Search

In vitro production of embryos (IVP) is increasingly applied in dairy cattle breeding and promises widespread use of females of superior genetic merits. One of the current challenges with implementation of IVP is the variability in blastocyst rates. Several factors contribute to these variabilities, among which is known to be the bull used for oocytes fertilization. The extent of genetic control of bulls’ effect on IVP performances is yet to be investigated. This study estimates genetic parameters for bull effects on IVP performance traits including blastocyst rate, hatching rate and an index trait combining Blastocyst rate, Kinetic Score, and Morphology score (BL_M_K). The IVP experiments were performed using oocytes aspirated from slaughterhouse ovaries from Holstein cows, fertilized with semen from 123 Holstein bulls. A total of 77 in vitro fertilization (IVF) experiments with 163 records (different IVF groups) were available for the analysis. The results indicate low to moderate heritability and moderate to high repeatability estimates for bull effects on IVP performance traits. Our study also showed that some semen quality traits had significant effects on IVP performance. This included strong genetic correlations between pre-cryopreservation sperm viability and blastocyst rate as well as BL_M_K score at days 7 and 8. Despite the generally weak bull effect correlations and the high standard errors of the estimates, our results provide initial evidence of a measurable genetic component in the bull's impact on IVP performance traits. However, the high standard errors underscore the need for further studies with a larger sample size.

Springtails (Collembola) inhabit soils from the Arctic to the Antarctic and comprise an estimated ~32% of all terrestrial arthropods on Earth. Here, we present a global, spatially-explicit database on springtail communities that includes 249,912 occurrences from 44,999 samples and 2,990 sites. These data are mainly raw sample-level records at the species level collected predominantly from private archives of the authors that were quality-controlled and taxonomically-standardised. Despite covering all continents, most of the sample-level data come from the European continent (82.5% of all samples) and represent four habitats: woodlands (57.4%), grasslands (14.0%), agrosystems (13.7%) and scrublands (9.0%). We included sampling by soil layers, and across seasons and years, representing temporal and spatial within-site variation in springtail communities. We also provided data use and sharing guidelines and R code to facilitate the use of the database by other researchers. This data paper describes a static version of the database at the publication date, but the database will be further expanded to include underrepresented regions and linked with trait data.

Soil life supports the functioning and biodiversity of terrestrial ecosystems. Springtails (Collembola) are among the most abundant soil arthropods regulating soil fertility and flow of energy through above- and belowground food webs. However, the global distribution of springtail diversity and density, and how these relate to energy fluxes remains unknown. Here, using a global dataset representing 2470 sites, we estimate the total soil springtail biomass at 27.5 megatons carbon, which is threefold higher than wild terrestrial vertebrates, and record peak densities up to 2 million individuals per square meter in the tundra. Despite a 20-fold biomass difference between the tundra and the tropics, springtail energy use (community metabolism) remains similar across the latitudinal gradient, owing to the changes in temperature with latitude. Neither springtail density nor community metabolism is predicted by local species richness, which is high in the tropics, but comparably high in some temperate forests and even tundra. Changes in springtail activity may emerge from latitudinal gradients in temperature, predation and resource limitation in soil communities. Contrasting relationships of biomass, diversity and activity of springtail communities with temperature suggest that climate warming will alter fundamental soil biodiversity metrics in different directions, potentially restructuring terrestrial food webs and affecting soil functioning.

PURPOSE To evaluate corneal sensitivity and corneal nerve morphology among patients with Wolfram syndrome (WFS). DESIGN An observational clinical case series with confirmatory experiments. METHODS We included a group of 12 patients with biallelic mutations in the WFS1 gene and a control group composed of 30 individuals with type 1 diabetes (T1D). All participants (n = 42) underwent a complete ophthalmic examination, esthesiometry, and retinal nerve fiber layer assessment using optical coherence tomography. Morphologic assessment of corneal neuropathy by in vivo corneal confocal microscopy was conducted in 11 patients with WFS (both eyes) and 1 WFS patient (1 eye) as well as in 24 patients with T1D (both eyes in 6 patients and 1 eye in 18 patients). Additionally, corneas from Wfs1KO mice and their wild-type littermates were subjected to laser scanning confocal microscopy. RESULTS Corneal sensitivity was significantly reduced in patients with WFS compared with patients with T1D (4.50 cm [interquartile range, 3.50–5.50 cm] vs 6.00 cm [interquartile range, 6.00–6.00 cm]; P < 10–5). Additionally, corneal nerve fiber and branch density as well as nerve fiber length were low among patients with WFS. Corneal sensitivity correlated with macular average thickness (R = 0.6928; P = .039) and best-corrected visual acuity (R = –0.61; P = .002) in the WFS group. Similarly, Wfs1 knockout mice also presented corneal neurodegeneration changes when corneal nerve fiber density and length were measured using laser scanning confocal microscopy. CONCLUSIONS Decreased corneal sensitivity and corneal nerve degeneration are observed in WFS. Corneal sensitivity is linked with the degree of disease progression as measured by visual acuity and retinal thinning.

Wolfram syndrome is a rare autosomal recessive disorder caused by mutations in the wolframin ER transmembrane glycoprotein (WFS1) gene and characterized by diabetes mellitus, diabetes insipidus, optic atrophy and deafness. In experimental models the homozygous Wfs1 mutant mice have a full penetrance and clearly expressed phenotype, whereas heterozygous mutants have a less-pronounced phenotype between the wild-type and homozygous mutant mice. Heterozygous WFS1 mutations have been shown to be significant risk factors for diabetes and metabolic disorders in humans. In the present study we analyzed the response of heterozygous Wfs1 mice to high fat diet (HFD) by exploring potential outcomes and molecular changes induced by this challenge. The HFD treatment increased the body weight (BW) similarly both in Wfs1 wild-type (WT) and heterozygous (HZ) mice, and therefore HFD also prevented the impaired BW gain found in Wfs1 mutant mice. In Wfs1HZ mutant mice, HFD impaired the normalized insulin secretion and the expression of ER stress genes in isolated pancreatic islets. These results suggest that Wfs1HZ mice have a decreased insulin response and pronounced cellular stress response due to a higher sensitivity to HFD as hypothesized. In Wfs1HZ mice, HFD increased the expression of Ire1α and Chop in pancreas and decreased that of Ire1α and Atf4 in liver. The present study shows that HFD can disturb insulin function with an increased ER stress in Wfs1HZ mice and only one functional Wfs1 gene copy is not sufficient to compensate this challenge. In conclusion, our study indicates that quantitative Wfs1 gene deficiency is sufficient to predispose the carriers of single functional Wfs1 copy to diabetes and metabolic syndrome and makes them susceptible to the environmental challenges such as HFD.

Background: Wolfram syndrome (WFS, OMIM: #222300) is an ultrarare autosomal recessive disorder characterized by diabetes insipidus, diabetes mellitus, optic nerve atrophy and deafness. It has been reported that the average retinal thickness in WFS patients decreases with the progression of the disease. Aim: To investigate retinal thickness and wolframin expression disorders in Wolfram syndrome 1 gene knockout (Wfs1KO) mice compared to their wild-type (WT) littermates. Materials and methods: Both bulbs with optic nerves of three mice Wfs1WT and three Wfs1KO were taken for the histopathological examination. A strain of knockout mice with mutation in exon 8 was used. Results: No expression of wolframin protein in the retina and neurodegeneration of the optic nerve of Wfs1KO mice as compared among Wfs1WT mice was observed. The mean central retinal thickness was thinner and the retinal thickness/longitudinal diameter ratio was significantly lower in hte Wfs1KO as compared to the Wfs1WT mice. In four (67%) eyeballs of Wfs1KO mice, intra-retinal neovessels were observed. Conclusions: Wfs1KO mice retina with mutation in exon 8 present similar clinical features as patients with WFS in the form of reduced retinal thickness and neurodegeneration of the optic nerve. The presence of proliferative retinopathy observed in Wfs1KO mice requires further investigation.

Purpose To evaluate corneal morphology among patients with Wolfram syndrome (WFS). Design Comparative observational longitudinal case series of WFS patients with a laboratory approach in the WFS1 gene knockout (Wfs1KO) mouse model. Methods A group of 12 patients with biallelic mutations in the WFS1 gene recruited from the whole country and a control group composed of 30 individuals with type 1 diabetes (T1D) were evaluated in a national reference center for monogenic diabetes. All subjects (n = 42) underwent a complete ophthalmic examination, computer videokeratography, and corneal thickness and endothelial measurements. Additionally, WFS patients (n = 9) underwent longitudinal videokeratography and Pentacam evaluation. Corneal characteristics were assessed and compared between both groups. Human and mouse corneas were subjected to immunohistochemistry to detect wolframin expression and microscopic evaluation to study corneal morphology ex vivo. Results Clinical and topographic abnormalities similar to keratoconus were observed in 14 eyes (58.3%) of 8 WFS patients (66.7%). Flat keratometry, inferior-superior dioptric asymmetry, skewed radial axis, logarithm of keratoconus percentage index, index of surface variance, index of vertical asymmetry, keratoconus index, central keratoconus index, index of height asymmetry, and index of height decentration differed between WFS and T1D patients. Immunohistochemistry demonstrated wolframin expression in human and mouse corneas. Compared with Wfs1WT mice, Wfs1KO mice also presented corneal abnormalities. Conclusions Patients with WFS present a high prevalence of changes in corneal morphology compatible with the diagnosis of early stages of keratoconus. Observations in a mouse model suggest that a mutation in the WFS1 gene may be responsible for corneal abnormalities similar to keratoconus.

The data presented in this article are related to the research article entitled "Increased Mitochondrial Protein Levels and Bioenergetics in the musculus rectus femoris of Wfs1-Deficient mice" (Eimre et al., accepted for publication). This dataset reports the analysis of Wfs1-deficient mouse heart, musculus soleus, and white part of musculus rectus femoris by liquid chromatography/tandem mass spectrometry. Label-free quantitative analysis of the mass spectrometry data identified 4056 proteins, with 114, 212, and 1290 proteins differentially expressed (t-test; p < 0.05) in the heart, m. soleus, and m. rectus femoris, respectively, between the Wfs1-deficient and wild-type groups. Eight proteins were found to be differentially expressed in all mentioned muscles, with 1 protein differently expressed in oxidative (m. soleus and heart) and 88 in skeletal muscles. This dataset supports the cited study and can be used to extend additional analyses. Data are available via ProteomeXchange with identifier PXD011019.

Wolfram syndrome is caused by mutations in the WFS1 gene. WFS1 protein dysfunction results in a range of neuroendocrine syndromes and is mostly characterized by juvenile-onset diabetes mellitus and optic atrophy. WFS1 has been shown to participate in membrane trafficking, protein processing and Ca2+ homeostasis in the endoplasmic reticulum. Aim of the present study was to find the transcriptomic changes influenced by WFS1 in the hypothalamus and hippocampus using RNA-sequencing. The WFS1-deficient mice were used as a model system to analyze the changes in transcriptional networks. The number of differentially expressed genes between hypothalami of WFS1-deficient (Wfs1KO) and wild-type (WT) mice was 43 and between hippocampi 311 with False Discovery Rate (FDR) <0.05. Avpr1a and Avpr1b were significantly upregulated in the hypothalamus and hippocampus of Wfs1KO mice respectively. Trpm8 was the most upregulated gene in the hippocampus of Wfs1KO mice. The functional analysis revealed significant enrichment of networks and pathways associated with protein synthesis, cell-to-cell signaling and interaction, molecular transport, metabolic disease and nervous system development and function. In conclusion, the transcriptomic profiles of WFS1-deficient hypothalamus and hippocampus do indicate the activation of degenerative molecular pathways causing the clinical occurrences typical to Wolfram syndrome.

Wfs1 deficiency leads to a progressive loss of plasma insulin concentration, which should reduce the consumption of glucose in insulin-dependent tissues, causing a variety of changes in intracellular energy metabolism. Our objective here was to assess the changes in the amount and function of mitochondrial proteins in different muscles of Wfs1-deficient mice. Mitochondrial functions were assayed by high-resolution oxygraphy of permeabilized muscle fibers; the protein amount was evaluated by liquid chromatography tandem mass spectrometry (LC/MS/MS) analysis and mRNA levels of the uncoupler proteins UCP2 and UCP3 by real-time PCR; and citrate synthase (CS) activity was determined spectrophotometrically in muscle homogenates. Compared to controls, there were no changes in proton leak and citrate synthase activity in the heart and m. soleus tissues of Wfs1-deficient mice, but significantly higher levels of both of these factors were observed in the m. rectus femoris; mitochondrial proteins and mRNA of UCP2 were also higher in the m. rectus femoris. ADP-stimulated state 3 respiration was lower in the m. soleus, remained unchanged in the heart, and was higher in the m. rectus femoris. The mitochondrial protein amount and activity are higher in Wfs1-deficient mice, as are mitochondrial proton leak and oxygen consumption in m. rectus femoris. These changes in muscle metabolism may be important for identifying the mechanisms responsible for Wolfram syndrome and diabetes.

Somatic cell nuclear transfer (SCNT) is, to date, the most used technology producing transgenic (TG) cattle. Depending on the gene construct and transfection method, transfection efficiency may differ greatly. Applying a more intense selection regime after transfection may obliterate the cells. An extended selection affects the passage number and leads to genotypic and phenotypic drift of the cells. We used the pBC1 Milk Expression Vector Kit (cat. no. K270-01, Invitrogen Corp., Carlsbad, CA, USA) to make the expression vector of human FSH (hFSH). For TG fibroblast cell line, the AmaxaTM NucleofectorTM Kit for Primary Fibroblasts (cat. no. VPI-1002, Lonza Grouop, Basel, Switzerland) was used. For TG fibroblast selection, G418 (neomycin) was used for 21 days with a final concentration of 400 µg mL−1. The final passage number of the cell line was 6. The primers included in the pBC1 Milk Expression Vector Kit-BCF (GATTGACAAGTAATACGCTGTTTCCTC) and BCR (CATCAGAAGTTAAACAGCACAGTTAG)-were used to control the insert. The transgenesis of the cell line was confirmed by sequencing the PCR product and analysing it with the BlastN and Bioedit software to make sure the fibroblast cell line was hFSH-positive. These cells were thereafter randomly used for SCNT as donor cells. All the SCNT embryos were cultured for 4 days in IVF Bioscience (Falmouth, United Kingdom) culture media and then biopsied. After aspirating 1 blastomere from the 6- to 8-cell-stage embryo, the biopsied embryos were further individually cultured until Day 7 and blastocyst formation was recorded. Genomic DNA from the biopsies was isolated and amplified with REPLI-g Single Cell Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The primers BCF and BCR were used to control the hFSH positivity of the embryos, and the PCR product was visualised on a 1% agarose gel. From 62 biopsied SCNT cloned embryos, 22 (35.48%) tested TG positive. The total blastocyst yield from biopsied embryos was 26 (41.

Introduction Mice models of Wfs1 deficiency allow to study the mechanisms of human Wolfram syndrome. Our aim was to assess the changes in mitochondrial proteins and function in muscles of wfs1‐deficient mice. Materials and methods Samples of heart, m. soleus and m. rectus femoris of wfs1‐deficient and wild‐type mice. LFQ intensity of proteins was evaluated by nano‐LC‐MS/MS analysis of muscle homogenates, mRNA levels of uncoupler proteins, UCP2 and UCP3, by real‐time PCR method, and citrate synthase activity was determined spectrophotometrically. Mitochondrial function was assayed by high‐resolution oxygraphy of permeabilized muscle fibres. Results Compared with controls, there was no change in proton leak and citrate synthase activity in the wfs1‐deficient heart and m. soleus, but in m. rectus femoris 16.1‐fold (P<0.002) and 1.46‐fold (P<0.05) increases were found respectively. However, oxidative phosphorylation did not change in any muscle group. UCP2 mRNA level was in wfs1‐deficient m. rectus femoris 2.6 times (P<0.05) higher than in wild‐type muscle. UCP3 expression was one order of magnitude lesser than UCP2 and did not differ in muscle groups. The amounts of mitochondrial pyruvate dehydrogenase E1 component subunit alpha and mitochondrial succinate dehydrogenase iron sulphur subunit were in m. rectus femoris, compared with the wild type, respectively, 1.69 (P<0.005) and 2.08 times (P<0.0002) larger. Conclusion Wfs1‐deficient mice are characterized by a larger amount and activity of mitochondrial proteins in m. rectus femoris; the proton leak in this muscle was increased probably due to a larger amount of UCP2.

Poster session

Poster abstract

Ucp1 expression in brown adipose tissue (BAT) is induced by cold temperatures and is fully consistent with temperature adaptation and thermogenesis. Transcription of the Ucp1 gene is increased within minutes of cold exposure. Beige adipocytes are mainly in the subcutaneous white adipose tissues (WAT) and they arise postnatally in response to chronic cold exposure. This process is often referred as the browning of WAT. The aim of this study was to compare the cold induced metabolic and Ucp1 expression differences between WFS1-deficient mice and their wild-type littermates. Experiments were performed with 2–3 months old male and female F2 hybrids (129S6/SvEvTac × 129S6/SvEvTac). Five to twelve WFS1-deficient mice and wild-type mice were used in the study. Mice were kept at 8–12°C up to 7 days and metabolic effect was measured with calorimetric cages (TSE Phenomaster). Ucp1 expression was measured in BAT and WAT with qPCR (Applied Biosystems). The results of measurements showed that WFS1-deficient mice have significantly higher energy metabolism and higher Ucp1 expression in BAT and WAT after cold exposure. In conclusion, our results show that WFS1-deficient mice have a stronger response to cold exposure and upregulation of Ucp1 in BAT and WAT. Thus suggesting that WFS1-deficient mice have changes in regulation of thermogenesis that should be studied further.

Introduction To study the mechanisms of Wolfram syndrome, we assessed the changes in activities, amounts and functional coupling between mitochondria and enzymes involved in the transport of energy in muscles of wfs1‐deficient mice, models of this syndrome. Materials and methods Samples of heart, m. soleus and m. rectus femoris of wfs1‐deficient and wild‐type mice. Real‐time PCR method, spectrophotometry and nano‐LC‐MS/MS analysis of homogenates. Coupling between mitochondria and enzymes was assayed by oxygraphy of permeabilized muscle fibres. Results Compared with wild type, in m. rectus femoris of wfs1‐deficient mice mRNA level of muscle‐type creatine kinase isoform was two times (P<0.05) lower, total activities of creatine and adenylate kinase decreased by 34% (P<0.01) and 48% (P<0.02) respectively. In wfs1‐deficient mice functional coupling of adenylate kinase and mitochondria in heart decreased by 39% (P<0.05), but in m. soleus and m. rectus femoris did not change. Coupling of mitochondria and creatine kinase did not alter in any muscle of wfs1‐deficient mice. The amounts of mitochondrial sarcomeric creatine kinase in wfs1‐deficient m. rectus femoris increased 3.16‐fold (P<0.001) and mitochondrial adenylate kinase 2 2.09‐fold (P<0.01), cytoplasmatic adenylate kinase 1 but 2.12‐fold (P<0.01) decreased compared with wild‐type muscle. Conclusion In hearts of wfs1‐deficient mice, functional coupling of adenylate kinase and mitochondria decreased. Despite the drop in total activities of creatine and adenylate kinase in m. rectus femoris, the functional coupling of mitochondria did not change, because the amounts of mitochondrial isoforms of these enzymes even increased.

Land application of sewage sludge compost is an important and efficient tool in the remediation of industrial landscapes and agricultural soils in Estonia. A number of studies have shown that, as a rule, pharmaceuticals and personal care products (PPCPs) are neither completely removed by sewage treatment, nor completely degraded in the environment. In this study, degradation rates of diclofenac sodium (DFC) and triclosan (TCS) were determined during sewage sludge composting. Anaerobically digested and dewatered sewage sludge was mixed with sawdust at two different ratios (1:2 and 1:3 sludge/sawdust, v:v). Then aerobic composting was carried out. These ratios were chosen on the basis of previous studies on sewage sludge composting with different bulking agents. The initial concentration of DFC and TCS was 2 mg kg-1 in relation to dry weight (dw). Low quantities of the studied pharmaceuticals were present in sewage sludge that was used for preparing the compost mixtures used in our experiments. The background concentrations of DFC and TCS were never equal to zero. The results showed that the difference between sewage sludge and bulking agent ratios (1:2 vs 1:3) in compost samples did not significantly affect temperature profiles during the experiment. The degradation of pharmaceuticals was more complete in the compost samples where the ratio of bulking agent was higher (1:3 by volume). The average degradation level (in all compost mixtures) was 95% for DFC and 68% for TCS. Pharmaceuticals entering into the soil may affect microbial activity, plant growth and development, and may have adverse effects on living organisms., Funding Agency:Environmental Investment Centre of Estonia

Wolfram syndrome, an autosomal recessive disorder characterized by juvenile‐onset diabetes mellitus and optic atrophy, is caused by mutations in the WFS1 gene. WFS1 encodes an endoplasmic reticulum resident transmembrane protein. The Wfs1‐null mice exhibit progressive insulin deficiency and diabetes. The aim of this study was to describe the insulin secretion and transcriptome of pancreatic islets in WFS1‐deficient mice. WFS1‐deficient (Wfs1KO) mice had considerably less pancreatic islets than heterozygous (Wfs1HZ) or wild‐type (WT) mice. Wfs1KO pancreatic islets secreted less insulin after incubation in 2 and 10 mmol/L glucose and with tolbutamide solution compared to WT and Wfs1HZ islets, but not after stimulation with 20 mmol/L glucose. Differences in proinsulin amount were not statistically significant although there was a trend that Wfs1KO had an increased level of proinsulin. After incubation in 2 mmol/L glucose solution the proinsulin/insulin ratio in Wfs1KO was significantly higher than that of WT and Wfs1HZ. RNA‐seq from pancreatic islets found melastatin‐related transient receptor potential subfamily member 5 protein gene (Trpm5) to be downregulated in WFS1‐deficient mice. Functional annotation of RNA sequencing results showed that WFS1 deficiency influenced significantly the pathways related to tissue morphology, endocrine system development and function, molecular transport network.

In this study, we investigated the physiological regulation of energy metabolism in wild‐type (WT) and WFS1‐deficient (Wfs1KO) mice by measuring the effects of menthol treatment on the O2 consumption, CO2 production, rectal body temperature, and heat production. The basal metabolism and behavior was different between these genotypes as well as TRP family gene expressions. Wfs1KO mice had a shorter life span and weighed less than WT mice. The food and water intake of Wfs1KO mice was lower as well as the body temperature when compared to their WT littermates. Furthermore, Wfs1KO mice had higher basal O2 consumption, and CO2 and heat production than WT mice. In addition, Wfs1KO mice showed a higher response to menthol administration in comparison to WT mice. The strongest menthol effect was seen on different physiological measures 12 h after oral administration. The highest metabolic response of Wfs1KO mice was seen at the menthol dose of 10 mg/kg. Menthol increased O2 consumption, and CO2 and heat production in Wfs1KO mice when compared to their WT littermates. In addition, the expression of Trpm8 gene was increased. In conclusion, our results show that the Wfs1KO mice develop a metabolic phenotype characterized with several physiological dysfunctions.

Previous experiments of RNA sequencing showed that Trpm8 gene was upregulated in the hippocampus of WFS1-deficient mice compared to wild-type littermates. TRPM8 is activated by cold (8–28°C) and chemicals, e.g. menthol, which induce cold sensation. TRP ion channels are used as primary transducers of thermal stimuli for thermosensation. The aim of this study was to compare the metabolic differences and dose-response effects to menthol between WFS1-deficient mice and their wild-type littermates. Experiments were performed with 9–12 months old male F2 hybrids (129S6/SvEvTac x 129S6/SvEvTac). Five to twelve WFS1-deficient mice and wild-type mice were used in the study. Different menthol doses were administrated by oral gavage and metabolic effect was measured with metabolic cages (TSE Phenomaster). The life span of WFS1-deficient and wild-type mice was investigated. The results of measurements showed that WFS1-deficient mice have significantly higher energy metabolism and shorter life span compared to WT mice and specific menthol doses had a significantly higher reaction on the energy metabolism of WFS1-deficient mice compared to WT mice. In conclusion, our results show that the shorter life span, metabolic changes and upregulation of Trpm8 gene in WFS1-deficient mice suggest that WFS1-deficient mice have serious metabolic dysfunctions. Menthol has an opposite effect on the WFS1-deficient mice metabolic parameters by increasing them compared to wild-type mice.

Tuuma siirdamise teel kloonimise efektiivsus on väga madal, sageli on elussündide osakaal alla 1%(Watanabe, 2013). Embrüonaalses arengus on väga oluline etapp doonorraku tuuma ümberprogrammeerimine, mis ei pruugi kloonimise puhul toimuda täies ulatuses. Puuduliku ümberprogrammeerimise tulemusena peetub kloonembrüote kasv erinevates arenguetappides ning lõpeb sageli loote surmaga (Chitwood jt, 2013; Graf jt, 2014). Suurem osa probleemidest avaldub varastes arenguetappides. Kuid ka hilisemas arengus võib avalduda kõrvalekaldeid normaalsest arengust–sageli esineb kloontiinuste puhul platsentoomide suurenemist ja nende arvu vähenemist, suurenenud läbimõõduga nabanööri ja ka vasikad ise on keskmisest suuremad. Sellist nähtust nimetatakse suure järglase sündroomiks (Chitwood jt, 2013; Graf jt, 2014).

Aim: To assess changes of mitochondrial function and activities of enzymes involved in the transport of energy in different muscles of wfs1 deficient mice. Methods: Mitochondrial function was assayed by high resolution oxygraphy of permeabilized muscle fibers. Respiration related to oxidative phosphorylation was calculated by subtracting initial basal respiration in the presence of pyruvate and malate from respiration with ADP. Proton leak related respiration was found by subtracting residual oxygen consumption with rotenone from basal respiration. The difference between the respiration rates in the presence of ADP+pyruvate+malate and rotenone was considered to represent the activity of Compex I in the electron transfer chain, and the difference between ADP+succinate and rotenone represented the activity of Complex II. Activities of enzymes were measured by spectroscopy of muscle homogenates. Results: Compared to controls, there was no change of proton leak and hexokinase activity in the wfs1 deficient heart and m. soleus, but in m. rectus femoris 16.1-fold (p<0.002) and 1.7-fold (p<0.01) increases were found respectively. However, oxidative phosphorylation was not changed in any muscle group. The Complex I / Complex II ratio was decreased in heart by 15% (p<0.03) and in musculus rectus femoris by 21% (p<0.01). Activities of creatine and adenylate kinase were decreased in m. rectus femoris by 34% (p<0.01) and 48% (p<0.02) respectively. Conclusions: In heart and m. rectus femoris of wfs1 deficient mice the ratio of Complex I and Complex II activities was decreased. In m. rectus femoris of wfs1 deficient mice proton leak and hexokinase activity were increased, but activity of other energy tranfer enzymes was decreased.

Wolfram syndrome, an autosomal recessive disorder characterized by juvenile-onset diabetes mellitus and optic atrophy, is caused by mutations in the wolframin (Wfs1) gene. Wfs1 negatively regulates endoplasmic reticulum (ER) stress signalling and therefore have a role in the pathogenesis of diabetes and regulation of metabolism. One cardinal feature of Wfs1 mutant mice is their significantly reduced body weight. The real mechanism of weight loss is not known, but these mice develop normally until the age of 8 weeks. After this period weight loss starts. We recently found significant up-regulation of TRPM8 gene in the hippocampus of Wfs1 mutant mice. TRPM8 is menthol receptor and is involved in the regulation of energy metabolism. In present study we analysed metabolic activity and sensitivity of Wfs1 mutant mice to the menthol stimulation. We found that Wfs1 mutant mice have elevated metabolic activity in metabolic cages. Moreover, menthol induced significant increase in basal metabolic activity in Wfs1 mutant mice. Over-activation of TRPM8 receptor can explain increased metabolic rate in Wfs1 mutant mice and their reduced body weight.

There is no data about the energy metabolism of patients with Wolfram syndrome caused by mutations in the wolframin (Wfs1) gene. The aim of this study was to investigate the role of Wfs1 in energy metabolism and thyroid function in Wfs1 deficient mice (Wfs1KO). 16 male (8 Wfs1KO, 8 wild type (wt)) and 16 female (8 Wfs1KO, 8wt) mice aged 11–13 weeks were studied alone in a specific metabolic cage for 48 h. Body weight, food, water and O2 consumption, motor activity, CO2 and heat production of mice were recorded. At the age of 14–20 weeks, plasma levels of thyroxine (T4), TSH and leptin were measured and histology of thyroid tissues examined. Mean CO2 and heat production was not different between the groups. Mean O2 consumption was higher in the Wfs1KO females compared to the Wfs1KO males (3 410.0±127.0 vs. 2 806.0±82.4 ml/kg/h; p<0.05), but not compared to the wt mice. The mean movement activity was not different between the groups except that the Wfs1KO females reared up more often than the wt females (199.8±63.46 vs. 39.26±24.71 cnts/48 h; p<0.05). Both male and female Wfs1KO mice had significantly lower body mass and food intake than wt mice. Male Wfs1KO mice also lost more weight in metabolic cage than wt males (20.43±0.41 vs. 16.07±0.86%; p<0.05) indicating more pronounced response to isolation. Male Wfs1KO mice had significantly lower levels of plasma leptin than wt male mice (3.37±0.40 vs. 5.82±0.71 ng/ml; p<0.01). Thyroid function measured by serum TSH and T4 levels was not different between Wfs1KO and wt groups, but both Wfs1KO and wt male mice had significantly higher mean T4 levels than female mice. The histology of thyroid tissue of Wfs1KO males showed a trend to a smaller mean number of epithelial cells per follicle than the wt male mice. Although Wfs1KO mice were smaller and lost more weight during the experiment, their energy metabolism was not different from wt mice except that the female Wfs1KO mice consumed more O2. As mice in this study were relati

The gene WFS1 encodes a protein with unknown function although its functional deficiency causes different neuropsychiatric and neuroendocrine syndromes. In the present study, we aimed to find the functional networks influenced by the time-dependent silencing of WFS1 in HEK cells. We performed whole genome gene expression profiling (Human Gene 1.0 ST Arrays) in HEK cells 24, 48, 72, and 96 h after transfection with three different WFS1 siRNAs. To verify silencing we performed quantitative RT-PCR and Western blot analysis. Analysis was conducted in two ways. First we analyzed the overall effect of the siRNA treatment on the gene expression profile. As a next step we performed time-course analysis separately for different siRNAs and combined for all siRNAs. Quantitative RT-PCR and Western blot analysis confirmed clear silencing of the expression of WFS1 after 48 h. Significant (FDR value <10%) changes in the expression of 11 genes was identified with most of these genes being related to the mitochondrial dysfunction and apoptosis. Time-course analysis confirmed significant correlations between WFS1 silencing and changes in the expression profiles of several genes. The pathways that were influenced significantly by WFS1 silencing were related to mitochondrial damage and neurodegenerative diseases. Our findings suggest a role of WFS1 gene in cell survival and its involvement in degenerative diseases. wolfram syndrome (ws, mim222300) is an autosomal recessive disorder most frequently characterized by diabetes insipidus, diabetes mellitus, optic atrophy, and deafness (DIDMOAD), first described by Wolfram and Wagener as a juvenile diabetes mellitus with optic atrophy (40, 46). Only insulin-dependent diabetes mellitus and progressive optic atrophy are necessary to confirm WS, and both of these syndromes may be present in childhood or adolescence (3). WS can be characterized as polyendocrinopathy with significant pituitary deficiency and atrophy (13, 31). In addition to these

Wolfram syndrome, an autosomal recessive disorder characterized by juvenile-onset diabetes mellitus and optic atrophy, is caused by mutations in the wolframin (WFS1) gene. WFS1 negatively regulates endoplasmic reticulum (ER) stress signalling and therefore have a role in the pathogenesis of diabetes. Valproic acid (VPA), a widely used anticonvulsant and mood-stabilizing drug, normalized the glucose intolerance in Wfs1 mutant mice, but had no effect on the course of glucose tolerance in wild-type (WT) mice. The aim of this study was to investigate insulin secretion in isolated pancreatic islets of WFS1-deficient (Wfs1KO) mice and also evaluate insulin secretion in the presence of VPA. In addition, the content of proinsulin in the isolated islets was measured. In general Wfs1KO pancreatic islets secreted less insulin compared to WT and Wfs1HZ islets. Differences in proinsulin amount were not statistically significant although there was a trend that Wfs1KO had an increased level of proinsulin. We found significantly reduced insulin secretion in Wfs1 mutants and no effect of VPA treatment. This study was supported by the Frontiers of Functional Genomics and by The European Regional Development Fund.

Poster abstracts: PS 022 Stressed out islets: ER stress