Search

The ability of MutS to recognize mismatched DNA is required to initiate a mismatch repair (MMR) system. ATP binding and hydrolysis are essential in this process, but their role in MMR is still not fully understood. In this study, steady-state ATPase activities of MutS from Escherichia coli were investigated using the spectrophotometric method with a double end-blocked heteroduplex containing gapped bases. The ATPase activities of MutS increased as the number of gapped bases increased in a double end-blocked heteroduplex with 2-8 gapped bases in the chain, indicating that MutS dissociates from DNA when it reaches a scission during movement along the DNA. Since movement of MutS along the chain does not require extensive ATP hydrolysis and the ATPase activity is only enhanced when MutS dissociates from a heteroduplex, these results support the sliding clamp model in which ATP binding by MutS induces the formation of a hydrolysis-independent sliding clamp.

To study the effect of sequence on DNA structure, the two decamer crystal structures one alternating, d(GTACGCGTAC), and the other non-alternating, d(GGCCGCGGCC), were solved. Crystals of both decamers belong to the hexagonal space group P6 1 22, with one strand in the asymmetric unit. The unit cell constants of the alternating decamer are a = b = 39.26 A, c = 77.70 A. The structure was refined with 1,828 reflections from 8.0 to 2.0 A resolution to an R value of 21.3% with all DNA atoms and 63 water molecules. The isomorphous non-alternating decamer had unit cell dimensions of a = b = 39.05 A, c = 82.15 A. The structure was refined with 2,423 reflections from 8.0 to 2.0 A resolution to a final R value of 22.2% for all DNA atoms and 65 water molecules. Although the average helical parameters of the decamers are typical of A-DNAs, there are some minor differences between them. The helical twist, rise, x-displacement, inclination and roll alternate in the alternating decamer, but do not in the non-alternating decamer. The backbone conformations in both structures show some differences; the residue G(7) of the alternating decamer is trans for a and ywhile the trans conformations are observed at the residue G(8) of the non-alternating decamer.

Ground and low-lying electronic states of Cr atoms in the gas phase were generated from photolysis of Cr(CO) 6 vapor in He or Ar using an unfocussed weak UV laser pulse and their reactions with O 2 and N2O were studied. When 0.5-1.0 Torr of Cr(CO)6 /O2 /He or Ar mixtures were photolyzed using 295-300 nm laser pulses, broadband chemiluminescence peaked at ~420 and ~500 nm, respectively, was observed in addition to the atomic emissions from z 7 P o , z 5 P o , and y 7 P o states of Cr atoms. When N2O was used instead of O2, no chemiluminescence was observed. The chemiluminescence intensities as well as the LIF intensities for those three low-lying electronic states (a 7 S3, a 5 S2 and a 5 DJ) showed second-order dependence on the photolysis laser power. Also, the chemiluminescence intensities were first-order in O 2 pressure, but the presence of excess Ar showed a strong inhibition effect on them. Based on the experimental results, the chemiluminecent species in this work is attributed to CrO 2* generated from hot ground state Cr atoms with O 2. The apparent radiative lifetimes of the chemiluminescent species and collisional quenching rate constants by O 2 and Ar also were investigated.

Excitation and emission spectra and luminescence lifetimes of Eu3+ complexes obtained by dissolving anhydrous EuCl3 and EuCl3/2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol (Bis-tris) in anhydrous dimethylformamide (DMF) and those from a Eu(Bis-tris)2Cl3 crystalline sample have been studied. Two distinct Eu3+ complexes were observed when anhydrous EuCl3 was dissolved in anhydrous DMF, and one was interpreted as an outer-sphere complex of Cl− anion. Dissolution of an excess amount of vacuum dried NaClO4 or KPF6 in anhydrous DMF resulted in longer luminescence lifetimes, presumably reducing the effects of trace amounts of water in the solvent due to competitive binding of the water in the solvent by alkali metal cations. The quenching rate constant for the 5D0 state of Eu3+ ion by each complexed DMF molecule in solution and by each OH group in the Bis-tris from the Eu(Bis-tris)2Cl3 crystalline sample were 54 ± 1 and 495 ± 5 s−1, respectively, and these were used to interpret the plausible structures of the different Eu3+ complexes in the EuCl3/Bis-tris/DMF solution.

The ground-state FeO molecules are generated from photolysis of Fe(CO) 5 in a Fe(CO) 5 /M(O 2 or N 2 O)/Rg(He or Ar) mixture using an unfocused weak UV laser beam. The formation of ground-state FeO molecules is identified by a laser-induced fluorescence (LIF) method. The LIF signal from FeO molecules is stronger in O 2 than in N 2 O at the same partial pressures. The radiative lifetimes for seven bands in the FeO orange system are measured. They are substantially different depending on the excited band ranging from 260±30 ns to 590±50 ns.

Vibronic relaxation among the Clements bands of SO2 molecule has been studied from time-resolved fluorescence spectra in the 300−350 nm region. The K‘ = 6, J‘ = 7 level of the Clements E-band was populated at 32 812.8 cm-1, and detailed time-resolved fluorescence spectra for the period 0−160 ns were obtained. Following the fast decay of the laser excited level, weak emissions from Clements A−F bands appeared almost simultaneously. The simultaneous appearance of many Clements bands was attributed to fast rovibronic relaxation of the laser excited molecules among the dark levels. It was also found that the broad apparent continuum emission following the direct fluorescence showed different decay rates at different wavelengths, but the decay rates of the emissions for λ > 350 nm were virtually identical. Based on the wavelength dependence of the decay rates, the apparent continuum emissions were ascribed to the emissions from the rovibronically dispersed hybrid bright states and the low-lying rovibrational l...

Collisional quenching of Ga(5p) atoms by H 2 , D 2 and CH 4 has been studied. The gallium atoms were generated by photolysis of trimethyl gallium using a KrF laser. The Ga(5p) state was populated by two-photon excitation from the ground state and cascade fluorescence from Ga(5s) atoms was analyzed to extract quenching rate constants for Ga(5p) atoms. The apparent quenching rate constants for Ga(5p) atoms are (4.6±0.3)×10 −10 , (3.4±0.3)×10 −10 and (7.8±0.2)×10 −11 cm 3 molecule −1 s −1 by H 2 , D 2 and CH 4 , respectively. It is found that the predominant process for the large quenching rate constants for Ga(5p) atoms by H 2 and D 2 is the energy transfer for Ga(5s) formation.

Epitaxial PbTiO 3 thin films were prepared in situ by pulsed laser deposition on MgO(001) and SrTiO 3 (001) single crystal substrates. The effects of oxygen pressure and substrate temperature on the growth of films were investigated. The favorable conditions for the fabrication of epitaxial films were identified. Appropriate control of oxygen pressure in the range of 200–250 mTorr was necessary for epitaxial PbTiO 3 thin films and higher substrate temperature up to 700°C was preferred. The epitaxial relation between film and substrate is PbTiO 3 {001}//MgO(001), PbTiO 3 〈100〉//MgO[100]. The chemical composition of the film was very similar to the ideal stoichiometry of PbTiO 3 .

The relaxation kinetics on the first excited singlet state ( 1 A 2 ) of SO 2 have been studied from time-resolved emission spectra in the 300–450 nm region. Two rovibronic levels belonging to the elements E-band and the 1 A 2 (0,8,1) level, which are located above and below the origin of the 1 B 1 state, respectively, were excited to investigate the role of the 1 B 1 state on the relaxation kinetics. Direct emissions from the laser excited rovibronic levels in the 1 A 2 state and direct intersystem crossing between the 1 A 2 (0,8,1) and 3 B 1 states were observed and revised relaxation kinetic schemes are proposed.

Relative formation efficiencies of the ground state Fe atoms from two-photon dissociation of Fe(CO)5 have been studied using an unfocused weak laser pulse at 386.0, 368.0, 319.3 and 298.4 nm. The laser wavelengths correspond to a5D4 → z5D4, a5D4 → z5F4, a5D4 → z3F4 and a5D4 → y5D3 transition frequencies of an Fe atom. The relative amounts of Fe atoms generated by two-photon dissociation of Fe(CO)5 were obtained by comparing the emission intensities from the excited state of Fe atoms with and without a pulsed dc discharge. The relative formation efficiencies are 100:21:0.2:0.08 as the photon energy decreased.

When an unfocused laser beam with narrow linewidth whose frequency matches exactly and atomic transition line of the Fe atom was passed through a gas mixture containing Fe(CO)5, atomic emissions from the state-selected excited state of Fe atoms were observed. The power dependence of the emission intensities as well as excitation and fluorescence spectra suggested that the state-selected excited state Fe atoms are generated by one-photon absorption of the ground state Fe atoms formed by two-photon dissociation of Fe(CO)5 within a single laser pulse.

Crystallographic properties such as lattice constants, degree of c‐axis orientation, and c/a ratio of tetragonal Pb1−xLaxTiO3 (PLT, x=0–0.28) epitaxial thin films grown by pulsed laser deposition on single‐crystal substrates such as MgO(001) and SrTiO3(001) were evaluated. General x‐ray‐diffraction techniques—θ‐2θ scan and Φ scan—were used to confirm the epitaxial relations between films and substrates. The epitaxial relations were PLT(001) or (100)//substrate (001) and PLT[100] or [001]//substrate[100]. Then, using the {303} asymmetric rocking curve technique, more quantitative crystallographic informations of PLT films could be obtained. The c/a ratio and lattice constant along the a axis of c‐axis‐oriented PLT tetragonal unit cell were calculated from the peak location of {303} rocking curve, which is slightly different from that of the powder or bulk PLT. The existence of a‐axis‐oriented domains was also verified in PLT films grown on SrTiO3 substrate by {303} rocking curve. The origin of the observed...

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

Radiative lifetimes for Ga(4d 2 D 3 2 ) and Ga(4d 2 D 5 2 ) states have been investigated by a laser-induced fluorescence technique. The individual spin-orbit state of Ga(4d) atoms was formed from the Ga(4p 2 D 3 2 ) atoms generated by a pulsed discharge of a trimethyl gallium and Ar mixture. The radiative lifetimes for the Ga(4d 2 D 3 2 ) and Ga(4d 2 D 5 2 ) states are 7.5 ± 0.2 and 9.0 ± 0.3 ns, respectively, and the two states are strongly coupled in Ar. The intramultiplet mixing rate constants assigned from kinetic simulations of time profiles are (12 ± 3) × 10 −3 and (8±2)×10 −10 cm 3 molecule −1 s −1 , respectively.

We have synthesized novel fluorophores by using Sonogashira reactions of 1,4-bis(dibromovinyl)benzene and 2,5-bis(dibromovinyl)thiophene with various aromatic bromides. The emission maxima of these fluorophores vary from the indigo blue to the reddish-orange region, depending on the structures of aromatic nuclei and peripheral moieties.

Using an RNA/peptide dual-aptamer probe, both PSMA (+) and PSMA (−) prostate cancer cells were simultaneously detected by electrochemical impedance spectroscopy. This approach can be applied as a general tool for early diagnosis of prostate cancer.

We have systematically measured the noise power spectral density ( S υ ( f )) of the YBCO micro-bridge as a function of frequency, temperature and magnetic field. In all the cases above, S υ ( f ) shows V 2 / f α behaviour at the measured frequency range of 0.2 f V , the d.c. voltage across the sample and, α the fitting parameter to be determined. In the normal state, the normalized noise power spectral density ( S n ( f ) = S υ ( f )/ V 2 ) is four or five orders of magnitude larger than that of the normal metals evaluated by Hooge's formula or thermal fluctuation model. Near the zero resistance temperature ( T c 0 , S n ( f ) was found to further increase by eight orders of magnitude and α was shown to increase from 1 to 2 depending on the frequency range. Furthermore, once a magnetic field is applied, S n ( f ) showed a marked increase near T c O . This anomaly is attributed to magnetoic vortices coupled with the enhanced instability of space-time coherence associated with Cooper pair as a result of applied magnetic field.

The effect of wild-type and mutant MutL on the steady-state ATPase activity of MutS from Escherichia coli has been investigated in the absence and presence of 22, 50, and 75 base pair hetero- and homoduplex DNAs with open and blocked ends. The steady-state ATPase activity of MutS has been measured at 37 degrees C using a spectrophotometric method. The presence of MutL did not affect appreciably on the ATPase activity of MutS in the absence of DNA or in the presence of blocked end homoduplex DNAs. However, the addition of MutL affected oppositely on the ATPase activity of MutS in the presence of G-T mismatched DNAs depending on their end status. We have also found that only the ATPase active forms of MutL increased the ATPase activity of MutS in the presence of G-T mismatched DNAs with blocked ends. The results suggest that MutL ATPase activity is required to catalyze dissociation of the MutS sliding clamps.

In situ high‐Tc superconducting thin films of YBa2Cu3O7−x were deposited on (100) SrTiO3 substrate by laser ablation with a glancing angle geometry at different substrate temperatures in the 560–700 °C range. The transition temperatures, x‐ray diffraction patterns, and surface morphologies of the films were substantially different from one another. The critical temperatures of the films deposited at below 600 °C were 72–84 K, while the films deposited at above 650 °C showed Tc0 of 85–91 K. The x‐ray diffraction patterns and surface morphologies of the films showed that the orientations of the deposited films depended on the substrate temperature. The films deposited at 700 °C showed an exclusive orientation of ‘‘c’’ axis perpendicular to the (100) SrTiO3 substrate surface, but those deposited at below 600 °C exhibited random but a preferential orientation of c axis parallel to the (100) SrTiO3 surface. The dependence of the film orientations versus substrate temperature is explained in terms of lattice mi...

We have investigated the dissipation characteristics in the mixed state of ${\mathrm{YBa}}_{2}$${\mathrm{Cu}}_{3}$${\mathrm{O}}_{7\mathrm{\ensuremath{-}}\mathrm{\ensuremath{\delta}}}$ film, grown epitaxially on the ${\mathrm{SrTiO}}_{3}$(100) substrate, in terms of external transport current as well as magnetic field applied parallel to the c axis of the film. The dissipation fits well the thermally activated flux creep model, R=${\mathit{R}}_{0}$ exp(-U/${\mathit{k}}_{\mathit{B}}$T), where U is a function of electrical current, magnetic field, and temperature. In the range of current density \ensuremath{\sim}20\char21{}4000 A/${\mathrm{cm}}^{2}$, the current dependence of the activation energy U scales with ln(I/${\mathit{I}}_{0}$), as observed recently by Zeldov et al. U shows a power-law dependence on magnetic field as ${\mathit{H}}^{\mathrm{\ensuremath{-}}\mathrm{\ensuremath{\beta}}}$ with \ensuremath{\beta}=0.73\ifmmode\pm\else\textpm\fi{}0.002. We obtain the resistance prefactor ${\mathit{R}}_{0}$ proportional to the applied magnetic field, provided the Ginzburg-Landau-type magnetic-field suppression of the mean-field transition temperature ${\mathit{T}}_{\mathit{c}0}$ is taken into account. In addition, we present the magnetoresistance at various temperatures below ${\mathit{T}}_{\mathit{c}0}$, in good accordance with the flux-creep model.

MutL is required to assist the mismatch repair protein MutS during initiation of the methyl-directed mismatch repair (MMR) response in various organisms ranging from prokaryotes to eukaryotes. Despite this necessity, the inherent propensity of MutL to aggregate has led to significant difficulties in determining its biological relationship with other MMR-related proteins. Here, we perform analysis on the thermostable MutL protein found in Thermotoga maritima MSB8 (TmL). Size exclusion chromatographic analysis indicates the lack of aggregated forms with the exception of a dimeric TmL. Small-angle X-ray scattering (SAXS) analysis reveals that the solution structures of the full-length TmL and its corresponding complexes with nucleotides and ssDNA undergo conformational changes. The elucidated TmL SAXS model is superimposed to the crystal structure of the C-terminal domain of Escherichia coli MutL. In addition, the N-terminal SAXS model of TmL exists as monomeric form, indicating that TmL has a structurally flexible N-terminal domain. TmL SAXS analysis can suggest a considerable possibility on a new 3D view of the previously unresolved full-length MutL molecule.

We have fabricated three-dimensional (3D) photonic quantum ring lasers with an equilateral triangle microcavity. Their spectra were well explained by combining the off-normal resonance and hexagonally bounced in-plane whispering-gallery-mode condition. The angular distribution of the emission modes and their discrete wavelengths were shown to be in excellent agreement with a 3D Rayleigh Fabry-Perot model. We confirmed that the allowed modes in the equilateral triangle microcavity decrease by decreasing the length of equilateral triangle side, L, and the spectral mode spacing linearly increases with the mode index m and is inversely proportional to L2.

We report on a new, simple, effective and fast cell sorting method for massive micro-manipulation of biological cells or small particles in microfluidic channel involving a sorter-on-mega photonic quantum ring (PQR) hole laser chip scheme.

We have synthesized a family of bis-enediynes by two complementary Pd/Cu-catalyzed Sonogashira cross-coupling methods. One is a modified Sonogashira reaction between the TMS-protected tetraalkyne 20 (or 21) and various aromatic bromides to afford bis-enediynes 22a-d and 23a-d bearing different peripheral aryl units. The other, the reaction of bifunctional 1,1-dibromo-1-alkenes with phenylacetylene, afforded a series of bis-enediynes 24-32 bearing various core aryl groups. These chemical modifications to the core and periphery of bis-enediynes induce dramatic changes in absorption and emission spectra. Bis-enediynes 22 and 23 show a large Stokes shift of about 50-110 nm when compared to the less-conjugated bis-enediynes 20 and 21. Absorptions and emissions of bis-enediynes 25, 27-29, and 31 were red-shifted relative to those of enediyne 35. Substantial increases in fluorescence quantum yields are observed as a result of extending the pi-conjugation. The emission wavelength of bis-enediynes was tailored from indigo blue to reddish-orange, suggesting that the color of emission can be tunable by modification of the core and/or peripheral units.

A new class of fluorescence sensors for ammonium and organoammonium ions has been disclosed. One of the sensors, an alaninol-derived tripodal oxazoline (1a) shows significant fluorescence enhancement upon binding NH(4)(+) but little response toward K(+), Na(+), and Mg(2+) ions. Owing to its chiral environment, a phenylglycinol-derived tripodal oxazoline (1b) shows chiral discrimination in fluorescence upon binding enantiomeric guests. [reaction: see text]

The luminescence of terbium(III) and europium(III) through luminescence resonance energy transfer from mononucleotides and oligodeoxynucleotides is examined. Among mononucleotides, dGMP gives the strongest luminescence of terbium(III), while dTMP and dCMP yield a luminescence intensity of europium(III) that is larger than the other two cases. In the homodeoxydecamers, decadeoxycytidylic acid (dC10) produces the highest intensity for both metals. The anomalously large cooperativity of dC10 is explained by the easiness of deformation of the helical structure to bind lanthanide ions, and a circular dichroism study supports this explanation.

The measurement of the normalized noise power spectral density (Sn(f)=Sv(f)/V2) of the YBCO microbridge sows 1/falpha dependence. The key features of the present measurements are as follows: in the normal state, Sn(f) is several orders of magnitude larger than the value predicted by Hooge (1969); near Tc, Sn(f) increases by several orders of magnitude and alpha approaches 2; the noise power increases in a magnetic field near Tc. This enhancement of Sn(f) seems to be related to fluctuation at the phase transition due to the instability of Cooper pair formation and breaking.

From three dimensional whispering gallery cavities of GaAs photonic quantum ring fabricated in hyperboloid drum shape by chemically assisted ion beam etching with the central active region diameter of 0.9μm, we have observed single mode lasing near 838nm with a record low injection threshold of 300nA (Jth=47.1A∕cm2) in continuous wave operation at room temperature. This indicates that the quantum ring lasing phenomena associated with the three dimensional whispering gallery modes continue to persist, even at the submicron range overcoming the conventional two dimensional whispering gallery mode limit.

A commonly used buffer, 2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol (Bis-Tris) coordinates lanthanide(III) ion strongly in water to form molecular species that are highly active for the hydrolysis of a phosphate diester, bis(4-nitrophenyl) phosphate.