Search

Oculocutaneous albinism (OCA) is a genetically heterogeneous disease and is most inherited in an autosomal recessive manner. The characteristic manifestation of OCA is due to disfunction of melanin synthesis. OCA1 is the most severe subtype of OCA and is caused by homozygous or compound heterozygous variants in tyrosinase (TYR) gene, which is the key gene for melanin synthesis. This study aimed to identify the genetic variants of a northern Chinese family with OCA1. Clinical information and peripheral blood samples were collected. PCR amplification and Sanger sequencing were used to detect the entire exons and adjacent flanking sequences of TYR gene. Functional prediction of variants was performed by various bioinformatic analyses, while the pathogenicity classification of variants was evaluated according to ACMG standards and guidelines. A missense variant NM_000372.5:c.107G > C;NP_000363.1:p.C36S was discovered in TYR gene which converted cysteine to serine. Another variant in intron, NM_000372.5:c.1037–7 T > A, also affected the function of TYR gene. We verified the pathogenicity of the intron variant with a pCAS2 mini‐gene based splicing assay and found that c.1037–7 T > A led to an insertion of 5 bp upstream from the common acceptor site of exon 3, which caused a frameshift TYR:c.1037–7 T > A:p.G346Efs*11. The results showed that the compound heterozygous variants c.107G > C:p.C36S and c.1037–7 T > A:p.G346Efs*11 of TYR gene were the pathogenic variants for this OCA1 family. [ABSTRACT FROM AUTHOR]

Purpose: To evaluate the feasibility and clinical effect of Krackow suturing combined with the suture bridge technique for the treatment of acute inferior pole patella fracture. Methods: In this study, 18 patients with acute inferior pole patella fracture who received treatment using Krackow suturing combined with the suture bridge technique between January 2019 and March 2020 were retrospectively reviewed. There were 10 men and 8 women, with an average age of 50.1 years (range 24–69 years). X-ray examinations were performed to assess fracture healing and the Insall–Salvati index. The clinical effect was measured by the range of motion of the knee joint and the Böstman scale. Results: Patients were followed up for 13–26 months, with an average follow-up period of 19.6 months. X-ray indicated that fracture union had occurred in all patients by 10.1 weeks after surgery on average (range 8–14 weeks). The mean Insall–Salvati index immediately after surgery and at the final follow-up was 0.98 ± 0.07 and 0.90 ± 0.22, respectively (P > 0.05). At the last follow-up, the mean flexion and extension ranges for the knee joint were 135.8° ± 8.8° and − 2.8° ± 3.9°, respectively, and the mean Böstman scale was 28.9 ± 1.1 points. Functional recovery was excellent in 17 patients and good in one patient, resulting in an overall good/excellent recovery rate of 100%. Conclusions: Our results indicated that Krackow suturing combined with the suture bridge technique can achieve stable fracture fixation, provides good clinical outcomes in the treatment of acute inferior pole patella fracture, and is worthy of clinical application. [ABSTRACT FROM AUTHOR]

Objective: Ovarian cancer (OV) has a high mortality rate all over the world, and extrachromosomal circular DNA (eccDNA) plays a key role in carcinogenesis. We wish to study more about the molecular structure of eccDNA in the UACC-1598–4 cell line and how its genes are associated with ovarian cancer prognosis. Methods: We sequenced and annotated the eccDNA by Circle_seq of the OV cell line UACC-1598–4. To acquire the amplified genes of OV on eccDNA, the annotated eccDNA genes were intersected with the overexpression genes of OV in TCGA. Univariate Cox regression was used to find the genes on eccDNA that were linked to OV prognosis. The least absolute shrinkage and selection operator (LASSO) and cox regression models were used to create the OV prognostic model, as well as the receiver operating characteristic curve (ROC) curve and nomogram of the prediction model. By applying the median value of the risk score, the samples were separated into high-risk and low-risk groups, and the differences in immune infiltration between the two groups were examined using ssGSEA. Results: EccDNA in UACC-1598–4 has a length of 0-2000 bp, and some of them include the whole genes or gene fragments. These eccDNA originated from various parts of chromosomes, especially enriched in repeatmasker, introns, and coding regions. They were annotated with 2188 genes by Circle_seq. Notably, the TCGA database revealed that a total of 198 of these eccDNA genes were overexpressed in OV (p < 0.05). They were mostly enriched in pathways associated with cell adhesion, ECM receptors, and actin cytoskeleton. Univariate Cox analysis showed 13 genes associated with OV prognosis. LASSO and Cox regression analysis were used to create a risk model based on remained 9 genes. In both the training (TCGA database) and validation (International Cancer Genome Consortium, ICGC) cohorts, a 9-gene signature could successfully discriminate high-risk individuals (all p < 0.01). Immune infiltration differed significantly between the high-risk and low-risk groups. The model's area under the ROC curve was 0.67, and a nomograph was created to assist clinician. Conclusion: EccDNA is found in UACC-1598–4, and part of its genes linked to OV prognosis. Patients with OV may be efficiently evaluated using a prognostic model based on eccDNA genes, including SLC7A1, NTN1, ADORA1, PADI2, SULT2B1, LINC00665, CILP2, EFNA5, TOMM. [ABSTRACT FROM AUTHOR]

Background: Polydactyly is a common congenital malformation characterized by the presence of supernumerary fingers or toes. In this case study, we sought to identify the causative pathogenic factor in a family from a northern region of China affected by non‐syndromic postaxial polydactyly (PAP). Methods: After recruiting a three‐generation family with PAP, whole‐exome sequencing was performed to identify the causative variant. In silico analysis and Sanger sequencing were used to validate the variant. Results: We identified a novel heterozygous frameshift variant (NM_000168.6:c.4540delG, p.Asp1514Thrfs*5) in the transcriptional activator (TA1) domain of the GLI3 gene. Conclusion: The novel frameshift variant identified in this study further confirms the relationship between non‐syndromic PAP and GLI3 and extends the previously established mutational and phenotypic spectra of GLI3. [ABSTRACT FROM AUTHOR]

Background: The treatment of completely displaced midshaft clavicle fractures is still controversial, especially Robinson 2B fractures. Titanium elastic nail (TEN) fixation is a good option for simple fractures, but no reports exist on its use in complex fractures. This study aimed to present a surgical method using the Nice knot-assisted TEN fixation to treat Robinson 2B midshaft clavicular fractures. Methods: A retrospective analysis of 29 patients who underwent fixation with TEN and had a 1-year postoperative follow-up between 2016 and 2020 was performed. The fractures were classified as Robinson type 2B1 in 17 cases and type 2B2 in 12 cases. Length of the incision, postoperative shoulder function Disability of Arm Shoulder and Hand (DASH) score and Constant score, complications rate, and second surgical incision length were recorded. Results: The length of the incision was 2–6 cm (average 3.7 cm). All incisions healed by first intention, and no infection or nerve injury occurred. The Constant score was 92–100 (average 96) and the DASH score was 0-6.2 (mean, 2.64). TEN bending and hypertrophic nonunion occurred in one case (3.4%) and implant irritation occurred in four cases (13.8%) Fixation implants were removed at 12–26 months (mean, 14.6 months) after surgery, and the length of the second incision was 1-2.5 cm (average 1.3 cm). Conclusions: Intramedullary fixation by TEN is approved as a suitable surgical technique in clavicular fracture treatment. Nice knot-assisted fixation provides multifragmentary fracture stabilization, contributing to good fracture healing. Surgeons should consider this technique in treating Robinson 2B midshaft clavicular fractures. Trial registration: Retrospectively registered. This study was approved by the Ethics Committee of Wuxi Ninth People's Hospital (LW20220021). [ABSTRACT FROM AUTHOR]

Background: Polycystic kidney disease (PKD) is an inherited disease that is life‐threatening. Multiple cysts are present in the bilateral kidneys of PKD patients. The progressively enlarged cysts cause structural damage and loss of kidney function. Methods: This study examined and analyzed 12 families with polycystic kidney disease. Whole exome sequencing (WES) or whole genome sequencing (WGS) of the probands was performed to detect the pathogenic genes. The candidate gene segments for lineal consanguinity in the family were amplified by the nest PCR followed by Sanger sequencing. The variants were assessed by pathogenic and conservational property prediction analysis and interpreted according to the American College of Medical Genetics and Genomics. Results: Nine of the 12 pedigrees were identified the disease causing variants. Among them, four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) were detected. After assessment, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The detected variants were interpreted. Conclusion: The four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) are pathogenic variants and cause autosomal dominant polycystic kidney disease in family. [ABSTRACT FROM AUTHOR]

Background: Thoracic aortic aneurysm (TAA) occurs due to pathological aortal dilation, and both individuals with normal tricuspid aortic valves (TAV) or abnormal bicuspid aortic valves (BAV), the latter being a congenital condition, are at risk. However, some differences are present between TAA/BAV and TAA/TAV with respect to their pathophysiological processes and molecular mechanisms, but their exact nature is still mostly unknown. Therefore, it is necessary to elucidate TAA developmental differences among BAV vs. TAV patients. Methods: Publically-available gene expression datasets, aortic tissue derived from TAA/BAV and TAA/TAV individuals, were analyzed by weighted gene co-expression network analysis (WGCNA) to identify gene modules associated with those conditions. Gene Ontology (GO) enrichment analysis was performed on those modules to identify the enriched genes within those modules, which were verified by Gene Set Variation Analysis (GSVA) on a dataset derived from aortic smooth muscle cell gene expression between TAA/TAV and TAV/BAV patients. Immune cell infiltration patterns were then analyzed by CIBERSORT, and a protein-protein interaction (PPI) network was constructed based on WGCNA and enrichment analysis results to identify hub genes, followed by validation via stepwise regression analysis. Three signatures most strongly associated with TAA/TAV were confirmed by receiver operating characteristic (ROC) and decision curve analyses (DCA) between prior-established training and testing gene sets. Results: WGCNA delineated 2 gene modules being associated with TAA/TAV vs. TAA/BAV; both were enriched for immune-associated genes, such as those relating to immune responses, etc., under enrichment analysis. TAA/TAV and TAA/BAV tissues also had differing infiltrating immune cell proportions, particularly with respect to dendritic, mast and CD4 memory T cells. Identified three signatures, CD86, integrin beta 2 (ITGB2) and alpha M (ITGAM), as yielding the strongest associations with TAA/TAV onset, which was verified by areas under the curve (AUC) at levels approximating 0.8 or above under ROC analysis, indicating their predictive value for TAA/TAV onset. However, we did not examine possible confounding variables, so there are many alternative explanations for this association. Conclusions: TAA/TAV pathogenesis was found to be more associated with immune-related gene expression compared to TAA/BAV, and the identification of three strongly-associated genes could facilitate their usage as future biomarkers for diagnosing the likelihood of TAA/TAV onset vs. TAA/BAV, as well as for developing future treatments. [ABSTRACT FROM AUTHOR]

Polycystic kidney disease (PKD) is a life-threatening inherited disease with a morbidity of 1:500–1,000 worldwide. Numerous progressively enlarging cysts are observed in the bilateral kidneys of patients with PKD, inducing structural damage and loss of kidney function. The present study analyzed one family with PKD. Whole exome sequencing of the proband was performed to detect the pathogenic gene present in the family. Candidate gene segments for lineal consanguinity in the family were amplified by nest polymerase chain reaction, followed by Sanger sequencing. One novel duplication variant (NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX) and one missense mutation (c.G9022A:p.V3008M) were detected in PKD1. Additionally, the pathogenic substitutions in PKD1 published from the dataset were analyzed. Following analysis and confirmation, the duplication variant NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX in PKD1, within the polycystin-1, lipoxygenase, α-toxin domain, was considered to be the pathogenic factor in the examined family with autosomal dominant PKD. Additionally, based on the analysis of 4,805 pathogenic substitutions in PKD1 within various regions, the presence of the missense mutation in the N-terminal domain of polycystin-1 may present high pathogenicity in ADPKD. [ABSTRACT FROM AUTHOR]

Background: MSM are at high risk of HIV infection. Previous studies have shown that the cell cycle regulation plays an important role in HIV-1 infection, especially at the G2/M checkpoint. ATR, Chk1, Cdc25C and CDK1 are key genes of G2/M checkpoint. However, the association between SNPs of these genes and susceptibility to HIV-1 infection and AIDS progression remains unknown. Methods: In this study, 42 tSNPs from the above four G2/M checkpoint genes were genotyped in 529 MSM and 529 control subjects from northern China to analyze this association. Results: The results showed that rs34660854 A and rs75368165 A in ATR gene and rs3756766 A in Cdc25C gene could increase the risk of HIV-1 infection (P = 0.049, OR = 1.234, 95% CI 1.001–1.521; P = 0.020, OR = 1.296, 95% CI 1.042–1.611; P = 0.011, OR = 1.392, 95% CI 1.080–1.794, respectively), while Chk1 rs10893405 (P = 0.029, OR = 1.629, 95% CI 1.051–2.523) were significantly associated with AIDS progression. Besides, rs34660854 (P = 0.019, OR = 1.364, 95% CI 1.052–1.769; P = 0.022, OR = 1.337, 95% CI 1.042–1.716, under Codominant model and Dominant model, respectively) and rs75368165 (P = 0.006, OR = 1.445, 95% CI = 1.114–1.899; P = 0.007, OR = 1.418, 95% CI 1.099–1.831, under Codominant model and Dominant model, respectively) in ATR gene, rs12576279 (P = 0.013, OR = 0.343, 95% CI 0.147-0.800; P = 0.048, OR = 0.437, 95% CI 0.192–0.991, under Codominant model and Dominant model, respectively) and rs540436 (P = 0.012, OR = 1.407, 95% CI 1.077–1.836; P = 0.021, OR = 1.359, 95% CI 1.048–1.762, under Codominant model and Dominant model, respectively) in Chk1 gene, rs3756766 (P = 0.013, OR = 1.455, 95% CI 1.083–1.954; P = 0.009, OR = 1.460, 95% CI 1.098–1.940, under Codominant model and Dominant model, respectively) in Cdc25C gene and rs139245206 (P = 0.022, OR = 5.011, 95% CI 1.267–19.816; P = 0.020, OR = 5.067, 95% CI 1.286–19.970, under Codominant model and Recessive model, respectively) in CDK1 gene were significantly associated with HIV-1 infection under different models. Conclusions: We found that genetic variants of G2/M checkpoint genes had a molecular influence on the occurrence of HIV-1 infection and AIDS progression in a northern Chinese MSM population. [ABSTRACT FROM AUTHOR]

Background and Aims. Men who have sex with men (MSM) are at high risk of HIV infection. The nonhomologous end joining (NHEJ) pathway is the main way of double-stranded DNA break (DSB) repair in the higher eukaryotes and can repair the DSB timely at any time in cell cycle. It is also indicated that the NHEJ pathway is associated with HIV-1 infection since the DSB in host genome DNA occurs in the process of HIV-1 integration. The aim of the present investigation was to evaluate associations of single-nucleotide polymorphisms (SNPs) in NHEJ pathway genes with susceptibility to HIV-1 infection and AIDS progression among MSM residing in northern China. Methods. A total of 481 HIV-1 seropositive men and 493 HIV-1 seronegative men were included in this case-control study. Genotyping of 22 SNPs in NHEJ pathway genes was performed using the SNPscan™ Kit. Results. Positive associations were observed between XRCC6 rs132770 and XRCC4 rs1056503 genotypes and the susceptibility to HIV-1 infection. In gene-gene interaction analysis, significant SNP-SNP interactions of XRCC6 and XRCC4 genetic variations were found to play a potential role in the risk of HIV-1 infection. In stratified analysis, XRCC5 rs16855458 was significantly associated with CD4+ T cell counts in AIDS patients, whereas LIG4 rs1805388 was linked to the clinical phases of AIDS patients. Conclusions. NHEJ gene polymorphisms can be considered to be risk factors of HIV-1 infection and AIDS progression in the northern Chinese MSM population. [ABSTRACT FROM AUTHOR]

• Gustilo grades IIIB/C open tibial fractures are severe and require aggressive, multidisciplinary management. • Large tibial defects combined with large soft tissue defects are challenging problems in clinical practice. • This study compared the effects of MFFT and IBTT by retrospectively analysing clinical data. • For open tibial and soft tissue defects in Gustilo IIIB/C fractures, MFFT should be the first treatment choice if the surgeon has a high level of microsurgical skills. • MFFT achieves faster healing, less discomfort, and may be better appearance within the bone and soft tissue defect. The treatment of bone and soft-tissue defects after open fractures remains challenging. This study aimed to evaluate the clinical efficacy of the Masquelet technique combined with the free-flap technique (MFFT) versus the Ilizarov bone transport technique (IBTT) for the treatment of severe composite tibial and soft-tissue defects. We retrospectively analysed the data of 65 patients with tibial and soft-tissue defects and Gustilo type IIIB/C open fractures treated at our hospital between April 2015 and December 2021. The patients were divided into two groups based on the treatment method: group A (n = 35) was treated with the MFFT and internal fixation, and group B (n = 30) was treated with the IBTT. The mean follow-up period was 28 months (range 13–133 months). Complete union of both soft-tissue and bone defects was achieved in all cases. The mean bone-union times were 6 months (range 3–12 months) in group A and 11 months (range 6–23 month) in group B, with a significant difference between the two groups (Z = –4.11, P = 0.001). The mean hospital stay was 28 days (range 14–67 d) in group A which was significantly longer than the mean stay of 18 days (range 10–43 d) in group B (Z = –2.608, P = 0.009). There were no significant differences in the infection rate between group A (17.1 %) and group B (26.7%) (χ2 = 0.867, P = 0.352). The Total Physical Health Scores were 81.51 ± 6.86 (range 67–90) in group A and 75.83±16.14 (range 44–98) in group B, with no significant difference between the two groups (t = 1.894, P = 0.063). The Total Mental Health Scores were significantly higher in group A (90.49 ± 6.37; range 78–98) than in group B (84.70 ± 13.72; range 60–98) (t = 2.232, P = 0.029). Compared with IBTT, MFFT is a better choice of treatment for open tibial and soft-tissue defects with Gustilo IIIB/C fractures. IBTT is the preferred option when the tibial bone defect is large or if the surgeon's expertise in microsurgery is limited. [ABSTRACT FROM AUTHOR]

Irisin, a myokine derived from proteolytic cleavage of the fibronectin type III domain-containing protein 5 (FNDC5) protein, is crucial in protecting tissues and organs from ischemia-reperfusion (I/R) injury. However, the underlying mechanism of its action remains elusive. In this study, we investigated the expression patterns of genes associated with FNDC5 knockout to gain insights into its molecular functions. We employed a mouse model of skeletal muscle I/R injury with FNDC5 knockout to examine the transcriptional profiles using RNA sequencing. Differentially expressed genes (DEGs) were identified and subjected to further analyses, including gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment, protein-protein interaction (PPI) network analysis, and miRNA-transcription factor network analysis. The bioinformatics findings were validated using qRT-PCR and Western blotting. Comparative analysis of skeletal muscle transcriptomes between wild-type (WT; C57BL/6), WT-I/R, FNDC5 knockout (KO), and KO-I/R mice highlighted the significance of FNDC5 in both physiological conditions and I/R injury. Through PPI network analysis, we identified seven key genes (Col6a2, Acta2, Col4a5, Fap, Enpep, Mmp11, and Fosl1), which facilitated the construction of a TF-hub genes-miRNA regulatory network. Additionally, our results suggested that the PI3K-Akt pathway is predominantly involved in FNDC5 deletion-mediated I/R injury in skeletal muscle. Animal studies revealed reduced FNDC5 expression in skeletal muscle following I/R injury, and the gastrocnemius muscle with FNDC5 knockout exhibited larger infarct size and more severe tissue damage after I/R. Moreover, Western blot analysis confirmed the upregulation of Col6a2, Enpep, and Mmp11 protein levels following I/R, particularly in the KO-I/R group. Furthermore, FNDC5 deletion inhibited the PI3K-Akt signaling pathway. This study demonstrates that FNDC5 deletion exacerbates skeletal muscle I/R injury, potentially involving the upregulation of Col6a2, Enpep, and Mmp11. Additionally, the findings suggest the involvement of the PI3K-Akt pathway in FNDC5 deletion-mediated skeletal muscle I/R injury, providing novel insights into the molecular mechanisms underlying FNDC5's role in this pathological process. • Our study revealed 102 differentially expressed genes associated with FNDC5 knockout and highlighted seven essential genes (Col6a2, Acta2, Col4a5, Fap, Enpep, Mmp11, and Fosl1) through bioinformatics analysis. • FNDC5 knockout significantly exacerbated skeletal muscle injury, potentially by upregulating the expression of Col6a2, Enpep, and Mmp11. • Moreover, we revealed the importance of the PI3K-Akt signaling pathway in regulating skeletal muscle I/R injury by FNDC5. [ABSTRACT FROM AUTHOR]

Progressive familial intrahepatic cholestasis type 3 (PFIC3) is a hepatic disorder occurring predominantly in childhood and is difficult to diagnose. PFIC3, being a rare autosomal recessive disease, is caused by genetic mutations in both alleles of ABCB4, resulting in the disruption of the bile secretory pathway. The identification of pathogenic effects resulting from different mutations in ABCB4 is the key to revealing the internal cause of disease. These mutations cause truncation, instability, misfolding, and impaired trafficking of the MDR3 protein. Here, we reported a girl, with a history of intrahepatic cholestasis and progressive liver cirrhosis, with an elevated gamma-glutamyltransferase level. Genetic screening via whole exome sequencing found a novel homozygous missense mutation ABCB4:c.1195G>C:p.V399L, and the patient was diagnosed with PFIC3. Various computational tools predicted the variant to be deleterious and evolutionary conserved. For functional characterization studies, plasmids, encoding ABCB4 wild-type and selected established mutant constructs, were expressed in human embryonic kidney (HEK-293T) and hepatocellular carcinoma (HepG2) cells. In vitro expression analysis observed a reduced expression of mutant protein compared to wild-type protein. We found that ABCB4 wild type was localized at the apical canalicular membrane, while mutant p.V399L showed intracellular retention. Intracellular mistrafficking proteins usually undergo proteasomal or lysosomal degradation. We found that after treatment with proteasomal inhibitor MG132 and lysosomal inhibitor bafilomycin A1, MDR3 expression of V399L was significantly increased. A decrease in MDR3 expression of mutant V399L protein may be a result of proteasomal or lysosomal degradation. Pharmacological modulator cyclosporin A and intracellular low temperature (30°C) treatment significantly rescued both the folding defect and the active maturation of the mutant protein. Our study identified a novel pathogenic mutation which expanded the mutational spectrum of the ABCB4 gene and may contribute to understanding the molecular basis of PFIC3. Therefore, genetic screening plays a conclusive role in the diagnosis of rare heterogenic disorders like PFIC3. [ABSTRACT FROM AUTHOR]

Lynch syndrome (LS) is the most common hereditary colorectal cancer (CRCs) inherited in an autosomal-dominant manner. Here, we reported a multigeneration Chinese family clinically diagnosed with LS according to the Amsterdam II criteria. To identify the underlying causative gene for LS in this family, whole-exome sequencing (WES) was performed. A germline missense variant (c.2054C>T:p.S685F) in exon 18 of MLH1 was successfully identified by WES. Sanger sequencing verified the results of WES and also confirmed the cosegregation of the MLH1 missense variant in all affected members of the family including two unaffected family members. Bioinformatic tools predicted the identified MLH1 variant as deleterious. Immunohistochemistry (IHC) staining showed loss of MLH1 and PMS2 protein expression. In vitro expression analysis also revealed that the identified MLH1 missense variant (c.2054C>T:p.S685F) results in reduced expression of both MLH1 and PMS2 proteins. Based on the American College of Medical Genetics and Genomics (ACMG) guidelines, the missense mutation c.2054C>T in MLH1 was classified as a "pathogenic" variant. Two unaffected family members were later recommended for colonoscopy and other important cancer diagnostic inspections every 1-2 years as both were at higher risk of LS. In conclusion, our findings widen the genotypic spectrum of MLH1 mutations responsible for LS. This study increases the phenotypic spectrum of LS which will certainly help the clinicians in diagnosing LS in multigeneration families. This study also puts emphasis on the importance of genetic counselling for the benefit of asymptomatic carriers of MMR gene variants who are at higher risk of LS. [ABSTRACT FROM AUTHOR]

Background: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1. [ABSTRACT FROM AUTHOR]

Background: Previous studies reported that DNA damage repair (DDR) genes may play an important role in HIV-1 infection. The MRE11 gene, a member of the MRN complex, plays an essential part in the homologous recombination pathway, which is one of the classical DDR pathways. Previous reports have demonstrated that MRE11 has an effect on HIV-1 replication. However, the role of SNPs in the MRE11 gene and their impact on HIV-1 infection and AIDS progression remain unknown.Methods: In this study, 434 MSM HIV-1-infected patients in northern China and 431 age-matched healthy controls were enrolled. Five SNPs (rs2155209, rs10831234, rs13447720, rs601341 and rs11020803) at the MRE11 gene were genotyped. Another series of cases (409 MSM HIV-1-infected patients) and controls (403 age-matched healthy males) were recruited as the validation set.Results: In our study, rs10831234 showed differences in allele frequencies between cases and controls (P = 0.005). Additionally, there was an association between rs10831234 and HIV-1 infection susceptibility in dominant and additive models (P = 0.005 and P = 0.006, respectively). All significant associations were replicated in the validation set, and the associations were still significant after Bonferroni correction for multiple testing when the two data sets were combined. Furthermore, in haplotype association analyses between the case and control groups, the frequencies of the haplotypes Crs11020803Crs10831234 and Trs11020803Trs10831234 showed significant differences (P = 0.0181 and P = 0.0068, respectively).Conclusions: We demonstrated that the MRE11 rs10831234-T allele may confer increased risk of HIV-1 infection. [ABSTRACT FROM AUTHOR]

Abstract Psoriasis is a chronic immune-mediated disease with a complex etiology involving various genetic and immunological factors as well as environmental factors. Psoriasis is thought to be mediated by T-cells polarized to a Th17 fate. PTPN2 encodes the T-cell protein tyrosine phosphatase, which acts as a negative regulator of the JAK/STAT signaling pathways downstream of cytokines and plays a prominent role in T-cell activation, signaling and/or effector function. To evaluate the association between PTPN2 gene polymorphisms and psoriasis in the Northeastern Chinese population. A case-control study was conducted, and 398 patients with psoriasis and 397 healthy controls were genotyped for thirteen genetic polymorphisms in PTPN2. Allele analysis revealed that rs2847297, rs657555 and rs482160 polymorphisms were significantly associated with psoriasis (p = 0.0018, p = 0.0017 and p = 0.0086, respectively). Genotype analysis also revealed that these polymorphisms were significantly associated with psoriasis under different models (codominant, dominant and recessive models) (p < 0.05). In this study, three haplotypes (H1, H7 and H11) were also found to be associated with psoriasis (p = 0.0015, p = 0.0094, and p = 0.0124, respectively). These results indicate that PTPN2 genetic polymorphisms are associated with psoriasis in the Northeastern Chinese population. [ABSTRACT FROM AUTHOR]

Men who have sex with men (MSM) are at high risk of HIV infection. The APOBEC3G (apolipoprotein B mRNA editing catalytic polypeptide 3G) protein is a component of innate antiviral immunity that inhibits HIV-1 replication. In the present study, a total of 483 HIV-1 seropositive men and 493 HIV-1 seronegative men were selected to investigate the association between single nucleotide polymorphisms (SNPs) of the APOBEC3G gene and susceptibility to HIV-1 infection and AIDS progression among MSM residing in northern China. Genotyping of four SNPs (rs5757465, rs3736685, rs8177832, and rs2899313) of the APOBEC3G was performed using the SNPscan™ Kit, while the rs2294367 polymorphism was genotyped using the SNaPshot multiplex system. Our results disclosed no association between the SNPs of APOBEC3G and susceptibility to HIV-1, or effects of these polymorphisms on the CD4 T cell count or clinical phase of disease. A meta-analysis of 1624 men with HIV-1 infection and 1523 controls suggested that the association between rs8177832 and susceptibility was not significant. However, we observed a trend towards association with HIV-1 infection for haplotype TTACA ( p = 0.082). The potential role of variants of APOBEC3G in HIV-1/AIDS warrants further investigation. [ABSTRACT FROM AUTHOR]

It has been reported that DNA repair genes play an important role in HIV-1 infection and AIDS progression. One DNA repair pathway, the mismatch repair (MMR) is associated with a wide variety of tumors. However, the role of single nucleotide polymorphisms (SNPs) in the MMR genes and their importance in HIV-1 infection and AIDS progression remain unclear. In the present study, 479 HIV-1-infected and 487 healthy individuals from northern China were genotyped for nine SNPs in the MSH2 gene (rs13019654, rs4608577, rs4952887, rs6726691, rs10191478, rs12999145, rs1981929, rs2042649, rs2303428) and five SNPs in the MSH6 gene (rs2348244, rs3136245, rs3136329, rs2072447, rs7562048). Our results showed that the rs7562048 G allele frequency was significantly higher in the cases with the CD4 + T-lymphocyte count < 200 cells/μl than those with > 200 cells/μl ( P = 0.001, OR = 1.811, 95% CI 1.255–2.614), which is in agreement with the result of the Bonferroni correction. The frequencies of the rs2348244 C allele and rs3136245 T allele were higher in the cases at clinical phase IV than those at clinical phase I + II + III ( P = 0.026, OR = 1.591, 95% CI 1.056–2.398 and P = 0.019, OR = 1.749, 95% CI 1.096–2.791, respectively); however, this difference is not supported by the Bonferroni correction. There were no significant differences in the frequency of allele, genotype and haplotype of the 14 SNPs between HIV-1-infected individuals and healthy controls ( P > 0.05). These results suggest that the rs7562048 is associated with the clinical features and that the MSH6 gene polymorphisms likely play an important role in the progression of AIDS in the northern Chinese population. [ABSTRACT FROM AUTHOR]

The Dybowski's frog ( Rana dybowskii) is mainly distributed in northeast China and the Russian Far East. Its dried oviduct, or frog oil, has been used in traditional Chinese medicine for thousands of years. Frogs from different geographic regions exhibit variations in their body mass and oil productivity. As a result, farmers usually import high quality breeding stock from different areas to increase oviduct productivity. This practice could alter the genetic structure of the frog populations. We used 10 microsatellite loci to investigate the level of genetic variation for 10 frog populations in the context of human-mediated disturbance. The study populations comprised the following: the Hebei, Tieli, and Jiamusi populations from the Lesser Khingan Mountains; the Mudanjiang, Jilin, Jiaohe, and Huadian populations from the north central Changbai Mountains; and the Tonghua, Benxi, and Xiuyan populations from the southern Changbai Mountains. Our results showed that the 3 Lesser Khingan Mountain populations exhibited highly significant differentiation values ( FST = 0.047-0.071, P < 0.001). In addition, the Tonghua population differentiated significantly from the other 6 populations of the Changbai Mountains ( P < 0.001). The genetic differentiation coefficient ( FST) and gene flow ( Nem) estimates showed that the Benxi and Jiaohe populations had a high degree of genetic similarity despite being geographically separated by mountains and river systems. We obtained similar results for the Xiuyan and Tieli populations. Furthermore, the degree of gene flow between the Jiamusi and the north central Changbai Mountain populations was greater than that observed between the Jiamusi and the other Lesser Khingan Mountain populations. These results therefore suggest that the Benxi, Xiuyan, and Jiamusi populations have undergone substantial intermixing because of human-mediated relocation. Economic demands make completely stopping the geographical relocation of Dybowski's frog in northeast China virtually impossible. Consequently, effective management strategies are now a high priority to ensure that conservationists and local economies can work together to guarantee the long-term survival of this species. © 2013 The Wildlife Society. [ABSTRACT FROM AUTHOR]

Background: Heilongjiang Province located in northeast China is a multi-ethnic region with people who have lived in cold conditions for several generations. Fatty acids are important to people with cold resistance. CPT1A encodes a protein that imports long-chain fatty acids into the mitochondria for fatty-acid oxidation. FADS is an essential enzyme for the synthesis of long-chain polyunsaturated fatty acids. Results: In the present study, we investigated the distributions of three cold resistance-related SNPs (rs80356779 G > A in CPT1A, rs7115739 T > G in FADS3 and rs174570 C > T in FADS2) from six populations that included 1093 individuals who have lived in Heilongjiang Province for at least three generations. The frequencies of rs174570 and rs7115739 were different in our six north minorities compared to the Chinese Dai in Xishuangbanna (CDX) in southern China. All the SNPs in Hezhen were significantly different from other five studied populations. In addition, the genetic distribution of rs174570 in Daur was significantly different from Manchu and Korea, and the frequency of rs7115739 in Ewenki was significantly different from the other populations. The results also showed that the frequencies of the three SNPs in the six minorities were different from those of Greenlandic Inuit and Siberian population. Conclusions: Our results showed the distributions of the three cold resistance-related SNPs from six populations that included 1093 individuals in northern China. Distributions of the allele frequencies for the cold resistance-related SNPs in northern China were statistically different from those in southern China. These data help to establish the DNA genome database for the six populations and fully preserve existing minority genetic information. [ABSTRACT FROM AUTHOR]