measurements. The findings offer a pathway to high-performance photonic devices with potential applications in optoelectronics and microwave experimentation.

Abstract Abnormal hemoglobin anti-Lepore Hong Kong is a rare βδ fusion variants resulting from non-homologous crossover during meiosis. Anti-Lepore Hong Kong is known to consistently exhibit significantly increased level of HbA2. In this study, we used multiplex ligation-dependent probe amplification (MLPA) and single molecular real-time (SMRT) sequencing, as well as Sanger sequencing, to identify variants in five unrelated families with abnormal elevated HbA2 level. All probands in these five families were found to be heterozygous for anti-Lepore Hong Kong. Among them, two families showed co-occurrence of β0-thalassemia and α-thalassemia (–SEA/ or αCSα/). Heterozygotes for anti-Lepore Hong Kong displayed an average HbA2 level of 17.7% and behaved normal. However, when combined with β0-thalassemia and α-thalassemia, the probands exhibited higher HbA2 level (30.2–40.8%) and behaved with β-thalassemia trait. Furthermore, determination of the α/β-mRNA ratio revealed a slight downregulation of β-globin, similar to that of β-thalassemia minor. Our study is the first to identify compound heterozygotes for anti-Lepore Hong Kong, β0-thalassemia and α-thalassemia, provide valuable information for prenatal counseling.

Buildings adjacent to high-speed rail (HSR) tracks are one of the key concerns in the environmental hazard monitoring of HSR lines. The rapid and accurate extraction of building information for real-time inspection through high-resolution remote sensing (HRRS) images is a crucial and effective method to ensure the safe operation of high-speed trains. However, a significant challenge associated with this task emerges from the extremely intricate scenes and diverse buildings within HRRS images that cover long-span HSR lines. To surmount this challenge, this paper presents a high-quality HSR dataset and a novel full-attention semantic segmentation network (referred to as FANet) for building detection along HSR lines. The dataset provided contains rich HRRS image data and high-quality pixel-level building annotations. The proposed FANet is designed to enhance model performance by paying comprehensive attention to multi-level, multi-scale, and global relational information. Specifically, after analyzing the special requirements, a multi-scale global attention (MSGA) module and an affinity attention fusion (AAF) module have been devised and incorporated into FANet. The MSGA module is utilized to ensure the integrity and consistency of building extractions across various shapes and sizes, while the AAF module aids in the fine-grained identification of building outline boundaries. Extensive experiments conducted using the introduced HSR dataset, along with two publicly available building datasets–the Massachusetts building dataset and the Inria aerial image dataset–demonstrate the superior performance of the proposed approach. Moreover, the paper comprehensively discusses various applications that the HSR dataset can support for future research endeavors. The HSR dataset and method code will be made publicly accessible at https://github.com/QiaoWenfan/Building_Dataset.

Abstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Paleogeographic reconstruction studies the evolution of the earth's surface tectonic process, the pattern of land and sea, climate, and biology in time and space in geological history. With the advent of the big data era, the accuracy of the digital paleogeographic reconstruction is essential. Although there are various global paleogeographic reconstruction models, there is still a lack of paleogeographic reconstruction integrating tectonic, lithofacies, paleontology, and paleoclimate data. In this paper, a case study of the comprehensive paleogeographic reconstruction is carried out in the Middle Permian-Middle Triassic eastern Tethyan tectonic domain, which is highly concerned and rich in geological data accumulation. The digital paleogeographic map is completed by the combination of automatic mapping with machine learning and manual correction. We use the newly upgraded paleomagnetic, geological and paleontological data to reconstruct the paleoposition of the East Asian blocks at 260, 250 and 240 Ma, which shows the Paleo-Tethys Ocean (PTO) had a wider east-west range than the previous version due to adopting the method of Torsvik et al. (2008) to reconstruct the paleolongitude of South China at 260 Ma. The new model shows the PTO was semi-closed with several narrow seaways and was divided into north and south branches at 260 Ma. Based on the updated lithofacies paleogeographic map data of China and marine fossils data, we updated the paleogeographic map of the Eastern Tethyan tectonic domain on the basis of the global paleogeographic map, combining automatic mapping with machine learning and manual revision of paleotopography and paleocoastline. Based on the new tectonic paleogeographic reconstruction, we revised the paleoclimate zonation pattern of the East Tethys ocean using climate-sensitive lithologies.

To investigate double protein product which was combined with fermented milk and peanut protein followed by characterization of the sensory properties, acidity, viscosity, water holding capacity and viable count of probiotics after the storage of 28 days. The pure milk was mixed with different peanut protein proportions, and after pasteurization, the mixture were fermented with the fermentation (Streptococcus thermophilus S10:Bifidobacterium animalis subsp. lactis strain V9:Lactobacillus casei Zhang=10:10:1). The results showed that the group of peanut protein:milk protein=3:7 presented better sensory characteristics (94±3) and texture properties with both color and aroma, delicate tissue, and good cohesion, and the fermentation time was 5.4 h. Compared with the control groups, the 3:7 group showed a weak post-acidification ability, and higher cohesiveness and viscosity index (−20.24±1.77 g, −20.63±2.79 g·s, respectively). In addition, the 3:7 group showed (1085±100) mPa·s of viscosity and the 75% water holding capacity for the whole process. Further more, the viable count of Lactobacillus casei Zhang and Bifidobacterium animalis subsp. lactis V9 in 3:7 group maintained 1×107 CFU/mL after the 28 d storage, respectively. In general, the product of probiotic fermented milk mixed with the peanut protein appeared better sensory characteristics and stability, which would have potential research and commercial values for the future.

ABSTRACTBackground Hb Chapel Hill [Alpha2 74(EF3) Asp > Gly] results from an GAC > GGC substitution at codon 74 of the HBA1 or HBA2 genes. Hb Chapel Hill has not been reported since 1986.Methods A heterozygous mutation, HBA2: c.224A > G, was identified in the proband, her father and sister. We compared the haematological and clinical data of this family with the data reported in the limited number of individuals.Results Having excluded iron deficiency, the Hb Chapel Hill was asymptomatic in heterozygous state. The cases presented here characterize cases in new techniques including capillary electrophoresis (CE). Two aberrant peaks were identified by CE, a major peak migrating in the zone 7 that correspond to Hb Chapel Hill (αChapel Hill 2β2) and a minor peak migrating in the zone 1 that correspond to Hb Chapel Hill2 (αChapel Hill 2δ2). Focusing on the variant expression, the Hb Chapel Hill plus Hb A2 variant were around 18.9–20.6% of total Hb in three members.Conclusion This data will be useful for providing up-to-date and high quality information on the Hb Chapel Hill.

ABSTRACTObjective In the present study, two unrelated cases of Hb Q-Thailand heterozygosity unlinked with the (–α4.2/) α+-thalassemia deletion allele were identified by long-read single molecule real-time (SMRT) sequencing in southern China. The aim of this study was to report the hematological and molecular features as well as diagnostic aspects of the rare manifestation.Methods Hematological parameters and hemoglobin analysis results were recorded. A suspension array system for routine thalassemia genetic analysis and long-read SMRT sequencing were applied in parallel for thalassemia genotyping. Traditional methods, including Sanger sequencing, multiplex gap-polymerase chain reaction (gap-PCR) and multiplex ligation-dependent probe amplification (MLPA), were used together to confirm the thalassemia variants.Results Long-read SMRT sequencing was used to diagnose two Hb Q-Thailand heterozygous patients for whom the hemoglobin variant was unlinked to the (–α4.2/) allele for the first time. The hitherto undescribed genotypes were verified by traditional methods. Hematological parameters were compared with those of Hb Q-Thailand heterozygosity linked with the (–α4.2/) deletion allele in our study. For the positive control samples, long-read SMRT sequencing revealed a linkage relationship between the Hb Q-Thailand allele and the (–α4.2/) deletion allele.Conclusions Identification of the two patients confirms that the linkage relationship between the Hb Q-Thailand allele and the (−α4.2/) deletion allele is a common possibility but not a certainty. Remarkably, as it is superior to traditional methods, SMRT technology may eventually serve as a more comprehensive and precise method that holds promising prospects in clinical practice, especially for rare variants.

Abstract Probiotic functional products have drawn wide attention because of their increasing popularity. However, few studies have analyzed probiotic-specific metabolism in the fermentation process. This study applied UPLC-QE-MS-based metabolomics to track changes in the milk metabolomes in the course of fermentation by two probiotic strains, Lacticaseibacillus paracasei PC-01 and Bifidobacterium adolescentis B8589. We observed substantial changes in the probiotic fermented milk metabolome between 0 and 36 h of fermentation, and the differences between the milk metabolomes at the interim period (36 h and 60 h) and the ripening stage (60 h and 72 h) were less obvious. A number of time point-specific differential metabolites were identified, mainly belonging to organic acids, amino acids, and fatty acids. Nine of the identified differential metabolites are linked to the tricarboxylic acid cycle, glutamate metabolism, and fatty acid metabolism. The contents of pyruvic acid, γ-aminobutyric acid, and capric acid increased at the end of fermentation, which can contribute to the nutritional quality and functional properties of the probiotic fermented milk. This time-course metabolomics study analyzed probiotic-specific fermentative changes in milk, providing detailed information of probiotic metabolism in a milk matrix and the potential beneficial mechanism of probiotic fermented milk.

Abstract Background At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. Methods We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. Results Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). Conclusion We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.

ABSTRACT: Streptococcus thermophilus has been extensively applied in fermented milk. This study used gas chromatography-ion mobility spectroscopy to determine and evaluate the volatile metabolites in raw milk, milk fermented at 37°C, and milk fermented at 42°C. Ten discriminatory volatile metabolites were identified at different incubation temperatures: acetone, 2-heptanone, 2-pentanone, 2-hexanone, butanal, hexanal, ethyl acetate, 3-methylbutanal, 3-methylbutanoic acid, and 2-methylpropanoic acid, indicating that fermentation temperature affected the spectrum of volatiles in milk fermented by different strains of S. thermophilus. Specifically, fermentation at 37°C led to accumulation of short-chain fatty acids, whereas fermentation at 42°C enriched ketones and other flavor substances in the fermented milk, enhancing the flavor of the product. This work examined the differences between the volatile metabolites produced by different S. thermophilus strains fermented at different temperatures to evaluate the effect of temperature on the metabolic pathways.

This study presents a biosensor fabricated based on integrated passive device (IPD) technology to measure microbial growth on solid media in real-time. Yeast (Pichia pastoris, strain GS115) is used as a model organism to demonstrate biosensor performance. The biosensor comprises an interdigital capacitor in the center with a helical inductive structure surrounding it. Additionally, 12 air bridges are added to the capacitor to increase the strength of the electric field radiated by the biosensor at the same height. Feasibility is verified by using a capacitive biosensor, and the change in capacitance values during the capacitance detection process with the growth of yeast indicates that the growth of yeast can induce changes in electrical parameters. The proposed IPD-based biosensor is used to measure yeast drop-added on a 3 mm medium for 100 h at an operating frequency of 1.84 GHz. The resonant amplitude of the biosensor varies continuously from 24 to 72 h due to the change in colony height during vertical growth of the yeast, with a maximum change of 0.21 dB. The overall measurement results also fit well with the Gompertz curve. The change in resonant amplitude between 24 and 72 h is then analyzed and reveals a linear relationship with time with a coefficient of determination of 0.9844, indicating that the biosensor is suitable for monitoring yeast growth. Thus, the proposed biosensor is proved to have potential in the field of microbial proliferation detection.

The effects of different concentrations of cadmium and 2,2′,4,4′,5,5′-hexabrominated diphenyl ether (BDE-153) on the growth and related physiological and biochemical indexes of Amaranthus mangostanus L. (amaranth) were studied. The results showed that the presence of BDE-153 promoted the absorption of Cd by the amaranth and inhibited the migration of Cd from the roots to the shoots. At the same time, 0.1 mg/L of Cd had a synergistic effect on the migration of BDE-153, but 5 mg/L Cd inhibited the accumulation of BDE-153 in the aboveground part of the amaranth. In addition, the kinetics of the uptake of pollutants by the amaranth showed that both Cd and BDE-153 could be transported by amaranth, but Cd and BDE-153 were mainly enriched in the roots, and the presence of Cd may cause a lag in the uptake of BDE-153 in the shoots. Compared with the control group, the biomass of the amaranth affected by BDE-153 and a high concentration of Cd (5 mg/L) decreased by 30.2–49.5%, the chlorophyll content decreased by 43.0–60.3%, the Evans blue increased, and the MDA content was higher. The activities of superoxide dismutase (SOD) and catalase (CAT) also decreased with an increase in the BDE-153 concentration. This indicates that the interaction between BDE-153 and a high concentration of Cd (5 mg/L) is more toxic to amaranth than single Cd pollution. This paper provides the necessary data support for phytoremediation of heavy metal and organic compound pollution.

Accurate and effective assessment of groundwater potential in aquifers hundreds of meters deep remains a major challenge in mining and environmental protection. We analyzed the interaction mechanism of hydrogeological parameters, quantified it and incorporated it into the variable weight model (VWM) for secondary optimization, and constructed a dual dynamic variable weight model (PE-HVWM) that varies with multi-parameter entanglement and single-parameter state values to characterize the groundwater potential. Then, the pumping test data measured at the mining site were used to compare and analyze the results of different model predictions, and the optimized model was validated and tested using the Receiver Operating Curve (ROC) method and sensitivity analysis, which showed that the PE-HVWM method has a fairly high accuracy in groundwater potential prediction (AUC = 0.874). The PE-HVWM model can visualize the intrinsic correlation between hydrogeological parameters, and can respond sensitively to sudden changes in the state value of a hydrogeological parameter in the aquifer, and output groundwater potential results that are more in line with the actual situation after self-balancing by linking other parameters.

Metalens can achieve more challenging functions especially dynamic regulation than traditional lens due to its unprecedented ability to manipulate light. In this paper, an approach to realizing switchable bidirectional metalens is proposed based on phase change material GST. Two geometric parameters of nanopillars were designed to demonstrate full phase modulation due to the Pancharatnam-Berry phase. According to the phase distribution, we realize the flexible control of the metalens through the transition of states. These special designs of unit structures make multi-focal point focus and two-dimensional focus also realized. In addition, the bidirectional switchable metalens have been realized through the transformation of states on a bilayer metasurface substrate. Its unique phase transition properties which are not available to previous metasurface can be applied in high quality imaging cameras, optical microscopes, lidar scanning systems, etc.

In some complex scene, such as military reconnaissance and other fields, the target object may be partially occluded by some opaque obstacles, which increase the difficulty to obtain the complete object image. In traditional optical imaging system, the lenslet array or the reference beam and special algorithms are usually needed to solve this problem, which increase the complexity of the system. As a computational optical imaging technology, the problem of single-pixel imaging (SPI) for an occluded object has not been researched yet as we know. Here we propose an SPI system to recover the occluded object image. Firstly, the images of object and occlusion from different perspectives are obtained by detecting the light field at different positions. Secondly, the limited conditions of the system parameters are derived by using geometric optics theory to ensure complete imaging. Thirdly, the feasibility of the scheme and the correctness of the limited conditions are verified by experiments. The results in this article can promote the application of SPI technology in many complex practices.

Abstract The fermented milk mainly consists of Lactobacillus bulgaricus and Streptococcus thermophilus. This research was aimed to investigate the cofermentation characteristics of different L. bulgaricus and S. thermophilus strains. Three strains of L. bulgaricus and S. thermophilus ST‐2 were mixed and prepared into the starter (A, B, and C) and applied to milk fermentation for screening of optimal combination, and the commercial starter (D) was used as the reference. The microrheological properties during fermentation were analyzed by using multifrequency diffusion spectroscopy. Meanwhile, the fermented milk's stability, texture, and sensory characteristics were also observed during storage. Microrheology analysis revealed that the time to reach the fermentation endpoint of starters A, B, and C was almost the same during fermentation. Groups A, B, and C showed more elastic solid‐state properties and groups A and C had higher elastic factors, indicating that the gel structure of the sample was relatively strong. During storage, the pH value of fermented milk in each group D, A, C, and B was in sequence from high to low, and the titratable acidity was also in sequence from high to low in B, C, A, and D groups, respectively. The viscosity of group A was significantly higher than that of groups B and C (p 0.05). The sensory score of fermented milk in group A was higher, and the overall texture was good. Results concluded that group A starter culture produced fermented milk with a firm gel structure and excellent texture and flavor. This study will provide data support and methodology for developing and screening compound starters applied for milk fermentation in the future.

Abstract Optical bound states in the continuum (BICs) exist in many photonic crystals and periodic structures with a strong resonance and ultrahigh Q factor. Such phenomena can be used in the designs of narrowband transmission filters, lasers, and sensors. In this paper, we consider the energy bands of a complex structure consisting of a grating and a multilayer substructure to obtain the position of the BIC in the structure. Hence, the higher Q factor can be obtained in the grating-multilayer structure than can be realized in the simple grating geometry. We analyze the wave propagation process in the complex structure and the change in the Q value via the use of transmission matrix theory. In addition, the reflectance spectrum is found to exhibit a series of asymmetric line-shapes with different values of the asymmetry parameter, δ, due to the interference between the two channels. One of these channels is the broadband channel, induced by the Fabry–Perot resonance, and the other channel is the narrowband channel, induced by guided mode resonance. Quasi-BICs are seen to transform into BICs as the value of δ is decreased gradually to zero. Therefore, a large Goos–Hänchen shift can be achieved as a result of the high Q factor and quasi-BIC. This work designs a complex structure with ultrahigh Q factor and strong resonance properties, which has significant implications for exploring the phenomenon of BICs.

Objectives Here we report two rare α-globin chain variants in two unrelated families: Hb Val de Marne [α133(H16) Ser > Arg (AGC > CGC); HBA2: c.400A > C] and Hb Dongguan [α52(E6) Ser > Cys (TCT > TGT); HBA1: c.158C > G]. Notably, HBA2: c.400A > C is an unreported new variant in the third exon of the α2 gene, and simple heterozygous unstable Hb Dongguan haematological characteristics are proposed for the first time.Methods Hb analysis was performed by using capillary electrophoresis (CE). Twenty-three common mutations were detected using a suspension array system. Mutations were identified by DNA sequencing.Results The CE results showed an abnormal peak with incomplete separation from Hb A at zone 8 in two members of Family 1. DNA sequencing confirmed the presence of Hb Val de Marne [α133(H16) Ser > Arg (AGC > CGC); HBA2: c.400A > C]. Five members of Family 2 exhibited an abnormal peak at zone 11, and DNA sequencing confirmed the presence of Hb Dongguan [α52(E6) Ser > Cys (TCT > TGT); HBA1: c.158C > G].Conclusions The discovery of HBA2: C.400A > C expands the existing spectrum of α-globin variants. The carriers of simple heterozygous Hb Dongguan generally do not have obvious clinical symptoms. The information in this study will help clinicians understand the screening, molecular diagnosis and clinical significance of Hb variants.

Objective The 3.7 kb deletion (-α3.7) in the α-globin cluster, which characterizes α+-thalassemia, has been reported to have a carrier rate of 4.78% in southern China. Three -α3.7 subtypes have been identified worldwide. However, the -α3.7 III subtype has not previously been identified in China. Herein, we reported identification of the -α3.7 III subtype in a Chinese patient.Methods We used gap-PCR and a liquid chip system to detect α-thalassemia mutations. Multiple ligation-dependent probe amplification was performed to detect the large deletion. We finally used Sanger sequencing and single molecule real-time sequencing to characterize and confirm the genotype.Results The proband, characterized as -α3.7 III heterozygous, showed microcytosis and hypochromic red cells, with a mean corpuscular volume of 78 fL and mean corpuscular hemoglobin of 25.4 pg. The proband’s mutation was inherited from her father, who had normal blood parameters.Conclusion We first identified the -α3.7 III subtype in China. Consequently, all -α3.7 subtypes have now been identified in the Chinese population. Therefore, attention should be paid to -α3.7 III in clinical prenatal diagnosis, given that commonly used methods such as gap-PCR may lead to misdiagnosis or missed diagnosis.

Background The α-thalassemia is a highly prevalent disease in tropical and subtropical regions, including southern China, and is mainly caused by deletion in α-globin genes (HBA1 and HBA2). The clinical manifestation of α-thalassemia is highly correlated with the copy number of α-globin genes. The decrease in copy number results in α-thalassemia, while duplication or triplication compounded with β-thalassemia may aggravate the clinical manifestation. However, the common methods used to measure the copy number variants can only detect the three common types: –SEA, -α3.7, and -α4.2, and may easily miss the rare deletional type and duplication or triplication cases. Therefore, a new method that allows the detection of different copy number variants in α-globin genes simultaneously and accurately needs to be established. Methods A total of 428 peripheral-blood and fetal chorionic villus or amniotic fluid samples were used in this study. We employed a pair of primers and two probes, one for HBA1 and another for HBA2, to perform droplet digital polymerase chain reaction (ddPCR). Each reaction needed the ddPCR of RPP30 as a reference gene to calculate the copy number. Results We accurately detected the copy number variants in α-globin genes, including the common form α-thalassemia, triplications such as αααanti4.2, and trisomy 16, by performing only two reactions. The accuracy rate for detecting the copy number of α-globin genes was up to 100%. Conclusion In conclusion, ddPCR served as an accurate and rapid method for detecting copy number variations in the clinical screening for α-thalassemia.

Hemoglobin Santa Ana [β88(F4)Leu→Pro (CTG > CCG) HBB: c.266T > C] is an unstable hemoglobin variant characterized by a substitution of the amino acid leucine by proline at the 88th position of the β-globin chain. We for the first time identified this hemoglobin variant in a Chinese patient by capillary electrophoresis (CE). The proband was an 8-year-old boy with chronic anemia, brown urine and splenomegaly. He had been affected by moderate anemia, twice approaching a severe degree, that was attributed to infection. The CE result revealed an abnormal hemoglobin peak at electrophoretic zone 4 that correspond to the hemoglobin Santa Ana peak, and a CTG > CCG mutation at codon 88 of the β-globin gene was confirmed by DNA sequencing. To avoid misdiagnosis and genetic risks, a literature review of other unstable hemoglobins that migrate similarly to the hemoglobin Santa Ana was performed. Our findings indicate that hemoglobin Santa Ana can be clearly separated by CE, with accurate diagnosis depending on molecular analysis. This information will be useful for providing appropriate genetic counselling and for prenatal diagnosis.

Abstract High-quality-factor (high-Q-factor) electromagnetic resonance plays an important role in sensor applications. Previously proposed gas refractive index sensors are often limited by the large cavity length or microscale fabrication process in practical applications. Recently, ultra-high Q factor resonance based on the bound state in the continuum (BIC) has provided a feasible approach to solve these problems. In this paper, we propose a metasurface structure consisting of a single size tetramer cylinder. It supports dual band toroidal dipole (TD) resonances driven by BIC. The physical mechanism of double TD resonances is clarified by the multipole decomposition of the metasurface band structure and far-field scattering power. The sensor structure based on this achieves a sensitivity of 518.3 MHz/RIU, and the maximum line width does not exceed 680 kHz. The high-Q-factor electromagnetic resonance has the advantages of polarization independence and simplicity to manufacture. These findings will open up an avenue to develop the ultrasensitive sensor in the gigahertz regime.

ABSTRACT: The addition of Bifidobacterium to goat milk has dual effects on health, for which various inherent nutrients of goat milk are retained and live probiotics are provided. We explored the effect of Bifidobacterium animalis ssp. lactis Probio-M8 (Probio-M8) on fermentation characteristics, formation of organic acid, sensory properties, and storage characteristics of fermented goat milk (with added 4.0% sucrose). Addition of Probio-M8 decreased the fermentation time and significantly increased the content of functional organic acids, such as acetic acid, and functional long-chain unsaturated fatty acids, including linoleic acid, α-linolenic acid, and docosahexaenoic acid. Furthermore, the contents of medium-chain and short-chain fatty acids, which are related to “goaty” flavor, were significantly lower in the Probio-M8 treatment compared with the control. The number of living Probio-M8 decreased from 8.27 log cfu/mL (1.80 × 108 cfu/mL) to 7.94 log cfu/mL (0.79 × 108 cfu/mL) after 28 d of storage. Titratable acidity and pH value did not differ between the control group and experimental group (containing Probio-M8). Sensory evaluation indicated a lower goaty flavor and odor in the Probio-M8 fermented milk. Our results suggest that the addition of the probiotic Probio-M8 could improve the sensory, physicochemical, and functional properties of fermented goat milk.

Abstract Metasurface can use artificial microstructures to manipulate electromagnetic waves more accurately and flexibly. All-dielectric metalens have a wide range of materials and low cost so it has a wide application prospect. Herein, we propose a all-dielectric achromatic metalens built with Si as the structural unit that can operate over a broadband of wavelengths in the visible region. It controls the wavefront of light through the Pancharatnam–Berry phase and propagation phase to eliminate the chromatic aberration. Meanwhile, we also use Gerchberg–Saxton algorithm and its improved algorithm to iterate over multiple design wavelengths and obtain holographic phases suitable for broadband. Thus, both the metalenses and holographic metasurfaces can achieve achromatic broadband in the visible light range, which provides a new method for the development of meta-optical imaging devices.

Lactiplantibacillus plantarum is a candidate probiotic that has been included in the list of recommended biological agents for certification by the European Food Safety Authority. It has been found to be widely present in acidic-gruel, yogurt, cheese, kefir, kimchi, and so on. In this article, we have reviewed both preclinical and human studies related to the health promoting effects of L. plantarum that have been published for the past decade. We found that L. plantarum could significantly improve intestinal function, oral as well as skin health, promote neuro as well as immune regulation, and be effective against metabolic diseases, etc. L. plantarum primarily enters the body through the oral cavity and acts on the gastrointestinal tract to effectively improve the intestinal flora. It can affect the female reproductive endocrine system through interaction with estrogen, androgen, insulin, and other hormones, as well as improve the body’s allergic reaction and immunity by regulating Th1/Th2 response. Several prior reports also suggest that this Gram-positive bacterium can promote production and secretion of key neurotransmitters and neural activators in the intestinal tract by regulating the intestinal flora by directly or indirectly affecting the gut–brain axis through modulation of vagus nerve, cytokines, and microbial metabolites, thus relieving stress and anxiety symptoms in adults. This review is the first report describing the health promoting effects of L. plantarum, with the aim of providing a theoretical basis for the development of various beneficial applications of L. plantarum.

ABSTRACT: Probiotic fermented milk is more and more popular due to their positive health associated properties. However, fermentation temperature and other process conditions may affect the growth and metabolism of probiotic strains, thereby affecting quality of the final products. In this study, the growth behaviors and metabolomic profiles of yogurts induced by Lactobacillus casei Zhang at fermentation termination (FT) and d 10 of storage (S10d) under different fermentation temperatures at 37°C (low) and 42°C (high) were analyzed and compared using liquid chromatography-mass spectrometry (MS)- and gas chromatography-MS-based metabolomics approaches. At 37°C, the growth of L. casei Zhang at FT and S10d was significantly increased, and the potential relationship between riboflavin, starch, and sucrose metabolism and growth of L. casei Zhang may be mutually promoting. Fermentation temperature (37°C and 42°C) affected volatile and nonvolatile metabolomic profiles and pathways. The levels of acetaldehyde, 2,3-butanedione, acetoin, butyric acid, decanoic acid, hexanoic acid, and octanoic acid were significantly higher at 37°C than at 42°C at FT and S10d. This indicates that the low temperature (37°C) most likely contributes more to the formation of important flavor compounds during the fermentation process and production of short-chain fatty acids during storage.

As a special imaging technique, one of the most important advantages of single-pixel imaging (SPI) than conventional imaging method is that it can recover the object image even through turbid medium. In these situations, the noises bring by the turbid medium usually obey special rules in statistics. While in some other applications, SPI is performed in the environment with complicate ambient light, in which no prior information of the environment noise is known. Aiming at this situation, in this work, the frame-by-frame subtraction-based compressive sensing SPI (FFS-CSPI) method with random 0/1 pattern is used to decrease the effect from the unknown ambient light. The noise robustness of the FFS-CSPI method is analyzed and compared with Hadamard CSPI. In simulation and experiment, two kinds of noises, from external light source and from background video, are considered. The results prove that FFS-CSPI with random 0/1 patterns can achieve higher image quality than conventional mean subtraction method and Hadamard CSPI with the same measurement number. Considering the high refresh rate of digital micromirror device when it loads the 0/1 binary patterns, the imaging speed is acceptable. This work will promote the practical applications of SPI in complicated environment.

Aiming at asymmetric Bessel mode, we investigate the propagation characteristics of vortex mode in atmospheric turbulence. The theoretical expressions of mode detection probability are derived for signal and crosstalk modes, based on which channel capacity is further analyzed. The detection probability distribution is mainly affected by mode wavelength and asymmetric factor. The increment of asymmetric factor can diversify the transverse mode intensity pattern, but cause the decline of signal probability and channel capacity. To improve channel capacity, longer wavelength and more transmitted modes are beneficial, while the adjustments of mode topological charge and Bessel cone angle have no effect. Besides, the influences of atmospheric turbulence conditions are discussed. The results are referential for exploring the use of asymmetric Bessel mode as signal source.

In the field of optics, bound state in the continuum (BIC) as a special state to be researched in many photonic crystals and periodic structures, which can produce strong resonance and an ultrahigh Q factor. Some designs of narrowband transmission filters, lasers, and sensors are proposed based on excellent optical properties of quasi-BIC. In this paper, we consider symmetrical rectangular grating structure firstly. Then cut off a corner of rectangular gratings, the Fano line of quasi-BIC can be observed in the spectrum. After that, we change the oblique parameter of the other rectangular grating, which can further decrease the Fano line width. In the momentum space, the change of structure means topological charges split from q = 1 into half charges q = 1/2. We analyze guided mode resonance (GMR) excitation of the grating structure, and discuss the dispersion relations in the waveguide layer with the position of BIC in energy bands. In addition, the spectrum exhibits asymmetric line-shapes with different values of the asymmetry parameters, M1 and M2. BIC is transformed into quasi-BIC as the symmetry of the structure broken. Thus, a large Goos-Hänchen shift can be achieved as a result of ultrahigh Q factor of quasi-BIC. This work demonstrates a double trapezoid structure with strong resonance properties, which has significant implications for exploring the phenomenon of BIC.

Weakly supervised semantic segmentation (WSSS) methods based on image-level labels can relieve the tedious pixel-level annotation burden, and these methods are mainly based on class activation maps (CAMs). However, it is challenging to generate high-quality CAMs for high-resolution remotely sensed imagery (HRSI). In this article, we propose a WSSS method for building extraction from HRSI using image-level labels. The proposed method, termed as the MSG-SR-Net, integrates two novel modules, i.e., multiscale generation (MSG) and superpixel refinement (SR), to obtain high-quality CAMs so as to provide reliable pixel-level training samples for subsequent semantic segmentation steps. The MSG module is proposed to use global semantic information to guide the learning of multiple features across different levels, and then, respectively, to utilize multilevel features for generating multiscale CAMs. This component can effectively suppress the interference of the class-irrelevant noise and strengthen the use of profitable information in multilevel features. The SR module is designed to take advantage of superpixels to improve multiscale CAMs in target integrity and details preserving. Extensive experiments on two public building datasets demonstrated that the proposed modules made the MSG-SR-Net obtain more integral and accurate CAMs for building extraction. Moreover, experimental results also showed the proposed method achieved excellent performance with over 67% in F1-score, and outperformed other weakly supervised methods in effectiveness and generalization ability.

This study proposes a novel metasurface structure made of dielectric diagonal round holes. It is possible to achieve the quasi-bound state in the continuum (quasi-BIC) resonance modes with high Q-factors by introducing symmetry breaking into the unit structure. The quality factor and line width can be controlled by asymmetric parameters, which are the offset and radius size of the nano round hole. Additionally, adjustable light absorption can be achieved at the quasi-BIC resonance by doping graphene, which corresponds to the preeminent characteristic of graphene of enhancing light absorption. We conclude that the theoretical fitting results for the dissipation rate of the diagonal round holes (DRH) structure with or without graphene are consistent with the simulated quasi-BIC data. The proposed metasurfaces are more feasible and potentially useful compared to other complex nanostructures, as they may contribute to applications such as high-performance graphene-based devices.

In this paper, we demonstrate an adjustable trifunctional absorber that can achieve the conversion of broadband, narrowband and superimposed absorption based on the phase transition material vanadium dioxide (VO2) in the mid-infrared domain. The absorber can achieve the switching of multiple absorption modes by modulating the temperature to regulate the conductivity of VO2. When the VO2 film is adjusted to the metallic state, the absorber serves as a bidirectional perfect absorber with switching capability of wideband and narrowband absorption. The superposed absorptance can be generated while the VO2 layer is converted to the insulating state. Then, we introduced the impedance matching principle to explain the inner mechanism of the absorber. Our designed metamaterial system with a phase transition material is promising for sensing, radiation thermometer and switching devices.