Search

Selecting high-quality embryos for transfer has been a difficult task when producing bovine embryos in vitro. The most used non-invasive method is based on visual observation. Molecular characterisation of embryo growth media has been proposed as a complementary method. In this study we demonstrate a culture medium sampling method for identifying potential embryonic viability markers to predict normal or abnormal embryonic development. During single embryo culture, 20 µL culture media was removed at Days 2, 5 and 8 after fertilisation from the same droplet (60 µL). In all, 58 samples were analysed using liquid chromatography–mass spectrometry. We demonstrate that it is possible to remove samples from the same culture medium droplets and not significantly affect blastocyst rate (25.2%). Changes in any single low molecular weight compound were not predictive enough. Combining multiple low molecular weight signals made it possible to predict Day 2 and 5 embryo development to the blastocyst stage with an accuracy of 64%. Elevated concentrations of lysophosphatidylethanolamines (m/z = 453, 566, 588) in the culture media of Day 8 well-developing embryos were observed. Choline (104 m/z) and citrate (215 m/z) concentrations were increased in embryos in which development was retarded. Metabolic profiling provides possibilities to identify well-developing embryos before transfer, thus improving pregnancy rates and the number of calves born.

Eestis on veisekasvatusest lugu peetud juba kiviajast peale. Meil on heade tõuomadustega ja suure toodanguga piimakari ja kiiresti kasvav lihakari ning me suudame toota kvaliteetset piima ja veiseliha nii kohalikele tarbijatele kui ka ekspordiks. Veiste sigimisprobleemid on oluliseks veisekasvatuse kasumlikkust mõjutavaks teguriks. Selleks, et sigimisprobleemide olemust mõista ja nende teket ennetada või neid ravida, on vajalikud põhjalikud teadmised veise sigimise erinevatest aspektidest. Seni puudub üks terviklik veise sigimise alast teavet koondav eestikeelne õppevahend. Käesoleva õpiku abil soovime seda lünka täita. Oleme õpikusse kokku kogunud teadmised suguorganite morfoloogiast ja füsioloogiast, tiinusest ja sünnitusest ning poegimisjärgsetest haigustest. Suguorganite anatoomiat käsitletakse õpikus mitte klassikalise, vaid funktsionaalse anatoomia seisukohast. Veise tiinuse ja sünnituse …

Somatic cell nuclear transfer (SCNT) is, to date, the most used technology producing transgenic (TG) cattle. Depending on the gene construct and transfection method, transfection efficiency may differ greatly. Applying a more intense selection regime after transfection may obliterate the cells. An extended selection affects the passage number and leads to genotypic and phenotypic drift of the cells. We used the pBC1 Milk Expression Vector Kit (cat. no. K270-01, Invitrogen Corp., Carlsbad, CA, USA) to make the expression vector of human FSH (hFSH). For TG fibroblast cell line, the AmaxaTM NucleofectorTM Kit for Primary Fibroblasts (cat. no. VPI-1002, Lonza Grouop, Basel, Switzerland) was used. For TG fibroblast selection, G418 (neomycin) was used for 21 days with a final concentration of 400 µg mL−1. The final passage number of the cell line was 6. The primers included in the pBC1 Milk Expression Vector Kit-BCF (GATTGACAAGTAATACGCTGTTTCCTC) and BCR (CATCAGAAGTTAAACAGCACAGTTAG)-were used to control the insert. The transgenesis of the cell line was confirmed by sequencing the PCR product and analysing it with the BlastN and Bioedit software to make sure the fibroblast cell line was hFSH-positive. These cells were thereafter randomly used for SCNT as donor cells. All the SCNT embryos were cultured for 4 days in IVF Bioscience (Falmouth, United Kingdom) culture media and then biopsied. After aspirating 1 blastomere from the 6- to 8-cell-stage embryo, the biopsied embryos were further individually cultured until Day 7 and blastocyst formation was recorded. Genomic DNA from the biopsies was isolated and amplified with REPLI-g Single Cell Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The primers BCF and BCR were used to control the hFSH positivity of the embryos, and the PCR product was visualised on a 1% agarose gel. From 62 biopsied SCNT cloned embryos, 22 (35.48%) tested TG positive. The total blastocyst yield from biopsied embryos was 26 (41.

This book focuses on opportunities and challenges in implementing a bioeconomy strategy from a research and education perspective. It is the second e-book produced by EURAGRI, following “Diffusion and transfer of knowledge in agriculture”, published in December 2016. It draws on contributions presented during the 30th EURAGRI annual conference held in Tartu (Estonia) in September 2016, as well as on other workshops organised as part of EURAGRI. EURAGRI is an informal gathering of EU research and higher education organisations and ministries interested in agri-food research. It works as a platform of exchange and discussion on topics of common interest pertaining to the organisation, orientation and outlook of agri-food research in Europe in connection with global changes. It holds annual conferences and organises workshops twice a year.

Selecting high quality preimplantation embryo for transfer has been the most difficult task when producing embryos in vitro. To date the most used non-invasive method is based on visual observation. Developing a non-invasive method for embryo assessment is essential to have a profitable in vitro embryo production (IVP) and embryo transfer system. Molecular characterization of embryo growth media has been proposed as an complementary method to visual assessment of embryo morphology. In this study we are demonstrating a novel method, allowing sample collection at different embryo development stages, without compromising embryo quality, to determine potential viability markers for bovine IVP. Single bovine embryos were cultured in 60µl SOF+0.4% BSA droplets under mineral oil. Twenty µl of culture media was removed at day 2, 5 and 8 post-fertilization. A total of 58 samples were analyzed using liquid chromatography-mass spectrometry (Q-Trap 3200), followed by principal component analysis. Our results indicate that there are significant differences (p<0,00001) in concentrations for proline (m/z = 116), inositol (m/z of sodium adduct = 203) and citrate (m/z of sodium adduct = 215) also in the amino acid group of leucine and isoleucine (m/z = 132), phenylalanine (m/z = 165) and arginine (m/z = 211) between the normally developed and retarded in development embryo culture media. Platelet activating factor (m/z = 524) (PAF) was roughly 3 fold increased in day 5 to day 8 embryo culture media. Unfortunately the increase of PAF was not statistically significant between normally developing and retarded embryos. These results demonstrate that it is possible to remove culture media samples from droplets and not significantly affect embryo development. Applying this method for embryo selection provides a possibility to identify well-developing embryos and provides an opportunity for improving the herds genetic value.

Over a few decades the bovine in vitro embryo production (IVP) systems have been improving rapidly. Still, the goal to produce the same quality embryos in vitro as in vivo has not yet been reached. The FCS is usually added to media during IVP to provide growth factors and energy sources. Currently, serum-free culture systems are often preferred due to the lower risk of contamination and prevention of the development of large offspring syndrome. The aim of this study was to establish whether complete elimination of FCS from the bovine IVP system has an effect on blastocyst rates, embryo quality, and embryo survival rates after slow freezing. We replaced our conventional in vitro maturation (IVM) medium [tissue culture medium-199, 10% (v/v) FCS, 10 µg mL–1 epidermal growth factor (EGF), 1500 U mL–1 serum gonadotropin and chorionic gonadotropin (PG600), Na-pyruvate 0.5 mM, gentamycin sulfate 50 µg mL–1 and l-glutamine 1 mM] with SOF (SOFaaci) supplemented with 0.4% fatty acid-free BSA fraction V, 10 µg mL–1 EGF, and 1500 U mL–1 PG600. Matured cumulus-oocyte complexes (COC) from both experimental groups (total of 1145 from serum-free IVP and 687 from our conventional IVP system) were used for in vitro fertilisation and culture. Blastocyst rates were similar in the serum-free and our usual IVP protocol, 18 and 22%, respectively. Seventy-seven Grade 1 (according to IETS) Day 7 blastocysts from the serum-free IVP system and 80 Grade 1 Day 7 blastocysts from our conventional IVP system were frozen in 1.5 M ethylene glycol and 0.1 M sucrose containing cryopreservation medium. The post-thaw survival rates after 24 h of culture and evaluated as percentages of re-expanded embryos were 63.6% for the serum-free IVP and 46.3% for the conventional IVP system (P < 0.05, Z Test for 2 population proportions). These results indicate that it is possible to have a completely serum-free bovine IVP system and based on the slow freezing and thawing results the quality of serum-free IVP embr

Tuuma siirdamise teel kloonimise efektiivsus on väga madal, sageli on elussündide osakaal alla 1%(Watanabe, 2013). Embrüonaalses arengus on väga oluline etapp doonorraku tuuma ümberprogrammeerimine, mis ei pruugi kloonimise puhul toimuda täies ulatuses. Puuduliku ümberprogrammeerimise tulemusena peetub kloonembrüote kasv erinevates arenguetappides ning lõpeb sageli loote surmaga (Chitwood jt, 2013; Graf jt, 2014). Suurem osa probleemidest avaldub varastes arenguetappides. Kuid ka hilisemas arengus võib avalduda kõrvalekaldeid normaalsest arengust–sageli esineb kloontiinuste puhul platsentoomide suurenemist ja nende arvu vähenemist, suurenenud läbimõõduga nabanööri ja ka vasikad ise on keskmisest suuremad. Sellist nähtust nimetatakse suure järglase sündroomiks (Chitwood jt, 2013; Graf jt, 2014).

A significant proportion of mammalian fertilization is mediated through the proteomic composition of the sperm surface. These protein constituents can present as biomarkers to control and regulate breeding of agricultural animals. Previous studies have addressed the bovine sperm cell apical plasma membrane (PM) proteome with nitrogen cavitation enrichment. Alternative workflows would enable to expand the compositional data more globally around the entire sperm's surface. We used a cell surface biotin‐labeling in combination with differential centrifugation to enrich sperm surface proteins. Using nano‐LC MS/MS, 338 proteins were confidently identified in the PM‐enriched proteome. Functional categories of sperm–egg interaction, protein turnover, metabolism as well as molecular transport, spermatogenesis, and signal transduction were represented by proteins with high quantitative signal in our study. A highly significant degree of enrichment was found for transmembrane and PM‐targeted proteins. Among them, we also report proteins previously not described on bovine sperm (CPQ, CD58, CKLF, CPVL, GLB1L3, and LPCAT2B) of which CPQ and CPVL cell surface localization was further validated. A descriptive overview of the bovine sperm PM integral and peripheral proteins is provided to complement future studies on animal reproduction and its relation to sperm cell surface. All MS data have been deposited in the ProteomeXchange with identifier PXD001096 (http://proteomecentral.proteomexchange.org/dataset/PXD001096).

The need for noninvasive embryo quality assessment techniques has increased as the in vitro production of cattle embryos has become more popular and necessary in the beef and milk production industries. In this study, we assessed the metabolomic profile of embryo culture media to determine whether it is possible to evaluate differences in low-molecular-weight metabolites in the culture media composition of morula stage embryos compared with embryos that develop to the blastocyst stage. Single bovine embryos were cultured in 60-µL SOF+0.4% BSA droplets under mineral oil. Twenty microliters of culture media was removed at Day 2, 5, and 8 post-fertilization. Cultured droplets without a zygote served as the control samples. A total of 42 samples were analysed using liquid chromatography-mass spectrometry (Q-Trap 3200, Ab Sciex, Framingham, MA, USA), followed by principal component analysis. Our preliminary results indicated significant differences (P < 0.00001) in 10 low-molecular-weight compounds between the groups. Three of those compounds (588, 589, and 702 Da) were represented in higher concentrations only in embryos that advanced into the blastocyst stage. These first results could allow the identification of embryos with improved viability and give better understanding of the development of pre-implantation embryo.

No abstract available

In the present study, we describe the deep sequencing and structural analysis of the Holstein breed bull genome. Our aim was to receive a high-quality Holstein bull genome reference sequence and to describe different types of variations in its genome compared to Hereford breed as a reference. We generated four mate-paired libraries and one fragment library from 30 μg of genomic DNA. Colour space fasta were mapped and paired to the reference cow (Bos taurus) genome assembly from Oct. 2011 (Baylor 4.6.1/bosTau7). Initial sequencing resulted in the 4,864,054,296 of 50-bp reads. Average mapping efficiency was 71.7 % and altogether 3,494,534,136 reads and 157,928,163,086 bp were successfully mapped, resulting in 60 × coverage. This is the highest coverage for bovine genome published so far. Tertiary analysis found 6,362,988 SNPs in the bull’s genome, 4,045,889 heterozygous and 2,317,099 homozygous variants. Annotation revealed that 4,330,337 of all discovered SNPs were annotated in the dbSNP database (build 137) and therefore 2,032,651 SNPs were novel. Large indel variations accounted for the 245,947,845 bp of the variation in entire genome and their number was 312,879. We also found that small indels (number was 633,310) accounted for the total variation of 2,542,552 nucleotides in the genome. Only 106,768 small indels were listed in the dbSNP. Finally, we identified 2,758 inversions in the genome of the bull covering in total 23,099,054 bp of genome’s variation. The largest inversion was 87,440 bp in size. In conclusion, the present study discovered different types of novel variants in bull’s genome after high-coverage sequencing. Better knowledge of the functions of these variations is needed.

Somatic cell nucleus transfer (SCNT) and in vitro culture of reconstructed embryos are the pivotal steps for successful cloning and generation of transgenic cattle. The aim of the study was to determine the influence of different cell fusion parameters, maturation, and culture conditions and the type of a cell line (bovine fetal fibroblast cell lines with or without gene transfection) on SCNT blastocyst development. Slaughterhouse-derived oocytes were matured for 17 h in TCM-199 (Sigma, St. Louis, MO, USA) supplemented with 0.05 µg mL–1 of epidermal growth factor (EGF) and 15 IU mL–1 of hCG/eCG (Intervet, PG600) or 10 µg mL–1 of FSH and 12.5 mU mL–1 of LH (Sioux Biochemical Inc., Sioux Center, IA, USA). Four fetal fibroblast cell lines (4 to 5 passages) and identical cell lines transfected with plasmid containing either human erythropoietin, FSH, growth hormone, or insulin-coding cDNA under β-casein promoter (7 to 9 passages) were used for SCNT. Cell fusion was induced by 2 direct-current pulses in 0.5 or 0.2 micro fusion chambers (Eppendorf Multiporator) using one of the following treatments: 100V for 15 µs (F1), 65V for 25 µs (F2), 65V for 20 µs (F3; all in a 0.5-mm chamber), or 36V for 25 µs (F4; 0.2-mm chamber). Fused complexes were activated with 4 µg mL–1 of Ca-ionophore for 4 min and then incubated for 5 h in 2 mM DMAP. The embryos were cultured in SOFaaci medium (Holm et al. 1999) or in commercial SOF medium (Minitüb GmbH, Tiefenbach, Germany) for 7 days. Data were analysed by ANOVA and the chi-square test. The results of the study showed that the cleavage rate of the reconstructed embryos was influenced by the fusion regimen (P < 0.05) but not by the donor cell type (P < 0.05). Treatments F2 and F3 resulted in cleavage rates higher (P < 0.05) than F1 and F4 (77.2, 82.0, 62.8, and 63.1%, respectively). Blastocyst yield was not significantly influenced by the different in vitro maturation (IVM) media – altogether, addition of FSH/LH resulted in 14.6% (158/107

The aim of our study was to create a high-quality Holstein cow genome reference sequence and describe the different types of variations in this genome compared to the reference Hereford breed. We generated one fragment and three mate-paired libraries from genomic DNA. Raw files were mapped and paired to the reference cow (Bos taurus) genome assemblies bosTau6/UMD_3.1. BioScope (v1.3) software was used for mapping and variant analysis. Initial sequencing resulted in 2,842,744,008 of 50-bp reads. Average mapping efficiency was 78.4 % and altogether 2,168,425,497 reads and 98,022,357,422 bp were successfully mapped, resulting in 36.7X coverage. Tertiary analysis found 5,923,230 SNPs in the bovine genome, of which 3,833,249 were heterozygous and 2,089,981 were homozygous variants. Annotation revealed that 4,241,000 of all discovered SNPs were annotated in the dbSNP database and 1,682,230 SNPs were considered as novel. Large indel variations accounted for 48,537,190 bp of the entire genome and there were 138,504 of them. The largest deletion was 18,594 bp and the largest insertion was 13,498 bp. Another group of variants, small indels (n = 458,061), accounted for the total variation of 1,839,872 nucleotides in the genome. Only 92,115 small indels were listed in the dbSNP and therefore 365,946 small indels were novel. Finally, we identified 1,876 inversions in the bovine genome. In conclusion, this is another description of the Holstein cow genome and, similar to previous studies, we found a large amount of novel variations. Better knowledge of these variations could explain significant phenotypic differences (e.g., health, production, reproduction) between different breeds.

In present study we describe the sequencing and annotated analysis of the individual genome of Estonian. Using SOLID technology we generated 2,449,441,916 of 50-bp reads. The Bioscope version 1.3 was used for mapping and pairing of reads to the NCBI human genome reference (build 36, hg18). Bioscope enables also the annotation of the results of variant (tertiary) analysis. The average mapping of reads was 75.5% with total coverage of 107.72 Gb. resulting in mean fold coverage of 34.6. We found 3,482,975 SNPs out of which 352,492 were novel. 21,222 SNPs were in coding region: 10,649 were synonymous SNPs, 10,360 were nonsynonymous missense SNPs, 155 were nonsynonymous nonsense SNPs and 58 were nonsynonymous frameshifts. We identified 219 CNVs with total base pair coverage of 37,326,300 bp and 87,451 large insertion/deletion polymorphisms covering 10,152,256 bp of the genome. In addition, we found 285,864 small size insertion/deletion polymorphisms out of which 133,969 were novel. Finally, we identified 53 inversions, 19 overlapped genes and 2 overlapped exons. Interestingly, we found the region in chromosome 6 to be enriched with the coding SNPs and CNVs. This study confirms previous findings, that our genomes are more complex and variable as thought before. Therefore, sequencing of the personal genomes followed by annotation would improve the analysis of heritability of phenotypes and our understandings on the functions of genome.

Communication between various ovarian cell types is a prerequisite for folliculogenesis and ovulation. In antral follicles granulosa cells divide into two distinct populations of mural and cumulus granulosa cells (CGC), enveloping the antrum and surrounding the oocyte, respectively. Both cell types, with the mural compartment in excess, contribute to the floating granulosa cell (FGC) population in the follicular fluid. The aim of this study was to compare the transcriptomes of FGC and CGC in stimulated antral follicles obtained from 19 women undergoing IVF–ICSI procedure. FGC were obtained from follicular fluid during the follicle puncture procedure and CGC were acquired after oocyte denudation for micromanipulation. Gene expression analysis was conducted using the genome-wide Affymetrix transcriptome array. The expression profile of the two granulosa cell populations varied significantly. Out of 28 869 analysed transcripts 4480 were differentially expressed (q-value < 10−4) and 489 showed ≥2-fold difference in the expression level with 222 genes up-regulated in FGC and 267 in CGC. The transcriptome of FGC showed higher expression of genes involved in immune response, hematological system function and organismal injury, although CGC had genes involved in protein degradation and nervous system function up-regulated. Cell-to-cell signalling and interaction pathways were noted in both cell populations. Furthermore, numerous novel transcripts that have not been previously described in follicular physiology were identified. In conclusion, our results provide a solid basis for future studies in follicular biology that will help to identify molecular markers for oocyte and embryo viability in IVF.