Search

Partial nucleotide sequences of amplification products obtained from four European apple stem grooving virus (ASGV) isolates using degenerate primers showed 80 to 85% similarity with the published ASGV sequence of a Japanese strain but 98 to 100% identities among themselves. Based on these sequences, two ASGV-specific primers (ASGV4F-ASGV4R) were designed to amplify a 574-bp fragment located in the putative viral RNA polymerase. With these primers, six European and five American ASGV isolates, maintained in herbaceous hosts (Chenopodium quinoa, Nicotiana glutinosa, and N. occidentalis) or in apple trees, were readily detected by reverse transcription-polymerase chain reaction (RT-PCR). Using these specific ASGV primers, dsRNA preparations have been shown to constitute good templates for reliable amplification of ASGV sequences from leaves and bark tissues of apple trees, both in a two-step RT-PCR protocol and in the one-step Titan One-Tube RT-PCR. System. Furthermore, the one-step RT-PCR system allowed a specific amplification of ASGV sequences directly from clarified crude extracts of leaves and bark tissues of apple trees during both active growth and the dormant season.

Plantains (Musa AAB) are important sources of food and income for millions of people in Colombia and other developing countries. Colombia is the largest producer of plantains (2) and the third largest exporter of bananas in the world. In 2001, plants of ‘Dominico-Hartón’ plantain showing mild chlorotic streak symptoms were observed in northwestern Colombia. Electron microscopy of symptomatic tissue extracts revealed the presence of filamentous virus-like particles approximately 800 nm long. Immunocapture reverse-transcription polymerase chain reaction was performed to test for the presence of Banana mild mosaic virus (BanMMV) as described by J. E. Thomas (unpublished, Queensland Department of Primary Industries, Australia) and Sharman et al. (3). For polymerase chain reaction (PCR), the upstream primer No. 193 (5′-CAC TTA GGT TTG TGT GAT GT-3′) (designed in this study by using the computer Program DNAMAN Version 4.13) and the downstream primer Poty1 (5′-GGA TCC CGG GTT TTT TTT TTT TTT TTT V-3′) (1,3; J. E. Thomas, unpublished, Queensland Department of Primary Industries, Australia) were used. Amplification products of the expected size (approximately 900 bp) were obtained and sequenced after cloning in a pCR2.1 plasmid vector. Analyses of nucleic acid sequences using the international sequence databases and the BLAST program yielded nucleotide and amino acid sequence similarities of 80 to 83% and 90 to 92%, respectively, with an Australian isolate of BanMMV (GenBank Accession No. AF314662). The coat protein (CP) gene of the Colombian BanMMV isolate consists of 717 nucleotides. When the CP of the Colombian BanMMV isolates (GenBank Accession Nos. AY319331, AY319332, and AY319333) was compared with the CP of the Australian isolate, a highly variable region was observed in the N-terminus region. To our knowledge, this is the first report of BanMMV isolated from plantains in Colombia and the presence of molecular variability in the CP of BanMMV isolates. BanMMV has been found in Colombia associated with Banana streak virus and Cucumber mosaic virus in plantain. References: (1) A. Gibbs and A. Mackenzie. J. Virol.Methods 63:9, 1997 (2) N. S. Price. Infomusa 8(2):26, 1999. (3) M. Sharman et al. J. Virol. Methods 89:75, 2000.

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

Viruses, distributed worldwide on cucurbits, cause severe damage to crops. Virus surveys in 2003 and 2004 were made in all the major cucurbit-growing areas in Tunisia. Large populations of aphids (Aphis gossypii Glover) and severe yellowing symptoms of older leaves of cucurbits were observed in outdoor and under plastic-tunnel cultivation, suggesting the presence of Cucurbit aphid-borne yellows virus (CABYV, genus Polerovirus, family Luteoviridae). Leaf samples collected from symptomatic and asymptomatic plants of melon (Cucumis melo L.), cucumber (C. sativus L.), squash (Cucurbita pepo L.), watermelon (Citrullus lanatus L.), and ware cucurbit (Ecballium elaterium L. T. Richard) were screened for the presence of CABYV using enzyme-linked immunosorbent assay (ELISA) and reverse transcription-polymerase chain reaction (RT-PCR). Reference isolate, CABYV-N (GenBank Accession No. X76931) was provided by H. Lecoq (INRA-Monfavet Cedex, France). Sample extracts from fresh leaf tissues were tested using ELISA with an antiserum prepared against this isolate. In addition, total RNA was extracted from fresh leaf tissues according to the technique of Celix et al. (2) using the Titan RT-PCR kit from Roche Diagnostics (Penzberg, Germany). Forward primer (5′-GAGGCGAAGGCGAAGAAATC-3′) and reverse primer (5′-TCTGGACCTGGCACTTGATG-3′) were designed with the available sequence of the reference isolate. ELISA tests demonstrated that 91 plants were positive among 160 plants tested with severe yellowing symptoms. All asymptomatic plants were negative. RT-PCR results yielded an expected 550-bp product that was amplified from the reference isolate. Of the 160 plants tested using ELISA, 106 plants were screened with RT-PCR including the 91 plants that were positive in ELISA. These 91 plants also were positive after RT-PCR amplification as were 12 more plants. This demonstrated that the RT-PCR test is more sensitive. No amplicons were produced from extracts of asymptomatic plants, RNA preparations of Cucurbit yellow stunting disorder virus (CYSDV), or Beet pseudo yellows virus (BPYV) positive controls provided by B. Falk (University of California, Davis). CYSDV and BPYV can induce similar yellowing symptoms in cucurbits. The results of the ELISA and RT-PCR tests showed that CABYV is widely distributed on five cucurbit species in the major growing areas of Tunisia including the northern, Sahel, central, and southern regions where it was detected, respectively, in 10 of 25, 11 of 21, 24 of 37, and 58 of 77 samples tested. CABYV was detected at the rates of 63 of 72 on melon, 10 of 21 on cucumber, 17 of 24 on squash, 10 of 25 on watermelon, and 3 of 18 on ware cucurbit. CABYV also seems to be widespread throughout the Mediterranean Basin (1,3,4), but to our knowledge, this is the first report of the occurrence of CABYV in Tunisia on different species of cucurbit and ware cucurbit. References: (1) Y. Abou-Jawdah et al. Crop Prot. 19:217, 2000. (2) A. Celix et al. Phytopathology 86:1370, 1996. (3) M. Juarez et al. Plant Dis. 88:907, 2004. (4) H. Lecoq et al. Plant Pathol. 41:749, 1992.

Almond (Prunus dulcis Mill) is an important crop in countries of the Mediterranean area. Until now, among viroids, only Hop stunt viroid (HSVd) is known to infect cultivated almond trees (2). In 2004, a survey of almond trees was carried out in orchards in different regions of Tunisia, a major producing and exporting country of almond. Symptoms such as mosaic and necrotic lesions, potentially caused by the Peach latent mosaic viroid (PLMVd), were observed on leaves of cultivated almond trees. Since PLMVd was recently detected in peach and pear trees in Tunisia (4), the presence of this viroid in almond trees was studied. The detection method on the basis of one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays was previously described and validated for the detection of this viroid in fruit trees (4). Amplification products were obtained by using previously reported primer pairs of PLMVd (1). Positive controls included RNA preparations of twigs of PLMVd-infected GF 305 peach seedlings. These materials, provided by B. Pradier (Station de Quarantaine des Ligneux, Lempdes, France), were positive as revealed by chip budding on peach seedling indicator plants grown under greenhouse conditions. RT-PCR analysis of nucleic acid preparations from leaves of almond showed specific amplification products with the expected size of 337 bp for two almond trees among 17 trees tested. Nucleotide sequence analyses of cloned amplification products obtained with the PLMVd primers confirmed a size of 337 bp and revealed a sequence similar to sequences from other PLMVd isolates previously characterized. The sequences shared 94 to 98% identity with the reference isolates of PLMVd from peach (EMBL Accession No. M83545, AF170511, AF170514, and AY685181). The two infected almond trees are proximal to each other and peach trees infected with PLMVd. This suggests that one tree may have served as a source of inoculum for the other through agronomic practices such as pruning or the aphid Myzus percicae (3). Alternatively, PLMVd may have originated in an unknown host and was then transmitted to almond trees. Our investigation shows that almond is a new host for PLMVd. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañizares et al. Eur. J. Plant Pathol. 105:553, 1999. (3) J. C. Desvignes et al. Phytoma 444:70, 1992. (4) I. Fekih Hassen et al. Plant Dis. 88:1164, 2004.

Recent technological development of molecular methods has led to the proliferation of new rapid PCR or reverse-transcriptase (RT)-PCR-derived diagnostic tests for plant viruses. Nevertheless, for routine use, the reliability of all these new methods is not widely established and there is still an apprehension to adopt them in official diagnostic for certification of plant material. This is partly because of the lack of confidence in the obtained results and the poor knowledge on the reproducibility and limits of the RT-PCR protocols.There is a lack of information on the adequate risk assessment in the use of this new technology.An interlaboratory evaluation of two RT-PCR duplex protocols for the detection of four different fruit tree viruses was performed to address these questions. Identical samples were sent as crude extract preparation to each of the participant laboratories. Samples were coded to ensure a double-blind test. General principles of result analysis are described, for example calculation of parameters such as specificity, sensitivity, repeatability, reproducibility, likelihood ratios and post-test probabilities. These parameters and the integration of the protocols within official certification scheme are discussed. Finally, guidelines for researchers desirous of validating their new plant virus diagnostic protocols through interlaboratory evaluation are suggested.

Samples of cassava leaves exhibiting severe symptoms of cassava mosaic disease (CMD) were collected with the PhytoPASS kit in fields surrounding the city of Bujumbura (Burundi). These materials were then sent to Belgium for polymerase chain reaction determination of the CMD begomoviruses inducing the observed symptoms. Different pairs of specific primers were used to amplify DNA sequences specific to African cassava mosaic virus (ACMV), East African cassava mosaic virus (EACMV), East African cassava mosaic Cameroon virus (EACMCV), East African cassava mosaic Malawi virus (EACMMV), East African cassava mosaic Zanzibar virus (EACMZV), the Uganda variant of East African cassava mosaic virus (EACMV-UG) and South African cassava mosaic virus (SACMV). It was revealed that mixed infections were prevailing in the analyzed materials. Most of the samples submitted to this analysis were found to be co-infected by three different begomoviruses (ACMV + EACMV + EACMV-UG). The so revealed mixed infections could explain the high severity of CMD symptoms noticed on cassava in the region of Bujumbura while the diversity within the CMD causal agents illustrates the importance to take this parameter into consideration for a successful use of plant genetic resistance to control the disease.

The operational capacity of a duplex RT-PCR method for simultaneous detection of Prune dwarf virus (PDV) and Prunus necrotic ringspot virus (PNRSV) has been established by nine European laboratories. A total of 576 samples from Prunus trees with known sanitary status, corresponding to 32 samples in two repetitions for each laboratory, were analysed. The level of sensitivity achieved by the method was 98.3% for PDV and 90.4% for PNRSV. The specificity was 87.4% for PDV and 94.3% for PNRSV. The unilateral 95% confidence intervals were calculated for all these values. Cohen's Kappa coefficient of repeatability and reproducibility of the technique indicated a strong agreement between data. Likelihood ratios were 7.50 (positive) and 0.02 (negative) for PDV. For PNRSV, the positive likelihood ratio was 15.00 while the negative likelihood ratio was 0.11. In addition, post-test probabilities of infection were calculated to manage the risk associated with the routine use of this method. This allows an accurate test result interpretation to facilitate the integration of this new technique into a certification scheme.

The presence of Peach latent mosaic viroid (PLMVd) was monitored during 2 years in peach orchards located in the North of Tunisia. PLMVd population was surveyed using a specific RT-PCR test adapted to crude sap extract. During the first year (2004), 228 samples were randomly selected in 22 peach orchards (eight cultivars) and tested for the presence of PLMVd. Results showed that PLMVd is highly and equally present in four regions of the North of Tunisia. Analyses of some key factors in relation to PLMVd incidence revealed that the tree age did not influence the infection rate. The eight studied cultivars were clustered in three groups according to their PLMVd incidence. Furthermore, the early and season cultivars were statistically more infected than the late cultivars. Prospections in May and October 2005 were performed in four selected orchards. Each two orchards contained Early May Crest (early cultivar) and Carnival (late cultivar) cultivars, respectively. The difference in PLMVd incidence observed in 2004 was confirmed. Furthermore, no correlation between the tree physiological state and the viroid detection was observed. Further investigations on the origin of the differences in PLMVd incidence between Early May Crest and Carnival cultivars would be of interest.

Nucleotide sequences of a broad range of Peach Latent Mosaic Viroid (PLMVd) variants were determined. The variants were isolated from peach, pear, and almond tree samples collected in Tunisia. Sequence analysis confirmed the high variability of PLMVd, as no less than 119 new variants were identified. Variations included new polymorphic positions, insertions of 11 to 14 nucleotides, and new mutations within the hammerhead self-cleavage motifs. We provide the first covariation-based evidence for certain stems within the proposed secondary structure. Our covariation analysis also strengthens the view that a pseudoknot closes the replication domain. On the basis of phylogenetic tree studies and informative positions, PLMVd variants are proposed to cluster into groups and subgroups likely to have resulted from recombination events. PLMVd thus emerges as a suitable viroid for retracing the evolution of an RNA genome.

A reverse transcription polymerase chain reaction was developed to investigate the occurrence ofpeach latent mosaic viroid� (PLMVd), � pear blister canker viroid� (PBCVd), � hop stunt viroid� (HSVd) andapple scar skin viroid� (ASSVd) on fruit trees (peach, pear, almond and apple) in Tunisia. The test was initially performed with total RNA preparations from selected isolates and then applied to total RNA preparations from leaf or bark tissues of fruit trees collected in the north of Tunisia and the Sahel. PLMVd was found to occur in peach and pear trees, HSVd in pear, peach and almond trees, and PBCVd in pear trees. Mixed PBCVd-HSVd and PLMVd-HSVd infections occurred naturally in pear trees. ASSVd was not detected in any samples from apple trees. The identity of the detected viroids was confirmed by comparing their sequences with those of other previously characterized isolates. The test was then simplified by direct use of diluted crude plant extracts. The results obtained from crude sap extracts of leaves or bark tissues and from total RNA preparations were identical. This improved test is thus quick and useful for large-scale routine analy- sis. It can be used in a certification programme to con- tribute to prevention of the occurrence and spread of PLMVd, HSVd, PBCVd and ASSVd in Tunisia.

A real-time fluorescent reverse-transcriptase polymerase chain reaction (RT-PCR) assay using a short fluorogenic 3′ minor groove binder (MGB) DNA hydrolysis probe was developed for the detection of Prunus necrotic ringspot virus (PNRSV) in stone fruit trees. The covalent attachment of the minor groove binder moiety at the 3′ end of the probe increased the probe target duplex stability and raised the melting temperature to a range suitable for real-time analysis. The real-time RT-PCR assay correlated well with conventional RT-PCR results for the detection of PNRSV. This assay reliably detects PNRSV in bark tissues of dormant cherry and plum trees. Furthermore, it is well adapted for the routine detection of PNRSV because it eliminates one risk of contamination by performing the whole test in a single closed tube. This system may replace the commonly used diagnostic techniques (e.g., woody indicators and immunological tests) to detect this virus.

A real-time assay for the detection of episomal Banana streak virus (BSV; strain OL) in banana and plantains that carry integrated BSV sequences is described. Primers specific to the viral DNA were designed using the viral sequence integrated into the cv. Obino l'Ewai genome and the sequence of the genomic DNA of the infecting virus strain OL. They amplify a sequence of 1,336 bp that is detected in real-time by a short fluorogenic 3' minor groove binder DNA probe. This method enables reproducible and specific detection of episomal BSV from purified DNA as well as from crude extracts from infected plants. The assay is rapid, adaptable for large-scale experiments, and circumvents carryover problems.

Real-time PCR with fluorogenic hydrolysis probes (5' nuclease assay) is increasingly used for the detection of pathogens for diagnostic purposes. Nevertheless, the size of the probes, usually 25–40 nucleotides, might limit their use to detect pathogens with high genome variability between isolates, where an identical sequence cannot be found without multiple mismatches. In this report, we describe a 5' nuclease assay, to detect Apple stem pitting virus, based on the use of a shorter probe which is chemically modified with a minor groove binder in order to increase duplex stability and raise the melting temperature to a value suitable for real-time analysis. The short size of the probe, which is critical to target a conserved cluster sequence of 14 nucleotides in the RNA polymerase gene, circumvents the genome variability of the virus. The assay correlates at 96 percent with gel analysis and is more reliable than biological indexing to detect Apple stem pitting virus field isolates. It is fast and fully compatible with automation, and therefore particularly suitable for plant certification.

Current developments in certification procedures for propagating material require the availability of rapid, sensitive, reliable and user-friendly detection protocols applicable for routine testing. Our research concerns the possible use of reverse transcriptase-polymerase chain reaction (RT-PCR) for the detection of the pathogens listed for virus-tested pome and stone-fruit propagating material in Belgium. Although RT-PCR satisfies the need for rapidity and sensitivity, the usual protocols relying on the use of purified nucleic acid preparations as template and ethidium bromide-stained agarose gels for detection are not appropriate for routine use. We therefore first optimized the parameters and cycling conditions of the RT-PCR reactions to allow direct use of crude extracts of either leaf or bark material as a template. Sandwich hybridization between a covalently linked capture probe and a biotinylated detection probe was then used for the detection of the specific amplicons (Lambdatech S.A. kits in development). These assays have the sensitivity and specificity of the RT-PCR, enhanced by sandwich hybridization with specific probes, and ease of sample preparation and detection of the amplicons. They make it possible to analyse a great number of samples and are thus well adapted for routine quality-control testing of propagating material.

Knowledge of virus diseases affecting sweet potato has been complicated due to the frequent occurrence of mixed infections and difficulties in isolating and purifying sweet potato viruses. A combined assay of reverse transcription and polymerase chain reaction (PCR) utilizing degenerate genus-specific primers POT1 and POT2 was applied to 18 sweet potato clones from China. The primers were designed to amplify the variable 5′ terminal region of the potyvirus coat protein gene. Molecular analysis of the amplified fragments identified the Chinese strains of sweet potato feathery mottle virus (SPFMV-CH), sweet potato latent virus (SPLV-CH), and sweet potato virus G (SPVG-CH). Among the detected potyviruses, a distantly related strain of SPFMV-CH, tentatively named SPFMV-CH2, was identified in sweet potatoes from China. On the basis of sequence identity, SPFMV-CH2 was closely related to the common (-C) strain of that virus. Identification of a closely related strain of SPVG-CH in one sweet potato clone from China further illustrated the usefulness of broad-spectrum PCR for detecting uncharacterized viruses. The acquisition of sequence information permitted the design of virus-specific primers for detecting and differentiating SPFMV, SPLV, and SPVG.

The use of potyvirus-specific primers and subsequent application of the RACE procedure allowed the cloning of the 3% terminal 1088 nucleotides of the genomic RNA of the Taiwan isolate of sweetpotato latent virus (SPLV-T) and the 3% genomic 1085 nucleotides of a SPLV-like virus from China (SPLV-CH). The sequence of an internal part of the presumptive nuclear inclusion b gene was also determined for both isolates. Detailed sequence analyses revealed the presence of consensus motifs which indicated that SPLV-CH and SPLV-T should be regarded as members of the genus Poty6irus. Multiple sequence alignments and phylogenetic analyses were also performed and unambiguously assessed these isolates as strains of a distinct Poty6irus. SPLV was not related to other potyviruses infecting sweetpotato nor to any other sequenced virus. From the presence of the DAG box, SPLV-CH is expected to be a typical aphid transmitted Poty6irus whereas a conceivable explanation is proposed for the non-aphid transmission of SPLV-T. © 1997 Elsevier Science B.V.

Complementary DNA representing 2 108 nucleotides at the 3' end of the genomic RNA of the whitefly-transmitted sweetpotato mild mottle virus (SPMMV) was cloned after PCR. Sequence analysis revealed an open reading frame of 1 797 nucleotides which codes for a protein of 599 amino acids, followed by a 3' non-coding region of 311 nucleotides. Alignment of the deduced amino acid sequence with corresponding sequences of other members of the Potyviridae demonstrated that part of the presumptive RNA-dependent RNA polymerase and the coat protein coding regions of SPMMV are found at the 3' end of its genome, in that order. Alignment of the amino acid sequence of the core of SPMMV coat protein with those of selected members of the Potyviridae showed limited identity, thus demonstrating--with phylogenetic analysis--that SPMMV belongs to a distinct genus of the family Potyviridae.

A combined assay of reverse transcription and the polymerase chain reaction (RT-PCR) utilizing degenerate primers derived from conserved regions in the genome of potyviruses was designed in order to amplify the 5’terminal part of the coat protein cistron, which can differ greatly in length between distinct potyviruses. Amplification on total RNA extracted from one sweet potato clone from China yielded three fragments of different lengths, and sequence analysis of these fragments indicated mixed infections by three distinct potyviruses in the sweet potato clone investigated. Two degenerate primers were also designed in order to amplify the 5’terminal part of the coat protein cistron of either potyviruses or bymoviruses. A third degenerate primer was selected from a region conserved in potyviruses and bymoviruses and used with primers specific for two different bymoviruses, barley yellow mosaic bymovirus (BaYMV) and barley mild mottle bymovirus (BaMMV). These primers allowed the identification of BaYMV and BaMMV barley plants from the field with single or mixed infection, and were used to clarify the etiology of a viral agent inducing mosaic symptoms on several barley cultivars considered so far as resistant to BaYMV and BaMMV. Amplification of fragments, including the variable 5’terminal region of the coat protein cistron, thus provides a convenient method for the detection and characterization of potyviruses and bymoviruses, without fastidious preliminary work of separation and purification of the components of viral complexes.

In the context of the phytosanitary legislation governing the trade of plants, accurate highly sensitive and rapid techniques of virus detection need to be developed. Such objectives can be achieved by molecular hybridization and PCR. Specific nucleic acid sequences of RNA viruses can be directly recognized by hybridization in the presence of labelled complementary DNA (cDNA) probes, synthesized either from purified viral RNA, from ds-RNA from infected plants, or from total RNA preparations from infected plants by RT-PCR. After characterization and selection, specific cDNA are cloned in bacteria by means of recombinant plasmids, allowing continuous availability of identical and homologous probes. Techniques of non-radioactive labelling, which can reach similar levels of sensitivity and specificity to the previous exclusive use of radioactivity, are used. Specific probes are generally hybridized to viral nucleic acid sequences from plant samples immobilized on solid support (dot-blot hybridization). Several examples for different viruses and host plants are presented, demonstrating the possibilities of the use of molecular hybridization for diagnosis of virus infection in plants.

A method to detect Apple stem grooving virus (ASGV) based on reverse transcription polymerase chain reaction (RT-PCR) was developed using primers ASGV4F-ASGV4R targeting the viral replicase gene, followed by a sandwich hybridisation, in microtiter plates, for colorimetric detection of the PCR products. The RT-PCR was performed with the Titan™ RT-PCR system, using AMV and diluted crude extracts of apple (Malus domestica) leaf or bark for the first strand synthesis and a mixture of Taq and PWO DNA polymerase for the PCR step. The RT-PCR products is hybridised with both a biotin-labelled capture probe linked to a streptavidin-coated microtiter plate and a digoxigenin (DIG)-labelled detection probe. The complex was detected with an anti-DIG conjugate labelled with alkaline phosphatase. When purified ASGV was added to extracts of plant tissue, as little as 400 fg of the virus was detected with this method. The assay with ASGV4F-ASGV4R primers specifically detected the virus in ASGV-infected apple trees from different origins, whereas no signal was observed with amplification products obtained with primers targeting the coat protein region of the ASGV genome or with primers specific for Apple chlorotic leaf spot virus (ACLSV) and Apple stem pitting virus (ASPV). The technique combines the power of PCR to increase the number of copies of the targeted gene, the specificity of DNA hybridization, and the ease of colorimetric detection and sample handling in microplates. Um método foi desenvolvido para a detecção do Apple stem grooving virus (ASGV), baseado na transcrição reversa do RNA viral e na polimerização em cadeia do DNA (RT-PCR), usando os oligonucleotídeos iniciadores ASGV4F-ASGV4R, localizados na região do gene da RNA polimerase, sendo os produtos de amplificação detectados por hibridização "sandwich", em placas de poliestireno, através de reação colorimétrica. A RT-PCR foi realizada com a "Titan™ RT-PCR System", complexo enzimático formado pela AMV, responsável pela transcrição do RNA viral em cDNA e as DNA polimerases PWO e Taq, usadas para a etapa de PCR, utilizando-se para isso extrato bruto de folhas e casca do caule de macieira (Malus domestica). A detecção dos produtos de amplificação RT-PCR foi realizada hibridizando esses produtos com uma sonda de captura marcada com biotina, ligada à placa de ELISA previamente sensibilizada com estreptavidina, e uma sonda de revelação marcada com digoxigenina. O complexo foi detectado utilizando-se um conjugado fosfatase alcalina marcada com anti-DIG. Foi avaliada a sensibilidade desse método utilizando-se uma série de diluições de vírus purificado, tendo sido possível detectar até 400 fg de vírus. A especificidade do método foi demonstrada usando-se os oligonucleotídeos iniciadores ASGV4F-ASGV4R e macieiras de diferentes origens infetadas com ASGV. Não foram reveladas colorimetricamente as amplificações observadas em gel de agarose, quando essas mesmas plantas foram testadas utilizando-se oligonucleotídeos iniciadores para o ASGV escolhidos na região que codifica para capa protéica e amplificações provenientes de material infetado com o Apple chlorotic leaf spot virus (ACLSV) e Apple stem pitting virus (ASPV). Esta técnica combina o desempenho da PCR, a especificidade da hibridização molecular e as facilidades do teste de ELISA.

The development of a real-time 5' nuclease RT-PCR assay for the detection of apple chlorotic leaf spot virus (ACLSV) from infected plant material is described. A short fluorogenic 3' minor groove binder-DNA hydrolysis probe was used to circumvent genome variability between isolates and target a short conserved sequence. The covalent attachment of the minor groove binder moiety at the 3' end of the probe increased the probe/target duplex stability and raised the melting temperature to a range suitable for real-time analysis. The method is rapid, sensitive and takes place within a single tube without post-PCR handling of the amplification products.

Primers corresponding to conserved regions in the RNA-dependent RNA polymerase and the RACE procedure led to the cloning of the complete sweetpotato mild mottle virus (SPMMV) RNA genome. The assembled SPMMV genomic sequence was 10 818 nucleotides in length with a polyadenylated tract at the 3′ terminus. The structure and organization of the SPMMV genome appear to be similar to those of potyviruses and rymoviruses. A 5′ untranslated region, rich in A and U residues, is present between nucleotides 1 and 139. A putative initiation codon, at nucleotides 140–142, marks the beginning of a large open reading frame (ORF) which ends in UAA at positions 10 508–10 510. A 308-nucleotide untranslated region is present between the termination codon of the ORF and the beginning of the 3′ polyadenylated region. Almost all known potyvirus motifs are present in the polyprotein of SPMMV. However, motifs in the putative helper-component and coat protein of SPMMV are incomplete or missing, which may account for its vector relations. Despite similarities with rymoviruses, potyviruses and, to a lesser extent, bymoviruses, comparative sequence analyses demonstrated that SPMMV belongs to a distinct genus of the family Potyviridae .

The sequences of the N-terminal part of the coat protein cistron from six isolates of yam mosaic virus (YMV-TOG, YMV-COT, YMV-12, YMV-CAR, YMV-BU1 and YMV-BU2) were determined. The analysis of the deduced amino acid sequences revealed the presence of consensus motifs characteristic of the potyvirus genus supporting the classification of YMV as a potyvirus member. The alignment of the N-terminal part of the coat protein of YMV-TOG, YMV-COT, YMV-12 and YMV-CAR showed that they were identical in size (152 aa) while YMV-BU1 and YMV-BU2 were shorter (140 aa) due to a deletion of 12 aa. These amino acid sequences exhibit an overall sequence identity ranging from 70.4% to 97.4% while the identity level with the other potyviruses sequenced in the considered region is below 50%, confirming that YMV is a distinct member of the potyvirus genus. The detailed analysis of the amino acid sequence alignment and of the identity levels observed between the N-terminal part of the coat protein of the six YMV isolates lead us to suggest that they have to be considered as distantly related strains of YMV rather than closely related but distinct viruses.

Complementary DNA representing 728 nucleotides of the 3' end of the genomic RNA of sweetpotato virus G (SPV-G) a newly-identified potyvirus infecting sweetpotato, was cloned and sequenced. This sequence was combined with that previously determined for the 5' terminal part of the coat protein cistron of the virus. The whole sequence contained a single open reading frame (ORF) of 1065 nucleotide, with the capacity to encode a coat protein of 355 amino acids, significantly larger than that of other potyviruses. The ORF was followed by an untranslated region of 222 nucleotides and a poly (A) tail. The coat protein of SPV-G was only distantly related to that of known potyviruses, with the exception of sweetpotato feathery mottle virus (SPFMV). Indeed, sequence identity in the C-terminal three quarters of the coat protein (more than 80%) and in the 3' untranslated region (more than 70%) indicate that SPV-G should be considered as closely related to, though distinct from SPFMV. This subset relationship is similar to that previously reported for members of the bean yellow mosaic virus subgroup or the bean common mosaic virus subgroup.

El presente estudio se adelantó dentro de un proyecto de investigación para obtención de plantas resistentes al virus del mosaico del pepino (CMV), mediante la transformación y expresión del gen de la proteína de la cápside de CMV en plantas transgénicas de variedades comerciales de plátano y banano (Musa spp). Se trata de una estrategia reciente que ha sido utilizada con éxito en varios cultivos comerciales. El CMV fue detectado serológicamente (DAS-EUSA) en hojas de plátano cv. Dominico Hartón y de banano cv. Gros Michel que presentaban síntomas de mosaico. El virus se purificó parcialmente a partir de hojas infectadas de Nicotiana tabacum y con la ayuda del microscopio electrónico de transmisión, se identificaron partículas isométricas de aproximadamente 30 nm dc diámetro. El peso molecular de la proteína de la cápside en geles desnaturalizados de poliacrilamida (SDS-PAGE) fué de 28 kDa. El patrón electroforético del RNA viral de doble cadena (dcRNA) fué similar para los dos aislamientos de CMV obtenidos de plátano y banano. Utilizando la dcRNA como patrón, se sintetizó cADN por transcripción reversa y, a partir de éste, se amplificaron por PCR los genes de la proteína de Ia cápside (GPC) de ambos aislamientos. Los productos de la amplificación de aproximadamente 890 pares de bases (pb), que contenían el GPC, se donaron en el plásmido vector Bluescript KS (+/-). El análisis de restricción con endonucleasas y la secuenciación del GPC de ambos aislamientos, indicó que éstos pertenecen al subgrupo I (tipificado por el aislamiento DTL). El análisis de la secuencia nucleotídica y de aminoácidos de ambos genes, indicó una homología del 99% y un alto grado de conservación con otros miembros del subgrupo I de CMV. El GPC se está donando en plásmidos vectores para su transformación en variedades comerciales de plátano y banano en Colombia. Characterization of the Coat Protein Gene of two Cucumber MosaicVirus (CMC) Isolates from Plantain and Banana (Musa spp)The final objective of this study is to genetically engineer cucumber mosaic virus (CMV) resistance in edible Musa spp.in Colombia, by means of expressing the CMV coat protein gene in transgenic plants. This strategy has been successfully employed in other crops. CMV was serologically detected in leaves of commercially grown bananas (cv. Gros Michel) and plantains (cv. Dominico-Harton) showing mosaic symptoms. CMV was partially purified from infected tissue of Nicotiana tabacum. Transmission electron microscopy examination showed the presence of viral isometric particles of approximately 30 nm in diameter. The molecular weight of the coat protein subunit was approximately 28 kDa as determined by SDS-PAGE. Analysis of double-stranded RNA (dsRNA) indicated that the isolations present in both varieties had similar dsRNA profiles, characteristic of CMV. cDNA was reverse transcribed using viral dsRNA as the template, and the coat protein genes (CPG) of the two CMV isolates were amplified by the polymerase chain reaction (PCR). The amplified products of approximately 890 bp, containing the CPG, were cloned into the plasmid vector Bluescript KS (+/-). Based on the pattern obtained from the digestion of the amplified CP genes with Msp 1 and DNA sequencing data, the two CMV isolates were classified into the serotype subgroup I (typified by isolate DTL). Computer analysis of DNA sequences of the CP genes derived from both CMV isolates showed a 99% homology between them at the nucleotide and amino acid level as well as a high level of conservation with other members of the CMV subgroup I. The CPG of CMV are now being cloned into plant transformation vectors for their genetic engineering into banana and plantain commercial cultivars.

A combined assay of reverse transcription and the polymerase chain reaction utilizing degenerate primers derived from conserved regions in the genome of potyviruses was designed to amplify the variable 5'-terminal region of the coat protein cistron. Amplification on total RNA extracted from two sweetpotato clones originating from China (Guangdong Province) yielded a 1.35-kb fragment amplified from a sweetpotato feathery mottle virus (SPFMV) isolate from China (SPFMV-CH) associated with one or two other fragments (1.30 and 1.45 kb), suggesting the presence of two other polyviruses in these sweetpotato clones. The 1.30- and 1.45-kb amplified fragments were cloned into the Bluescript plasmid and partially sequenced [...]