Search

Watermelon ( Citrullus lanatus ) and melon ( Cucumis melo ) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies ( Bemisia tabaci ) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus ( Opuntia auberi ) from Sonora, Mexico, and from one cactus ( O. cochenillifera ), lamb's ears ( Stachys byzantine ), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

Impatiens necrotic spot virus (INSV; Order Bunyavirales, Family Tospoviridae) is transmitted by several thrips species and has emerged as an important pathogen of lettuce (Lactuca sativa) in several countries (Beris et al., 2020 and Hasegawa & Del Pozo-Valdivia, 2023). In 2023, a total of 22,092 hectares of lettuce were planted in Mexico, with a total production of 523,739 tons (Agri-Food and Fisheries Information Service, 2024). In the last several years, increased outbreaks of a disease showing virus-like symptoms have emerged in lettuce in central Mexico. In all cases, plants exhibited symptoms of yellowing, brown necrotic spots and ringspots on the leaves and midribs, and reduced growth. In fall 2023, symptoms were observed in 12 iceberg lettuce fields, with incidences between 5-70% in the municipality of Tenango del Valle, in the state of Mexico. 18 plants collected from 6 fields were initially tested for the presence of two thrips-transmitted viruses, INSV and tomato spotted wilt virus (TSWV) using ImmunoStrips (Agdia Inc., Elkhart, Indiana), which indicated positive results for INSV in 16 plants and TSWV in 2 plants. None of the plants tested positive for both viruses. Follow up sampling was conducted, which included a total of 17 symptomatic lettuce plants from three fields in October 2023, while an additional 11 lettuce plants were collected from Tepeaca, in the neighboring state of Puebla in March 2024. DAS-ELISA confirmed the presence of INSV in 13/17 plants and TSWV in 2/17 plants from Tenango del Valle, while only INSV was detected in the 11 plants from Tepeaca. Based on ELISA, none of the lettuce samples were co-infected by INSV and TSWV, which was similarly observed in California and Greece (Koike et al., 2008 and Beris et al., 2020). Initially, RNA was purified from 3 plants (two from Tenango del Valle, one from Tepeaca) reverse-transcribed, and PCR amplified with primers to the N gene of the INSV S RNA, as previously described (Hasegawa et al., 2022). All three reactions produced a single expected amplicon of 524 bp and were confirmed by bi-directional Sanger sequencing (MCLab, South San Francisco, CA). To obtain the full-length sequences for the N and NSm genes, RNA from a fourth sample (Tenango del Valle) was amplified with primers (Kuo et al., 2014), and Sanger sequenced. The 789 bp N gene (PP726902) shared >99% nucleotide and amino acid identity to the corresponding region of the INSV isolate from orchid in California (KF926828), while the 912 bp NSm gene (PP726901) shared >98% nucleotide and amino acid identity to the INSV isolate from basil in Washington (KX790322). Additionally, all four samples showed >99.5% similarity to one another. INSV was previously reported to affect other crops in Mexico, including tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) (González-Pacheco and Silva-Rosales, 2013), while TSWV has been reported to infect lettuce (Moreno et al., 2016). To our knowledge, this is the first report of INSV infecting lettuce in Mexico and was the dominant orthotospovirus in lettuce samples that were tested. INSV should be closely monitored throughout central Mexico, where majority of lettuce production occurs. Additional studies are warranted to identify the thrips vector species that are present, and to understand the role of crop and non-crop hosts in the epidemiology of INSV throughout the region.

The transcription factor EHF is highly expressed in the lactating mammary gland, but its role in mammary development and tumorigenesis is not fully understood. Utilizing a mouse model of Ehf deletion, herein, we demonstrate that loss of Ehf impairs mammary lobuloalveolar differentiation at late pregnancy, indicated by significantly reduced levels of milk genes and milk lipids, fewer differentiated alveolar cells, and an accumulation of alveolar progenitor cells. Further, deletion of Ehf increased proliferative capacity and attenuated prolactin-induced alveolar differentiation in mammary organoids. Ehf deletion also increased tumor incidence in the MMTV-PyMT mammary tumor model and increased the proliferative capacity of mammary tumor organoids, while low EHF expression was associated with higher tumor grade and poorer outcome in luminal A and basal human breast cancers. Collectively, these findings establish EHF as a non-redundant regulator of mammary alveolar differentiation and a putative suppressor of mammary tumorigenesis., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2024 The Author(s). Published by Elsevier Inc. All rights reserved.)

Sugar beet ( Beta vulgaris ) is grown in temperate regions around the world as a source of sucrose used for natural sweetening. Sugar beet is susceptible to a number of viral diseases, but identification of the causal agent(s) under field conditions is often difficult due to mixtures of viruses that may be responsible for disease symptoms. In this study, the application of RNAseq to RNA extracted from diseased sugar beet roots obtained from the field and from greenhouse-reared plants grown in soil infested with the virus disease rhizomania (causal agent beet necrotic yellow vein virus; BNYVV) yielded genome-length sequences from BNYVV, as well as beet soil-borne virus (BSBV). The nucleotide identities of the derived consensus sequence of BSBV RNAs ranged from 99.4 to 96.7% (RNA1), 99.3 to 95.3% (RNA2), and 98.3 to 95.9% (RNA3) compared with published BSBV sequences. Based on the BSBV genome consensus sequence, clones of the genomic RNAs 1, 2, and 3 were obtained to produce RNA copies of the genome through in vitro transcription. Capped RNA produced from the clones was infectious when inoculated into leaves of Chenopodium quinoa and B. vulgaris , and extracts from transcript-infected C. quinoa leaves could infect sugar beet seedling roots through a vortex inoculation method. Subsequent exposure of these infected sugar beet seedling roots to aviruliferous Polymyxa betae , the protist vector of both BNYVV and BSBV, confirmed that BSBV derived from the infectious clones could be transmitted by the vector. Co-inoculation of BSBV synthetic transcripts with transcripts of a cloned putative satellite virus designated Beta vulgaris satellite virus 1A (BvSat1A) resulted in the production of lesions on leaves of C. quinoa similar to those produced by inoculation with BSBV alone. Nevertheless, accumulation of genomic RNA and the encoded protein of the satellite virus in co-inoculated leaves was readily detected on Northern and Western blots, respectively, whereas no accumulation of satellite virus products occurred when satellite virus RNA was inoculated alone. The predicted sequence of the detected protein encoded by BvSat1A bears hallmarks of coat proteins of other satellite viruses, and virions of a size consistent with a satellite virus were observed in samples testing positive for the virus. The results demonstrate that BSBV is a helper virus for the novel satellite virus BvSat1A., Competing Interests: The author(s) declare no conflict of interest.

Metastatic BRAF V600E colorectal cancer (CRC) carries an extremely poor prognosis and is in urgent need of effective new treatments. While the BRAF V600E inhibitor encorafenib in combination with the EGFR inhibitor cetuximab (Enc+Cet) was recently approved for this indication, overall survival is only increased by 3.6 months and objective responses are observed in only 20% of patients. We have found that a limitation of Enc+Cet treatment is the failure to efficiently induce apoptosis in BRAF V600E CRCs, despite inducing expression of the pro-apoptotic protein BIM and repressing expression of the pro-survival protein MCL-1. Here, we show that BRAF V600E CRCs express high basal levels of the pro-survival proteins MCL-1 and BCL-X L , and that combining encorafenib with a BCL-X L inhibitor significantly enhances apoptosis in BRAF V600E CRC cell lines. This effect was partially dependent on the induction of BIM, as BIM deletion markedly attenuated BRAF plus BCL-X L inhibitor-induced apoptosis. As thrombocytopenia is an established on-target toxicity of BCL-X L inhibition, we also examined the effect of combining encorafenib with the BCL-X L -targeting PROTAC DT2216, and the novel BCL-2/BCL-X L inhibitor dendrimer conjugate AZD0466. Combining encorafenib with DT2216 significantly increased apoptosis induction in vitro, while combining encorafenib with AZD0466 was well tolerated in mice and further reduced growth of BRAF V600E CRC xenografts compared to either agent alone. Collectively, these findings demonstrate that combined BRAF and BCL-X L inhibition significantly enhances apoptosis in pre-clinical models of BRAF V600E CRC and is a combination regimen worthy of clinical investigation to improve outcomes for these patients., (© 2024. The Author(s).)

Autophagy-related genes have been closely associated with intestinal homeostasis. BECLIN1 is a component of Class III phosphatidylinositol 3-kinase complexes that orchestrate autophagy initiation and endocytic trafficking. Here we show intestinal epithelium-specific BECLIN1 deletion in adult mice leads to rapid fatal enteritis with compromised gut barrier integrity, highlighting its intrinsic critical role in gut maintenance. BECLIN1-deficient intestinal epithelial cells exhibit extensive apoptosis, impaired autophagy, and stressed endoplasmic reticulum and mitochondria. Remaining absorptive enterocytes and secretory cells display morphological abnormalities. Deletion of the autophagy regulator, ATG7, fails to elicit similar effects, suggesting additional novel autophagy-independent functions of BECLIN1 distinct from ATG7. Indeed, organoids derived from BECLIN1 KO mice show E-CADHERIN mislocalisation associated with abnormalities in the endocytic trafficking pathway. This provides a mechanism linking endocytic trafficking mediated by BECLIN1 and loss of intestinal barrier integrity. Our findings establish an indispensable role of BECLIN1 in maintaining mammalian intestinal homeostasis and uncover its involvement in endocytic trafficking in this process. Hence, this study has important implications for our understanding of intestinal pathophysiology., (© 2024. The Author(s).)

High-fat (HF) diets (HFDs) and inflammation are risk factors for colon cancer; however, the underlying mechanisms remain to be fully elucidated. The transcriptional corepressor HDAC3 has recently emerged as a key regulator of intestinal epithelial responses to diet and inflammation with intestinal-specific Hdac3 deletion ( Hdac3 IKO ) in mice increasing fatty acid oxidation genes and the rate of fatty acid oxidation in enterocytes. Hdac3 IKO mice are also predisposed to experimentally induced colitis; however, whether this is driven by the intestinal metabolic reprogramming and whether this predisposes these mice to intestinal tumorigenesis is unknown. Herein, we examined the effects of intestinal-specific Hdac3 deletion on colitis-associated intestinal tumorigenesis in mice fed a standard (STD) or HFD. Hdac3 IKO mice were highly prone to experimentally induced colitis, which was further enhanced by an HFD. Hdac3 deletion also accelerated intestinal tumor development, specifically when fed an HFD and most notably in the small intestine where lipid absorption is maximal. Expression of proteins involved in fatty acid metabolism and oxidation (SCD1, EHHADH) were elevated in the small intestine of Hdac3 IKO mice fed an HFD, and these mice displayed increased levels of lipid peroxidation, DNA damage, and apoptosis in their villi, as well as extensive expansion of the stem cell and progenitor cell compartment. These findings reveal a novel role for Hdac3 in suppressing colitis and intestinal tumorigenesis, particularly in the context of consumption of an HFD, and reveal a potential mechanism by which HFDs may increase intestinal tumorigenesis by increasing fatty acid oxidation, DNA damage, and intestinal epithelial cell turnover. NEW & NOTEWORTHY We reveal a novel role for the transcriptional corepressor Hdac3 in suppressing colitis and intestinal tumorigenesis, particularly in the context of consumption of an HFD, and reveal a potential mechanism by which HFDs may increase intestinal tumorigenesis by increasing fatty acid oxidation, DNA damage, and intestinal epithelial cell turnover. We also identify a unique mouse model for investigating the complex interplay between diet, metabolic reprogramming, and tumor predisposition in the intestinal epithelium.

Viruses transmitted by the whitefly ( Bemisia tabaci ) are an increasing threat to cucurbit production in the southwestern United States and many other cucurbit production regions of the world. The crinivirus cucurbit yellow stunting disorder virus (CYSDV) has severely impacted melon production in California and Arizona since its 2006 introduction to the region. Within the past few years, another crinivirus, cucurbit chlorotic yellows virus (CCYV), and the whitefly-transmitted ipomovirus squash vein yellowing virus (SqVYV) were found infecting melon plants in California's Imperial Valley. CYSDV, CCYV, and an aphid-transmitted polerovirus, cucurbit aphid-borne yellows virus (CABYV), occur together in the region and produce identical yellowing symptoms on cucurbit plants. Mixed infections of these four viruses in the Sonoran Desert and other regions pose challenges for disease management and efforts to develop resistant varieties. A multiplex single-step RT-PCR method was developed that differentiates among these viruses, and this was used to determine the prevalence and distribution of the viruses in melon samples from fields in the Sonoran Desert melon production region of California and Arizona during the spring and fall melon seasons from 2019 through 2021. TaqMan probes were developed, optimized, and applied in a single-step multiplex RT-qPCR to quantify titers of these four viruses in plant samples, which frequently carry mixed infections. Results of the multiplex RT-PCR analysis demonstrated that CYSDV is the predominant virus during the fall, whereas CCYV was by far the most prevalent virus during the spring each year. Multiplex RT-qPCR was used to evaluate differential accumulation and spatiotemporal distribution of viruses within plants and suggested differences in competitive accumulation of CCYV and CYSDV within melon. This study provides the first official report of SqVYV in Arizona and offers an efficient method for virus detection and quantification for breeding and disease management in areas impacted by cucurbit yellowing viruses., Competing Interests: The author(s) declare no conflict of interest.

Climate change is causing mean sea surface temperatures (SST) to increase worldwide. However, this increase has not been temporally or spatially uniform, with variations observed depending both on the period considered and the geographic region. In this context, this paper aims to quantify relevant changes in SST along the Western Iberian Coast over the last four decades, through the calculation of trends and anomalies of long-term time series of in situ observations and satellite-derived data. Potential drivers of SST changes were considered using atmospheric and teleconnections time series. Changes in the seasonal cycle of SST were also evaluated. We show that SST has increased since 1982, with regional variations between 0.10 and 0.25 °C per decade, with an increase in air temperature appearing to drive the SST trends along the Iberian coast. In the near-shore area, no significant trends or changes in the seasonal cycle of SST were observed, which is likely due to a buffer effect caused by the seasonal upwelling that characterizes the region. Recent decades show a slowdown in the increase rate of SST along the Western Iberian Coast. An upwelling intensification could justify this observation, along with the effect of teleconnections on the regional climate, such as the North Atlantic Oscillation (NAO) and the Western Mediterranean Oscillation Index (WeMOI). Our results suggest that the WeMOI plays a more important role in coastal SST variability than the other teleconnections. The present study quantifies regional changes in SST and enhances knowledge of the role of ocean-atmosphere interactions in regulating climate and weather conditions. Moreover, it provides a relevant scientific context to the development of regional adaptative and mitigation actions in response to climate change., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 The Authors. Published by Elsevier B.V. All rights reserved.)

The EGFR/RAS/MEK/ERK signaling pathway (ERK/MAPK) is hyperactivated in most colorectal cancers. A current limitation of inhibitors of this pathway is that they primarily induce cytostatic effects in colorectal cancer cells. Nevertheless, these drugs do induce expression of proapoptotic factors, suggesting they may prime colorectal cancer cells to undergo apoptosis. As histone deacetylase inhibitors (HDACis) induce expression of multiple proapoptotic proteins, we examined whether they could synergize with ERK/MAPK inhibitors to trigger colorectal cancer cell apoptosis. Combined MEK/ERK and HDAC inhibition synergistically induced apoptosis in colorectal cancer cell lines and patient-derived tumor organoids in vitro, and attenuated Apc-initiated adenoma formation in vivo. Mechanistically, combined MAPK/HDAC inhibition enhanced expression of the BH3-only proapoptotic proteins BIM and BMF, and their knockdown significantly attenuated MAPK/HDAC inhibitor-induced apoptosis. Importantly, we demonstrate that the paradigm of combined MAPK/HDAC inhibitor treatment to induce apoptosis can be tailored to specific MAPK genotypes in colorectal cancers, by combining an HDAC inhibitor with either an EGFR, KRASG12C or BRAFV600 inhibitor in KRAS/BRAFWT; KRASG12C, BRAFV600E colorectal cancer cell lines, respectively. These findings identify a series of ERK/MAPK genotype-tailored treatment strategies that can readily undergo clinical testing for the treatment of colorectal cancer., (©2022 The Authors; Published by the American Association for Cancer Research.)

Colorectal cancers (CRCs) often display histological features indicative of aberrant differentiation but the molecular underpinnings of this trait and whether it directly drives disease progression is unclear. Here, we identify co-ordinate epigenetic inactivation of two epithelial-specific transcription factors, EHF and CDX1, as a mechanism driving differentiation loss in CRCs. Re-expression of EHF and CDX1 in poorly-differentiated CRC cells induced extensive chromatin remodelling, transcriptional re-programming, and differentiation along the enterocytic lineage, leading to reduced growth and metastasis. Strikingly, EHF and CDX1 were also able to reprogramme non-colonic epithelial cells to express colonic differentiation markers. By contrast, inactivation of EHF and CDX1 in well-differentiated CRC cells triggered tumour de-differentiation. Mechanistically, we demonstrate that EHF physically interacts with CDX1 via its PNT domain, and that these transcription factors co-operatively drive transcription of the colonic differentiation marker, VIL1. Compound genetic deletion of Ehf and Cdx1 in the mouse colon disrupted normal colonic differentiation and significantly enhanced colorectal tumour progression. These findings thus reveal a novel mechanism driving epithelial de-differentiation and tumour progression in CRC., (© 2022. The Author(s).)

Background: Mutations and fusions in Fibroblast Growth Factor Receptor 3 (FGFR3) occur in 10-20% of metastatic urothelial carcinomas and confer sensitivity to FGFR inhibitors. However, responses to these agents are often short-lived due to the development of acquired resistance. The objective of this study was to identify mechanisms of resistance to FGFR inhibitors in two previously uncharacterised bladder cancer cell lines harbouring FGFR3 fusions and assess rational combination therapies to enhance sensitivity to these agents., Methods: Acquired resistance to FGFR inhibitors was generated in two FGFR3 fusion harbouring cell lines, SW780 (FGFR3-BAIAP2L1 fusion) and RT4 (FGFR3-TACC3 fusion), by long-term exposure to the FGFR inhibitor BGJ398. Changes in levels of receptor tyrosine kinases were assessed by phospho-RTK arrays and immunoblotting. Changes in cell viability and proliferation were assessed by the Cell-Titre Glo assay and by propidium iodide staining and FACS analysis., Results: Long term treatment of FGFR3-fusion harbouring SW780 and RT4 bladder cancer cell lines with the FGFR inhibitor BGJ398 resulted in the establishment of resistant clones. These clones were cross-resistant to the clinically approved FGFR inhibitor erdafitinib and the covalently binding irreversible FGFR inhibitor TAS-120, but remained sensitive to the MEK inhibitor trametinib, indicating resistance is mediated by alternate activation of MAPK signalling. The FGFR inhibitor-resistant SW780 and RT4 lines displayed increased expression of pERBB3, and strikingly, combination treatment with an FGFR inhibitor and the ATP-competitive pan-ERBB inhibitor AZD8931 overcame this resistance. Notably, rapid induction of pERBB3 and reactivation of pERK also occurred in parental FGFR3 fusion-driven lines within 24 h of FGFR inhibitor treatment, and combination treatment with an FGFR inhibitor and AZD8931 delayed the reactivation of pERBB3 and pERK and synergistically inhibited cell proliferation., Conclusions: We demonstrate that increased expression of pERBB3 is a key mechanism of adaptive resistance to FGFR inhibitors in FGFR3-fusion driven bladder cancers, and that this also occurs rapidly following FGFR inhibitor treatment. Our findings demonstrate that resistance can be overcome by combination treatment with a pan-ERBB inhibitor and suggest that upfront combination treatment with FGFR and pan-ERBB inhibitors warrants further investigation for FGFR3-fusion harbouring bladder cancers., (© 2022. The Author(s).)

Introduction/aims: Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative illness with great unmet patient need. We aimed to evaluate whether mesenchymal stem cells induced to secrete high levels of neurotrophic factors (MSC-NTF), a novel autologous cell-therapy capable of targeting multiple pathways, could safely slow ALS disease progression., Methods: This randomized, double-blind, placebo-controlled study enrolled ALS participants meeting revised El Escorial criteria, revised ALS Functional Rating Scale (ALSFRS-R) ≥25 (screening) and ≥3 ALSFRS-R points decline prior to randomization. Participants received three treatments of MSC-NTF or placebo intrathecally. The primary endpoint evaluated efficacy of MSC-NTF through a responder analysis and safety. A change in disease progression post-treatment of ≥1.25 points/mo defines a clinical response. A pre-specified analysis leveraged baseline ALSFRS-R of 35 as a subgroup threshold., Results: Overall, MSC-NTF treatment was well tolerated; there were no safety concerns. Thirty-three percent of MSC-NTF and 28% of placebo participants met clinical response criteria at 28 wk (odds ratio [OR] = 1.33, P = .45); thus, the primary endpoint was not met. A pre-specified analysis of participants with baseline ALSFRS-R ≥ 35 (n = 58) showed a clinical response rate at 28 wk of 35% MSC-NTF and 16% placebo (OR = 2.6, P = .29). Significant improvements in cerebrospinal biomarkers of neuroinflammation, neurodegeneration, and neurotrophic factor support were observed with MSC-NTF, with placebo unchanged., Discussion: The study did not reach statistical significance on the primary endpoint. However, a pre-specified subgroup suggests that MSC-NTF participants with less severe disease may have retained more function compared to placebo. Given the unmet patient need, the results of this trial warrant further investigation., (© 2021 BrainStorm Cell Therapeutics. Muscle & Nerve published by Wiley Periodicals LLC.)

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Malignant pleural mesothelioma (MPM) is an aggressive cancer with treatment limited to Cisplatin and Pemetrexed chemotherapy. Recently, we showed that drugs targeting the BCL-2-regulated apoptosis pathway could kill MPM cell lines in vitro, and control tumor growth in vivo. These studies showed BCL-XL was the dominant pro-survival BCL-2 family member correlating with its high-level expression in cells and patient tumor samples. In this study we show another inhibitor, AZD4320 that targets BCL-XL (and BCL-2), can also potently kill MPM tumor cells in vitro (EC 50 values in the 200 nM range) and this effect is enhanced by co-inhibition of MCL-1 using AZD5991. Moreover, we show that a novel nanoparticle, AZD0466, where AZD4320 is chemically conjugated to a PEGylated poly-lysine dendrimer, was as effective as standard-of-care chemotherapy, Cisplatin, at inhibiting tumor growth in mouse xenograft studies, and this effect was enhanced when both drugs were combined. Critically, the degree of thrombocytopenia, an on-target toxicity associated with BCL-XL inhibition, was significantly reduced throughout the treatment period compared to other BCL-XL-targeting BH3-mimetics. These pre-clinical findings provide a rationale for the future clinical evaluation for novel BH3-mimetic formulations in MPM, and indeed, other solid tumor types dependent on BCL-XL.

Tomato chlorosis virus (ToCV; genus Crinivirus , family Closteroviridae ) was identified in tomato crops in São Paulo State, Brazil, in 2006. Management strategies to control external sources of inoculum are necessary, because chemical control of the whitefly vector Bemisia tabaci Middle East-Asia Minor 1 (MEAM1) has not efficiently prevented virus infections and no commercial tomato varieties or hybrids are resistant to this crinivirus. We first evaluated the natural infection rate of some known wild and cultivated ToCV-susceptible hosts and their attractiveness for B. tabaci MEAM1 oviposition. Physalis angulata was the most susceptible to natural infection in all six exposures in 2018 and 2019. No plants of Capsicum annuum 'Dahra' or Chenopodium album became infected. Solanum melongena 'Napoli' had only two infected plants of 60 exposed. Capsicum annuum and Chenopodium album were the least preferred, and Nicotiana tabacum and S. melongena were the most preferred for whitefly oviposition. In addition, from 2016 to 2019, we surveyed different tomato crops and the surrounding vegetation to identify ToCV in weeds and cultivated plants in the region of Sumaré, São Paulo State. Only S. americanum , vila vila ( S. sisymbriifolium ), and Chenopodium album were found naturally infected, with incidences of 18, 20, and 1.4%, respectively. Finally, we estimated the ToCV titer (U.S. and Brazilian isolates ToCV-FL and ToCV-SP, respectively) by quantitative reverse transcription PCR in different ToCV-susceptible host plants and evaluated the relationship between virus acquisition and transmission by B. tabaci MEAM1. The results clearly showed significant differences in ToCV concentrations in the tissues of ToCV-susceptible host plants, which appeared to be influenced by the virus isolate. The concentration of the virus in plant tissues, in turn, directly influenced the ToCV- B. tabaci MEAM1 relationship and subsequent transmission to tomato plants. To minimize or prevent damage from tomato yellowing disease through management of external sources of ToCV, it is necessary to correctly identify potentially important ToCV-susceptible hosts in the vicinity of new plantings.

Amplification or overexpression of the FGFR family of receptor tyrosine kinases occurs in a significant proportion of gastric cancers. Regorafenib is a multikinase inhibitor of angiogenic and oncogenic kinases, including FGFR, which showed activity in the randomized phase II INTEGRATE clinical trial in advanced gastric cancer. There are currently no biomarkers that predict response to this agent, and whether regorafenib is preferentially active in FGFR-driven cancers is unknown. Through screening 25 gastric cancer cell lines, we identified five cell lines that were exquisitely sensitive to regorafenib, four of which harbored amplification or overexpression of FGFR family members. These four cell lines were also sensitive to the FGFR-specific inhibitors, BGJ398, erdafitinib, and TAS-120. Regorafenib inhibited FGFR-driven MAPK signaling in these cell lines, and knockdown studies confirmed their dependence on specific FGFRs for proliferation. In the INTEGRATE trial cohort, amplification or overexpression of FGFRs 1-4 was detected in 8%-19% of cases, however, this was not associated with improved progression-free survival and no objective responses were observed in these cases. Further preclinical analyses revealed FGFR-driven gastric cancer cell lines rapidly reactivate MAPK/ERK signaling in response to FGFR inhibition, which may underlie the limited clinical response to regorafenib. Importantly, combination treatment with an FGFR and MEK inhibitor delayed MAPK/ERK reactivation and synergistically inhibited proliferation of FGFR-driven gastric cancer cell lines. These findings suggest that upfront combinatorial inhibition of FGFR and MEK may represent a more effective treatment strategy for FGFR-driven gastric cancers., (©2021 American Association for Cancer Research.)

Despite having one of the lowest survival rates of all cancers, there have been no new approved treatments for malignant pleural mesothelioma (MPM) in over a decade. Standard-of-care treatment relies on Cisplatin plus Pemetrexed chemotherapy. Here, we tested a suite of BH3-mimetic drugs targeting BCL-2 pro-survival proteins of the intrinsic apoptotic pathway. We found BCL-XL is the dominant pro-survival protein in a panel of cell lines in vitro, though potent, synergistic cell killing occurred with MCL-1 co-targeting. This correlates with high-level expression of BCL-XL and MCL-1 in cell lines and a large cohort of patient tumour samples. BCL-XL inhibition combined with Cisplatin also enhanced cell killing. In vivo BCL-XL inhibition was as effective as Cisplatin, and the combination enhanced tumour growth control and survival. Genetic ablation of MCL-1 also enhanced the effects of BCL-XL inhibitors, in vivo. Combined, these data provide a compelling rationale for the clinical investigation of BH3-mimetics targeting BCL-XL in MPM.

Biliary tract cancers (BTCs) currently have no approved targeted therapies. Although genomic profiling of primary BTCs has identified multiple potential drug targets, accurate models are needed for their evaluation. Genomic profiling of 22 BTC cell lines revealed they harbor similar mutational signatures, recurrently mutated genes, and genomic alterations to primary tumors. Transcriptomic profiling identified two major subtypes, enriched for epithelial and mesenchymal genes, which were also evident in patient-derived organoids and primary tumors. Interrogating these models revealed multiple mechanisms of MAPK signaling activation in BTC, including co-occurrence of low-activity BRAF and MEK mutations with receptor tyrosine kinase overexpression. Finally, BTC cell lines with altered ERBB2 or FGFRs were exquisitely sensitive to specific targeted agents, whereas surprisingly, IDH1-mutant lines did not respond to IDH1 inhibitors in vitro. These findings establish BTC cell lines as robust models of primary disease, reveal specific molecular disease subsets, and highlight specific molecular vulnerabilities in these cancers., (Copyright © 2019 The Author(s). Published by Elsevier Inc. All rights reserved.)

Suberoylanilide hydroxamic acid (SAHA) or vorinostat (VOR) is a potent inhibitor of class I histone deacetylases (HDACs) that is approved for the treatment of cutaneous T-cell lymphoma. However, it has the intrinsic limitations of low water solubility and low permeability which reduces its clinical potential especially when given orally. Packaging of drugs within ordered mesoporous silica nanoparticles (MSNs) is an emerging strategy for increasing drug solubility and permeability of BCS (Biopharmaceutical Classification System) class II and IV drugs. In this study, we encapsulated vorinostat within MSNs modified with different functional groups, and assessed its solubility, permeability and anti-cancer efficacy in vitro. Compared to free drug, the solubility of vorinostat was enhanced 2.6-fold upon encapsulation in pristine MSNs (MCM-41-VOR). Solubility was further enhanced when MSNs were modified with silanes having amino (3.9 fold) or phosphonate (4.3 fold) terminal functional groups. Moreover, permeability of vorinostat into Caco-2 human colon cancer cells was significantly enhanced for MSN-based formulations, particularly MSNs modified with amino functional group (MCM-41-NH₂-VOR) where it was enhanced ~4 fold. Compared to free drug, vorinostat encapsulated within amino-modified MSNs robustly induced histone hyperacetylation and expression of established histone deacetylase inhibitor (HDACi)-target genes, and induced extensive apoptosis in HCT116 colon cancer cells. Similar effects were observed on apoptosis induction in HH cutaneous T-cell lymphoma cells. Thus, encapsulation of the BCS class IV molecule vorinostat within MSNs represents an effective strategy for improving its solubility, permeability and anti-tumour activity.

Background: There is a need for better control of head louse infestations. Abametapir is an inhibitor of metalloproteinases critical for louse survival and egg development. The efficacy of abametapir lotion, 0.74%, was assessed for its ability to clear head louse infestations after a single application., Methods: Two randomized, double-blind, multicenter, vehicle-controlled studies were conducted in subjects aged 6 months and older to compare the effectiveness of abametapir lotion versus vehicle control for eliminating head louse infestations without nit combing. Abametapir lotion was applied to dry hair for 10 minutes on day 0 and then rinsed with water. The primary endpoint was the proportion of index subjects (youngest household member with ≥ 3 live lice at screening) in the intent-to-treat population who were louse free at all follow-up visits through day 14. Older household members with one or more live lice at screening were designated as nonindex subjects and treated as per the index subject within their household., Results: In the intent-to-treat population (index subjects, N = 216), 81.5% of subjects treated with abametapir lotion were louse free through day 14 after a single treatment, versus 49.1% with vehicle (P < 0.001). For the combined index and nonindex population (N = 704), 85.9% were louse free through day 14 in the abametapir group, versus 61.3% in the vehicle group (P < 0.001). The most frequently reported adverse events were erythema (4.0%), rash (3.2%), and skin burning sensation (2.6%)., Conclusion: Abametapir lotion, 0.74%, was effective at clearing active head louse infestations through day 14 in subjects aged 6 months and older. All adverse events (including one serious but unrelated to study drug) resolved uneventfully., (© 2018 The Authors. Pediatric Dermatology Published by Wiley Periodicals, Inc.)

Parents' conversations with teens about sex and relationships can play a critical role in improving teenage reproductive health by reducing teens' risky sexual behavior. However, little is known about how teen-parent communication changes from early to middle adolescence and how parents can tailor their communication to address their teens' changing development and experiences during these periods. In this longitudinal qualitative study, U.S. parents ( N = 23) participated in interviews when their teens were in early adolescence, then again when the teens were in middle adolescence. Participants were largely mothers and were from diverse racial/ethnic and educational backgrounds. Thematic analysis was used to assess continuity and change in parents' perceptions of teen-parent communication. Findings showed that many parents adapted their conversations with their teens about sex and relationships as teens developed. Once teens had entered high school, more parents described feeling comfortable with their conversations. However, parents also more often reported that their teens responded negatively to the communication in high school than they had in middle school. These findings may help parents to anticipate their own as well as their teens' responses to family conversations about sex at different developmental time points and to strategize how to effectively talk with their teens about sex and relationships to improve their teens' overall reproductive health., Competing Interests: The authors declare no conflict of interest. The founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Colorectal cancers (CRCs) are characterized by global hypomethylation and promoter-specific DNA methylation. A subset of CRCs with extensive and co-ordinate patterns of promoter methylation has also been identified, termed the CpG-island methylator phenotype. Some genes methylated in CRC are established tumor suppressors; however, for the majority, direct roles in disease initiation or progression have not been established. Herein, we examine functional evidence of specific methylated genes contributing to CRC pathogenesis, focusing on components of commonly deregulated signaling pathways. We also review current knowledge of the mechanisms underpinning promoter methylation in CRC, including genetic events, altered transcription factor binding, and DNA damage. Finally, we summarize clinical trials of DNA methyltransferase inhibitors in CRC, and propose strategies for enhancing their efficacy., (Copyright © 2017 Elsevier Inc. All rights reserved.)

Ti is often used to form an initial Ohmic interface between ZnO and Au due to its low work function, and the TiO 2 /ZnO heterojunction is also of great importance for many practical applications of nanoparticles. Here, Ti has been controllably deposited onto hydrothermally grown ZnO nanowires and the formation of metal-semiconductor contact has been investigated using x-ray photoelectron spectroscopy (XPS), photoluminescence (PL) spectroscopy and scanning electron microscopy. XPS results showed that that the Ti initially reacts with surface oxygen species to form TiO 2 , and further deposition results in the formation of oxides with oxidation state numbers lower than four, and eventually metallic Ti on top of the TiO 2 . The formation of TiC was also observed. XPS showed that the onset of metallic Ti coincided with a Zn 3p core level shift to lower binding energy, indicating upwards band bending and the formation of a rectifying contact. Annealing caused a near-complete conversion of the metallic Ti to TiO 2 and caused the Zn 3p to shift back to its original higher binding energy, resulting in downwards band bending and a more Ohmic contact. PL measurements showed that the optical properties of the nanowires are not affected by the contact formation.

Events are often remembered as having occurred in a specific order, but almost nothing is known about how the brain encodes this temporal information. It is commonly assumed that temporal information is encoded via a single mechanism, based either on the temporal context in which the event occurred or inferred from the strength of the memory trace itself. By analyzing time-dependent changes in activity patterns, we show that the distinctiveness of contextual representations in the hippocampus and anterior and medial prefrontal cortex was associated with accurate recency memory. In contrast, overall activation in the perirhinal and lateral prefrontal cortices predicted whether an object would be judged more recent, regardless of accuracy. These results demonstrate that temporal information was encoded through at least two complementary neural mechanisms., (© 2016 Wiley Periodicals, Inc.)

The hippocampus is critical for human episodic memory, but its role remains controversial. One fundamental question concerns whether the hippocampus represents specific objects or assigns context-dependent representations to objects. Here, we used multivoxel pattern similarity analysis of fMRI data during retrieval of learned object sequences to systematically investigate hippocampal coding of object and temporal context information. Hippocampal activity patterns carried information about the temporal positions of objects in learned sequences, but not about objects or temporal positions in random sequences. Hippocampal activity patterns differentiated between overlapping object sequences and between temporally adjacent objects that belonged to distinct sequence contexts. Parahippocampal and perirhinal cortex showed different pattern information profiles consistent with coding of temporal position and object information, respectively. These findings are consistent with models proposing that the hippocampus represents objects within specific temporal contexts, a capability that might explain its critical role in episodic memory., (Copyright © 2014 Elsevier Inc. All rights reserved.)

One of the defining features of episodic long-term memory is that it includes information about the temporal context in which an event occurred. Little is known about the regions that support the encoding of temporal information in the human brain, although previous work has suggested a role for the lateral prefrontal cortex (PFC) and medial temporal lobes (MTL). Here we used event-related fMRI to examine the relationship between activity at encoding and subsequent memory for temporal context. Participants were scanned while performing a serial order working memory task with pictures of common objects and were later tested for temporal memory at two different timescales. In the coarse temporal memory test, participants viewed one object from each trial and indicated approximately when during the course of the experiment it had appeared. In the fine temporal memory test, participants were shown the remaining objects from each trial and asked to recall the order in which they had been originally presented. Activity in the parahippocampal cortex predicted subsequent fine temporal accuracy, whereas coarse temporal accuracy was predicted by activity in several regions of the PFC, as well as in the hippocampus. Additional multivoxel pattern analyses revealed evidence implicating the rostrolateral PFC in the representation of time-varying contextual states in a manner similar to that proposed by computational theories of temporal context memory. These results highlight MTL and PFC contributions to temporal memory at the time of encoding and suggest a particular role for the rostrolateral PFC in encoding coarse temporal context.

Converging behavioral and neuroimaging evidence indicates that culture influences the processing of complex visual scenes. Whereas Westerners focus on central objects and tend to ignore context, East Asians process scenes more holistically, attending to the context in which objects are embedded. We investigated cultural differences in contextual processing by manipulating the congruence of visual scenes presented in an fMR-adaptation paradigm. We hypothesized that East Asians would show greater adaptation to incongruent scenes, consistent with their tendency to process contextual relationships more extensively than Westerners. Sixteen Americans and 16 native Chinese were scanned while viewing sets of pictures consisting of a focal object superimposed upon a background scene. In half of the pictures objects were paired with congruent backgrounds, and in the other half objects were paired with incongruent backgrounds. We found that within both the right and left lateral occipital complexes, Chinese participants showed significantly greater adaptation to incongruent scenes than to congruent scenes relative to American participants. These results suggest that Chinese were more sensitive to contextual incongruity than were Americans and that they reacted to incongruent object/background pairings by focusing greater attention on the object.

The default network is a system of brain areas that are engaged when the mind is not involved in goal-directed activity. Most previous studies of age-related changes in default mode processing have used verbal tasks. We studied non-verbal spatial tasks that vary in difficulty. We presented old and young participants with two spatial judgment tasks: an easy categorical judgment and a more demanding coordinate judgment. We report that (a) Older adults show markedly less default network modulation than young on the demanding spatial task, but there is age equivalence on the easy task; (b) This Age x Task interaction is restricted to the default network: Brain areas that are deactivated by the tasks, but that are outside the default network, show no interaction; (c) Young adults exhibit significantly stronger functional connectivity among posterior regions of the default network compared with older adults, whereas older adults exhibit stronger connectivity between medial prefrontal cortex and other sites; and (d) The relationship of default activity to reaction time performance on the spatial tasks is mediated by age: in old adults, those who deactivate the default network most also perform best, whereas the opposite is true in younger adults. These results extend the findings of age-related changes in default mode processing and connectivity to visuo-spatial tasks and demonstrate that the results are specific to the default network.

In rodents oral or parenteral administration of sulfolane (tetrahydrothiophene-1,1-dioxide) produced hyperactivity, followed by clonic-tonic convulsions. The analeptic effects of sulfolane were nearly additive with those of Metrazol. When injected simultaneously with pentobarbital, sulfolane decreased pentobarbital sleeping time in mice. But sulfolane increased sleeping time when the barbiturate was administered 1 hr after sulfolane.