Search

The precise molecular events initiating human lung disease are often poorly characterized. Investigating prenatal events that may underlie lung disease in later life is challenging in man, but insights from the well-characterized sheep model of lung development are valuable. Here, we determine the transcriptomic signature of lung development in wild-type sheep (WT) and use a sheep model of cystic fibrosis (CF) to characterize disease associated changes in gene expression through the pseudoglandular, canalicular, saccular, and alveolar stages of lung growth and differentiation. Using gene ontology process enrichment analysis of differentially expressed genes at each developmental time point, we define changes in biological processes (BP) in proximal and distal lung from WT or CF animals. We also compare divergent BP in WT and CF animals at each time point. Next, we establish the developmental profile of key genes encoding components of ion transport and innate immunity that are pivotal in CF lung disease and validate transcriptomic data by RT-qPCR. Consistent with the known pro-inflammatory phenotype of the CF lung after birth, we observe upregulation of inflammatory response processes in the CF sheep distal lung during the saccular stage of prenatal development. These data suggest early commencement of therapeutic regimens may be beneficial.

Abstract Somatic Cell Nuclear Transfer (SCNT) technique was used to produce the first viable cloned cattle offspring in Russia. Whole-genome SNP genotyping confirmed that the cloned calf was identical to the fibroblast cell line that was used for SCNT. CRISPR/Cas9 approach was subsequently used to knock out genes for beta-lactoglobulin gene (PAEP) and the beta-lactoglobulin-like protein gene (LOC100848610) in the fibroblast cells. Gene editing (GE) efficiency was 4.4% for each of these genes. We successfully obtained single-cell-derived fibroblast colonies containing PAEP and LOC100848610 knockouts, which will be used to produce beta-lactoglobulin-deficient cattle.

Spermatogonial stem cell transplantation (SSCT) is an experimental technique for transfer of germline between donor and recipient males that could be used as a tool for biomedical research, preservation of endangered species, and dissemination of desirable genetics in food animal populations. To fully realize these potentials, recipient males must be devoid of endogenous germline but possess normal testicular architecture and somatic cell function capable of supporting allogeneic donor stem cell engraftment and regeneration of spermatogenesis. Here we show that male mice, pigs, goats, and cattle harboring knockout alleles of the NANOS2 gene generated by CRISPR-Cas9 editing have testes that are germline ablated but otherwise structurally normal. In adult pigs and goats, SSCT with allogeneic donor stem cells led to sustained donor-derived spermatogenesis. With prepubertal mice, allogeneic SSCT resulted in attainment of natural fertility. Collectively, these advancements represent a major step toward realizing the enormous potential of surrogate sires as a tool for dissemination and regeneration of germplasm in all mammalian species.

Genetic engineering (GE) of livestock initially has been accomplished primarily using pronuclear microinjection into zygotes (1985 – 1996). The applications of technology were limited due to low integration efficiency, aberrant transgene expression resulting from random integration and presence of genetic mosaicism in transgenic founder animals. Despite enormous efforts to established embryonic stem cells (ESCs) for domestic species, the ESC GE technology does not exist for livestock. Development of Somatic Cell Nuclear Transfer (SCNT) has bypassed the need in livestock ESCs and revolutionized the field of livestock transgenesis by offering the first cell-based platform for precise genetic manipulation in farm animals. For nearly two decades since the birth of Dolly (1996 – 2013), SCNT was the only method used for generation of knockout and knockin livestock. Arrival of CRISPRS/Cas9 system, a new generation of gene editing technology, gave us an ability to introduce precise genome modifications easily and efficiently. This technological advancement accelerated production of GE livestock by SCNT and reinstated zygote micromanipulation as an important GE approach. The primary advantage of the SCNT technology is the ability to confirm in vitro that the desired genetic modification is present in the somatic cells prior to animal production. The edited cells could also be tested for potential off-target mutations. Additionally, this method eliminates the risk of genetic mosaicism frequently observed following zygote micromanipulation. Despite its low efficiency, SCNT is a well-established procedure in numerous laboratories around the world and will continue to play an important role in the GE livestock field.

Genetic engineering (GE) of livestock initially has been accomplished primarily using pronuclear microinjection into zygotes (1985-1996). The applications of the technology were limited due to low integration efficiency, aberrant transgene expression resulting from random integration and the presence of genetic mosaicism in transgenic founder animals. Despite enormous efforts to established embryonic stem cells (ESCs) for domestic species, the ESC GE technology does not exist for livestock. Development of somatic cell nuclear transfer (SCNT) has bypassed the need in livestock ESCs and revolutionized the field of livestock transgenesis by offering the first cell-based platform for precise genetic manipulation in farm animals. For nearly two decades since the birth of Dolly (1996-2013), SCNT was the only method used for the generation of knockout and knockin livestock. Arrival of CRISPRS/Cas9 system, a new generation of gene-editing technology, gave us an ability to introduce precise genome modifications easily and efficiently. This technological advancement accelerated production of GE livestock by SCNT and reinstated zygote micromanipulation as an important GE approach. The primary advantage of the SCNT technology is the ability to confirm in vitro that the desired genetic modification is present in the somatic cells prior to animal production. The edited cells could also be tested for potential off-target mutations. Additionally, this method eliminates the risk of genetic mosaicism frequently observed following zygote micromanipulation. Despite its low efficiency, SCNT is a well-established procedure in numerous laboratories around the world and will continue to play an important role in the GE livestock field.

Production of embryos with high developmental competence by somatic cell nuclear transfer (scNT) is far less efficient than for in vitro fertilized (IVF) embryos, likely due to an accumulation of errors in genome reprogramming that results in aberrant expression of RNA transcripts, including messenger RNAs (mRNA) and, possibly, microRNAs (miRNA). Thus, our objectives were to use RNAseq to determine the dynamics of mRNA expression in early developing scNT and IVF embryos in the context of the maternal-to-embryonic transition (MET) and to correlate apparent transcriptional dysregulation in cloned embryos with miRNA expression profiles. Comparisons between scNT and IVF embryos indicated large scale transcriptome differences, which were most evident at the 8-cell and morula stages for genes associated with biological functions critical for the MET. For two miRNAs previously identified as differentially expressed in scNT morulae, miR-34a and miR-345, negative correlations with some predicted mRNA targets were apparent, though not widespread among the majority of predicted targets. Moreover, although large-scale aberrations in expression of mRNAs were evident during the MET in cattle scNT embryos, these changes were not consistently correlated with aberrations in miRNA expression at the same developmental stage, suggesting that other mechanisms controlling gene expression may be involved.

The efficiency of somatic cell nuclear transfer (scNT) for production of viable offspring is relatively low as compared to in vitro fertilization (IVF), presumably due to deficiencies in epigenetic reprogramming of the donor cell genome. Such defects may also involve the population of small non-coding RNAs (sncRNAs), which are important during early embryonic development. The objective of this study was to examine dynamic changes in relative abundance of sncRNAs during the maternal-to-embryonic transition (MET) in bovine embryos produced by scNT as compared to IVF by using RNA sequencing. When comparing populations of miRNA in scNT versus IVF embryos, only miR-2340, miR-345, and miR34a were differentially expressed in morulae, though many more miRNAs were differentially expressed when comparing across developmental stages. Also of interest, distinct populations of piwi-interacting like RNAs (pilRNAs) were identified in bovine embryos prior to and during embryonic genome activation (EGA) as compared bovine embryos post-EGA and differentiated cells. Overall, sncRNA sequencing analysis of preimplantation embryos revealed largely similar profiles of sncRNAs for IVF and scNT embryos at the 2-cell, 8-cell, morula, and blastocyst stages of development. However, these sncRNA profiles, including miRNA, piRNA, and tRNA fragments, were notably distinct prior to and after completion of the MET. Summary sentence Small non-coding RNA sequencing analysis revealed largely similar sncRNA for IVF and scNT embryos at the 2-cell, 8-cell, morula and blastocyst stages of development. Graphical Abstract

Cystic fibrosis (CF) is a human genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. Correction of CFTR mutations at embryo stage could be a permanent solution to cure this disease. To assess the efficiency of CFTR/G542X mutation correction in vitro by CRISPR/Cas9, we utilized embryos generated by ovine-bovine interspecies somatic cell nuclear transfer (iSCNT) due to a limited access to sheep oocytes. First, we evaluated the developmental capacity of reconstructed iSCNT embryos. These embryos were able to develop to 16-cell stage, allowing for individual embryo genotyping. Then, we optimized the concentrations of Cas9:gRNA ribonucleoprotein (RNP) for 1-cell stage embryo injection. Genotyping results showed that we achieved high efficiencies (88.9–100%) of indel mutations at the target locus after injection of different concentrations of RNP. When an RNP (0.09 µg/µl:2.3 µM) was co-injected with a ssODN (18 µM), the G542X mutation was corrected via the homology-directed repair in 11.1% (1/9) of iSCNT embryos. Taken together, we developed an effective strategy to correct the CFTR/G542X mutation in ovine-bovine iSCNT embryos by CRISRP/Cas9. Our strategy overcomes the limitation of oocyte source and provides the opportunity of mimicking the editing of any other genes in one-cell embryos of different species.

Accelerated development of novel CRISPR/Cas9-based genome editing techniques provides a feasible approach to introduce a variety of precise modifications in the mammalian genome, including introduction of multiple edits simultaneously, efficient insertion of long DNA sequences into specific targeted loci as well as performing nucleotide transitions and transversions. Thus, the CRISPR/Cas9 tool has become the method of choice for introducing genome alterations in livestock species. The list of new CRISPR/Cas9-based genome editing tools is constantly expanding. Here, we discuss the methods developed to improve efficiency and specificity of gene editing tools as well as approaches that can be employed for gene regulation, base editing, and epigenetic modifications. Additionally, advantages and disadvantages of two primary methods used for the production of gene-edited farm animals: somatic cell nuclear transfer (SCNT or cloning) and zygote manipulations will be discussed. Furthermore, we will review agricultural and biomedical applications of gene editing technology.

Significance Transfer of sperm-producing stem cells isolated from a donor male into testes of a recipient male has important applications for preserving germplasm and as a conduit for widespread dissemination of desirable genetics in livestock production. A key aspect is surrogate males that lack endogenous germline but are otherwise physiologically normal. Here we demonstrate that male mice, pigs, and goats rendered genetically sterile by CRISPR-Cas9 editing of the NANOS2 gene support donor-derived spermatogenesis following allogeneic stem cell transplantation. In addition, we show that CRISPR-Cas9 editing of the NANOS2 gene in cattle leads to male germline ablation. These findings represent a major advance toward surrogate sires becoming a tool for disseminating and regenerating germplasm in all mammals., Spermatogonial stem cell transplantation (SSCT) is an experimental technique for transfer of germline between donor and recipient males that could be used as a tool for biomedical research, preservation of endangered species, and dissemination of desirable genetics in food animal populations. To fully realize these potentials, recipient males must be devoid of endogenous germline but possess normal testicular architecture and somatic cell function capable of supporting allogeneic donor stem cell engraftment and regeneration of spermatogenesis. Here we show that male mice, pigs, goats, and cattle harboring knockout alleles of the NANOS2 gene generated by CRISPR-Cas9 editing have testes that are germline ablated but otherwise structurally normal. In adult pigs and goats, SSCT with allogeneic donor stem cells led to sustained donor-derived spermatogenesis. With prepubertal mice, allogeneic SSCT resulted in attainment of natural fertility. Collectively, these advancements represent a major step toward realizing the enormous potential of surrogate sires as a tool for dissemination and regeneration of germplasm in all mammalian species.

Unlike oocytes of many other mammalian species, parthenogenetically activated hamster oocytes have not been reported to develop beyond the two-cell stage. This study investigated the in vitro development into blastocysts of parthenogenetic embryos of Golden Syrian hamsters. We observed that hamster oocytes could easily be artificially activated (AA) by treatment with ionomycin plus 6-dimethylaminopurine + cycloheximide + cytochalasin B as assessed by embryo cleavage in HECM-9 (63.15%) or HECM-10 (63.82%). None of the cleaved embryos developed beyond the two-cell stage when cultured in either of the two media. However, some of the embryos overcame the two-cell block and developed to the blastocyst stage (26.45%) when they were first cultured in HECM-10 for 24 hours and then in HECM-9 (serial culture media HECM-10-9) for 72 hours. Blastocyst development was further significantly (66.2%) improved when embryos were cultured in HECM-10 supplemented with ethylenediaminetetraacetic acid for 24 hours, then in HECM-9 supplemented with glucose for 72 hours (serial culture media HECM-11a-b). Hamster oocytes activated with ionomycin, ethanol, or a combination of the two treatments would develop to the blastocyst stage in serial culture media HECM-11a-b, whereas none of the spontaneously activated oocytes cleaved (0% vs. 86.93%, p

Pluripotent stem cells (PSCs) have been successfully developed in many species. However, the establishment of bovine-induced pluripotent stem cells (biPSCs) has been challenging. Here we report the generation of biPSCs from bovine mesenchymal stem cells (bMSCs) by overexpression of lysine-specific demethylase 4A (KDM4A) and the other reprogramming factors OCT4, SOX2, KLF4, cMYC, LIN28, and NANOG (KdOSKMLN). These biPSCs exhibited silenced transgene expression at passage 10, and had prolonged self-renewal capacity for over 70 passages. The biPSCs have flat, primed-like PSC colony morphology in combined media of knockout serum replacement (KSR) and mTeSR, but switched to dome-shaped, naïve-like PSC colony morphology in mTeSR medium and 2i/LIF with single cell colonization capacity. These cells have comparable proliferation rate to the reported primed- or naïve-state human PSCs, with three-germ layer differentiation capacity and normal karyotype. Transcriptome analysis revealed a high similarity of biPSCs to reported bovine embryonic stem cells (ESCs) and embryos. The naïve-like biPSCs can be incorporated into mouse embryos, with the extended capacity of integration into extra-embryonic tissues. Finally, at least 24.5% cloning efficiency could be obtained in nuclear transfer (NT) experiment using late passage biPSCs as nuclear donors. Our report represents a significant advance in the establishment of bovine PSCs.

This study was designed to compare the behavior of abattoir-derived goat oocytes submitted to different in vitro maturation (IVM) treatments. Cumulus-oocyte complexes collected from abattoir ovaries were subjected to IVM in three maturation media, which consisted of TCM199 supplemented either with: (1) 10 ng/ml EGF and 100 μM cysteamine (Defined medium); (2) 10% FCS, 5 μg/ml FSH, 10 μg/ml LH, 1 μg/ml estradiol (FCS medium); or (3) combined components of both Defined and FCS media (Combined medium). After 22 h of IVM, oocyte maturation rate was significantly higher in Combined medium compared to FCS medium (52.0 ± 2.0% vs. 37.7 ± 3.2%, P P > 0.05) was observed in maturation rates between Defined (43.4 ± 4.7%) and FCS or Combined medium. There was no significant difference ( P > 0.05) in the rates of cleavage, blastocyst, or blastocyst cell number among different maturation conditions. The intracellular glutathione (GSH) level was observed to be significantly higher ( P P

Reduced developmental competence after IVF has been reported using oocyte derived from small follicles in several species including cattle, sheep, and goats. No information is currently available about the effect of follicle size of the cytoplast donor on in vivo development after somatic cell nuclear transfer (SCNT) in goats. Oocytes collected from large (≥3 mm) and small follicles (

Background: There is increasing evidence that endurance exercise is associated with increased risk of atrial fibrillation (AF). However, it is unknown if the relationship between endurance exercise and AF is dependent on an atrial myopathy. Methods: Six cardiac-specific TGF (transforming growth factor)-β1 transgenic and 6 wild-type (WT) goats were utilized for these studies. Pacemakers were implanted in all animals for continuous arrhythmia monitoring and AF inducibility. AF inducibility was evaluated using 5 separate 10 s bursts of atrial pacing (160–200 ms). Three months of progressive endurance exercise (up to 90 minutes at 4.5 mph) was performed. Quantitative assessment of circulating microRNAs and inflammatory biomarkers was performed. Results: Sustained AF (≥30 s) was induced with 10 s of atrial pacing in 4 out of 6 transgenic goats compared with 0 out of 6 WT controls at baseline ( P P Conclusions: This study demonstrates a novel transgenic goat model of cardiac fibrosis (TGF-β1 overexpression) to demonstrate that endurance exercise in the setting of an underlying atrial myopathy increases the incidence of spontaneous AF. Furthermore, endurance exercise seems to increase inducible AF secondary to altered expression of key profibrotic biomarkers that is independent of the presence of an atrial myopathy.

Clinical approaches for quantification of atrial fibrosis are currently based on digital image processing of magnetic resonance images. Here, we introduce and evaluate a comprehensive framework based on convolutional neural networks for quantifying atrial fibrosis from images acquired with catheterized fiber-optics confocal microscopy (FCM). FCM images in three regions of the atria were acquired in the beating heart in situ in an established transgenic animal model of atrial fibrosis. Fibrosis in the imaged regions was histologically assessed in excised tissue. FCM images and their corresponding histologically-assessed fibrosis levels were used for training of a convolutional neural network. We evaluated the utility and performance of the convolutional neural networks by varying parameters including image dimension and training batch size. In general, we observed that the root-mean square error (RMSE) of the predicted fibrosis was decreased with increasing image dimension. We achieved a RMSE of 2.6% and a Pearson correlation coefficient of 0.953 when applying a network trained on images with a dimension of 400 × 400 pixels and a batch size of 128 to our test image set. The findings indicate feasibility of our approach for fibrosis quantification from images acquired with catheterized FCM using convolutional neural networks. We suggest that the developed framework will facilitate translation of catheterized FCM into a clinical approach that complements current approaches for quantification of atrial fibrosis.

Microchimerism is defined as the presence of a small population of cells or DNA in 1 organism originated from a genetically different organism. It is well established that this phenomenon occurs in humans and mice as cells are exchanged between mother and fetus during gestation. Currently, no information is available about the presence of maternal microchimerism in goats, and the only published study is limited to an evaluation of fetal and fetal–fetal microchimerism in blood samples following natural breeding. In order to determine whether bidirectional fetal–maternal cell or DNA trafficking occurs in goats, we assessed: 1) fetal microchimerism in surrogates that gave birth to somatic cell nuclear transfer (SCNT)-derived transgenic offspring (n = 4), 2) maternal microchimerism following natural breeding of SCNT-derived transgenic does with a nontransgenic buck (n = 4), and 3) fetal–fetal microchimerism in nontransgenic twins of transgenic offspring (n = 3). Neomycin-resistance gene (NEO) gene was selected as the marker to detect the presence of the αMHC-TGF-β1-Neo transgene in kidney, liver, lung, lymph node, and spleen. We found no detectable maternal or fetal–fetal microchimerism in the investigated tissues of nontransgenic offspring. However, fetal microchimerism was detected in lymph node tissue of one of the surrogate dams carrying a SCNT pregnancy. These results indicate occurrence of cell trafficking from fetus to mother during SCNT pregnancies. The findings of this study have direct implications on the use and disposal of nontransgenic surrogates and nontransgenic offspring.

To address the unmet needs for human polyclonal antibodies both as therapeutics and diagnostic reagents, building upon our previously established transchromosomic (Tc) cattle platform, we report herein the development of a Tc goat system expressing human polyclonal antibodies in their sera. In the Tc goat system, a human artificial chromosome (HAC) comprising the entire human immunoglobulin (Ig) gene repertoire in the germline configuration was introduced into the genetic makeup of the domestic goat. We achieved this by transferring the HAC into goat fetal fibroblast cells followed by somatic cell nuclear transfer for Tc goat production. Gene and protein expression analyses in the peripheral blood mononuclear cells (PBMC) and the sera, respectively, of Tc caprine demonstrated the successful expression of human Ig genes and antibodies. Furthermore, immunization of Tc caprine with inactivated influenza A (H7N9) viruses followed by H7N9 Hemagglutinin 1 (HA1) boosting elicited human antibodies with high neutralizing activities against H7N9 viruses in vitro. As a small ungulate, Tc caprine offers the advantages of low cost and quick establishment of herds, therefore complementing the Tc cattle platform in responses to a range of medical needs and diagnostic applications where small volumes of human antibody products are needed.

Cystic fibrosis (CF) is a human genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. We have recently generated 3 CF sheep models: a CFTR−/− model (Fan et al. 2018 LCI Insight 3:e123529; https://doi.org/10.1172/jci.insight.123529) and 2 additional models where we introduced human G542X and F508del mutations into the sheep genome (unpublished). Correction of CFTR mutations in zygotes with gene-editing techniques could be a permanent solution to cure this disease. To assess the efficiency of mutation correction invitro by CRISPR/Cas9, we utilised embryos generated by ovine-bovine interspecies SCNT (iSCNT) due to limited access to sheep oocytes. First, we evaluated the developmental capacity of reconstructed iSCNT embryos, in which nucleus donors were derived from ovine fibroblasts and recipient cytoplasm from enucleated bovine oocytes. These iSCNT embryos were able to develop to 16- to 32-cell stage (3/30, 10.0%), which allowed the genotyping of each embryo using PCR-restriction fragment length polymorphism assays and Sanger sequencing. Then, specific single-guide RNAs (sgRNAs) and 101-bp single-stranded oligodeoxynucleotides (ssODNs) were designed and synthesised to correct the G542X mutation in the sheep CFTR gene. We optimized the concentrations of Cas9:sgRNA ribonucleoproteins (RNPs) for 1-cell stage embryonic injection. Mutation analysis of embryos was conducted at 3 days post injection. Genotyping results showed that we achieved high efficiencies (95.7–100%) of mutations (indels) at targeting loci after injection of different concentrations of Cas9:sgRNA RNPs (0.02 µg:0.6 pmol/µL to 1.4 µg:40 pmol/µL). Furthermore, when an RNP (1.4 µg:40 pmol/µL) was co-injected with a ssODN (80 pmol/µL), both targeting the G542X mutation, the mutation was successfully corrected in the genome of iSCNT embryos generated using G542X fibroblasts as nucleus donors at an efficiency of 5.7% (3/53) via homology-directed repair mechanism. During the invitro culture of iSCNT embryos, we did not observe significant difference (P>0.05, unpaired t-test) in cleavage rates between embryos with or without injection (85.5% vs. 89.0%). Off-target analysis of those mutated and G542X-corrected embryos is in progress. Our strategy overcomes the limitation of oocyte source and provides an opportunity to mimic the editing of any other gene in embryos of different species.

Sickle cell disease (SCD) is the most common inherited hemoglobinopathy, with more than 2 million people in the United States alone carrying the sickle gene. Approximately 100 000 of these people are homozygous and suffer from SCD. Worldwide, there are ∼4.4 million people with SCD. SCD is caused by a single A to T nucleotide replacement at the sixth codon of the β-globin gene, which results in the substitution of a valine for glutamate in the β-globin protein. This causes the resultant tetrameric haemoglobin molecule to be unstable and the red cells carrying this aberrant protein to “sickle,” decreasing the ability of these cells to carry oxygen. Sheep and humans exhibit a high degree of homology at the level of the genome. In addition, their anatomy, organ physiology, and immune system development closely parallel that of humans during fetal life. The ovine β-globin (HBB) gene shares 87.5% similarity with human HBB. Therefore, we hypothesised that the introduction of the “sickle” mutation in the sheep genome would lead to the SCD phenotype in sheep that could provide a valuable platform for evaluating prenatal and postnatal drug and gene therapies for this disease. In this study, we used a CRISPR/Cas9 gene-editing approach to introduce the SCD mutation into the sheep β-globin/HBB gene. We designed a single guide (sg)RNA targeting exon 1 of the sheep β-globin/HBB gene using the Benchling software (https://benchling.com/academic). The sgRNA was synthesised by Synthego and Cas9 purchased from IDT. Using the Lonza-4D-Nucleofector system, the Cas9/sgRNA ribonucleoprotein complex was transfected into sheep fetal fibroblasts (SFFs) along with 101-bp single-stranded oligodeoxynucleotides, flanking the sickle cell mutation to enable homology-directed repair. The transfected SFFs were then cultured in Dulbecco’s modified Eagle medium, supplemented with 15% fetal bovine serum and 1% penicillin, and incubated at 38.5°C. After 2 days, DNA was extracted from one-third of the SFFs and the remainder were seeded individually into five 96-well plates by limited dilution. After 7 days of culture, individual colonies were expanded into 24-well plates and cultured for an additional 3 days. PCR-restriction fragment length polymorphism (RFLP) analysis using Image J software demonstrated a high rate of mutations (∼70%) by either indels or SCD mutation that led to the loss of the restriction enzyme site, which was further supported by the analysis of cell colonies. We isolated 59 single cell-derived SFF colonies and, based on PCR/RLFP assay, 31/59 (52%) of them contained biallelic mutations (either indels or point mutations) and were subsequently submitted for Sanger sequencing. The sequencing demonstrated that 3 colonies (9.6%) contained biallelic SCD mutations in the β-globin/HBB gene. These data demonstrate that we successfully introduced the SCD mutation into SFFs. These cells will be used in the production of the first large animal (sheep) SCD model by somatic cell nuclear transfer in fall of 2020. This research was supported by UAES project 1343 and by USDA/NIFA multistate research project W-4171.

Invitro maturation is an important process in the invitro production of embryos. It has been shown recently that 3 cytokines: fibroblast growth factor 2 (FGF2), leukemia inhibitory factor (LIF), and insulin-like growth factor 1 (IGF1), increase the efficiency of IVM, blastocyst production, and invivo development following somatic cell nuclear transfer (SCNT) in pigs (Yuan et al. 2017 PNAS 114, E5796-E5804). This study was designed to assess the effect of these cytokines on IVM in bovine oocytes, their consecutive development to blastocyst, and pregnancy rate when used in SCNT. Cumulus–oocyte complexes (COCs) were retrieved from abattoir-derived ovaries, matured for 21h in either standard maturation medium [TCM-199 (Gibco/Life Technologies), 10% fetal bovine serum, 0.5µgmL−1 FSH, 5µgmL−1 LH, 100UmL−1 penicillin/streptomycin] or maturation medium supplemented with 20ngmL−1 human LIF, 20ngmL−1 IGF1, and 40ngmL−1 FGF2. After IVM, the first polar body and metaphase plate were removed from MII oocytes. Fibroblast cells were injected in the perivitelline space and fused with enucleated oocytes in 0.28M sorbitol fusion medium (0.1mM calcium, 0.5mM magnesium, 0.5mM HEPES, 1gmL−1 bovine serum albumin) by a single pulse of 1.75 kV/cm for 22ms. Reconstructed embryos were activated by exposure to 5μM ionomycin for 5min, followed by 4h of incubation in 2mM 6-(dimethylamino)purine and 10μgmL−1 cycloheximide. Cleavage and blastocyst rates were assessed at Day 2 and Day 7, respectively. Blastocysts were transferred to oestrus synchronized recipients and initial pregnancy rates assessed at Day 40 after embryo transfer. Statistical analysis was performed using one-way ANOVA or chi-squared test. Data are presented as mean±s.e.m. The MII rate was significantly higher in maturation medium supplemented with cytokines compared with control medium (80.2±2.33%, n=885 vs. 66.8±1.82%, n=822; P0.05, 8 replicates, one-way ANOVA), respectively. However, a significant increase in blastocyst rate was observed in the treatment group compared with the control group (40.6±5.1%, n=446 vs. 24.3±2.9%, n=300; P

Cystic fibrosis (CF) is a human genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. Among the ∼2000 known CF mutations, the F508del mutation is found in 84% and G542X in 4.6% of the CF patients in the United States. The F508del mutation occurs in exon 11 and is characterised by deletion of the “CTT” nucleotides, resulting in deletion on the phenylalanine residue at the position 508 of CFTR. This causes misfolding of the CFTR protein, which is further degraded by proteases. The G542X mutation is a nonsense mutation found in exon 12 and associated with nonsense-mediated decay of the mutant transcript causing the absence of protein production. Previously, we generated CFTRF508del/F508del and CFTRG542X/G542X lambs (unpublished) using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. We hypothesised that gene editing may be an effective tool to correct these mutations and permanently cure this genetic disease. Thus, in this study, we evaluated the efficiency of CRISPR/Cas9-meditated gene knock-in to correct the F508del and G542X mutations in sheep fibroblasts invitro. We designed single guide (sg)RNAs using the Benchling software (https://benchling.com/academic) and approximately 100bp of single-stranded oligodeoxynucleotides (ssODNs) targeting the mutation sites at exon 11 and 12 to introduce either “CTT” or change the “T” to “G” nucleotide in genome of F508del or G542X CF sheep cells, respectively. Each of Cas9/sgRNA ribonucleoproteins was transfected into sheep fibroblast cells along with ssODNs using the Lonza-4D-NucleofectorTM (Lonza) system for homology-directed repair. The transfected cells were subsequently cultured in Dulbecco’s modified Eagle medium, supplemented with 15% fetal bovine serum and 1% penicillin, and incubated at 38.5°C. DNA was extracted 48h post-transfection to validate mutation efficiency. PCR products of the exons 11 and 12 were ligated into T-vector, and bacterial colonies were selected based on blue/white screening. In total, we isolated 32 single cell bacterial colonies for each mutant. Sequencing results indicate that “CTT” was introduced in 4/26 (15.3%) plasmid colonies, and “T to G” replaced in 13/31 (41.9%) colonies. Therefore, our results indicate that the F508del and G542X mutations can be effectively corrected in CF sheep fibroblasts invitro using a CRISPR/Cas9 approach.

Japanese encephalitis virus (JEV) is the main cause of acute viral encephalitis, primarily affecting children and young adults in the Asia-Pacific region. JEV is a vaccine-preventable pathogen, with four types of JE vaccine licensed in different regions of the world. To date, the most common JEV strain used in vaccine development and production is SA14-14-2, an attenuated strain derived from its wild-type parental strain SA14. In this study, we directly compared the phenotypic and genotypic characteristics of SA14 and SA14-14-2 to determine the biological and genetic properties associated with their differential virulence. In susceptible BHK-21 cells, SA14-14-2 grew slightly more slowly and formed smaller plaques than SA14, but unlike SA14, it showed almost no expression of the viral protein NS1', the product of a conserved predicted RNA pseudoknot-mediated ribosomal frameshift. In weanling ICR mice, SA14-14-2 was highly attenuated in terms of both neuroinvasiveness and neurovirulence, with its median lethal doses invariably over five logs higher than those of SA14 when inoculated intramuscularly and intracerebrally. Interestingly, the neurovirulence of SA14-14-2 was dependent on mouse age, with the 1- to 7-day-old mice being highly susceptible and the 14- to 21-day-old mice becoming resistant to intracerebral inoculation. At the genome level, SA14-14-2 differed from SA14 by 57 nucleotides, including one silent G-to-A substitution at position 3599 within the predicted RNA pseudoknot for NS1' synthesis; of the 57 differences, 25 resulted in amino acid substitutions. Our data pave the way for the development of new genetically modified JE vaccines.

INTRODUCTION Large animal models of progressive atrial fibrosis would provide an attractive platform to study relationship between structural and electrical remodeling in atrial fibrillation (AF). Here we established a new transgenic goat model of AF with cardiac specific overexpression of TGF-β1 and investigated the changes in the cardiac structure and function leading to AF. METHODS AND RESULTS Transgenic goats with cardiac specific overexpression of constitutively active TGF-β1 were generated by somatic cell nuclear transfer. We examined myocardial tissue, ECGs, echocardiographic data, and AF susceptibility in transgenic and wild-type control goats. Transgenic goats exhibited significant increase in fibrosis and myocyte diameters in the atria compared to controls, but not in the ventricles. P-wave duration was significantly greater in transgenic animals starting at 12 months of age, but no significant chamber enlargement was detected, suggesting conduction slowing in the atria. Furthermore, this transgenic goat model exhibited a significant increase in AF vulnerability. Six of 8 transgenic goats (75%) were susceptible to AF induction and exhibited sustained AF (>2 minutes), whereas none of 6 controls displayed sustained AF (P < 0.01). Length of induced AF episodes was also significantly greater in the transgenic group compared to controls (687 ± 212.02 seconds vs. 2.50 ± 0.88 seconds, P < 0.0001), but no persistent or permanent AF was observed. CONCLUSION A novel transgenic goat model with a substrate for AF was generated. In this model, cardiac overexpression of TGF-β1 led to an increase in fibrosis and myocyte size in the atria, and to progressive P-wave prolongation. We suggest that these factors underlie increased AF susceptibility.

Cloning by somatic cell nuclear transfer (SCNT) is characterized by low efficiency and the occurrence of developmental abnormalities, which are rather poorly studied phenomena in goats. This study aimed at comparing overall SCNT efficiency in goats by using in vitro-matured (IVM) or in vivo-matured oocytes and fibroblast donor cells (mock transfected, transgenic, or wild type), also characterizing symptoms of the Abnormal Offspring Syndrome (AOS) in development, comparing results with pregnancies produced by artificial insemination (AI) and in vivo-derived (IVD) embryos. The SCNT group had lower pregnancy rate (18.3%, 11/60), total number of concepti (20.0%, 12/60), term births (3.3%, 2/60), and live births (1.7%, 1/60) than both the IVD (77.8%, 7/9; 155.5%, 14/9; 122.2%, 11/9; 88.8%, 8/9) and the AI (71.4%, 10/14; 121.4%, 17/14; 100%, 14/14; 78.5%, 11/14) groups, respectively (p 0.05). No SCNT pregnancies reached term using IVM oocytes, but in vivo-matured oocytes resulted in two term transgenic cloned kids. The proportion fetal membrane (FM) weight/birth weight reflected an increase in FM size and cotyledonary enlargement in clones, for disproportionally bigger newborns in relation to cotyledonary numbers. Overall, goat cloning showed losses and abnormality patterns similar to the AOS in cloned cattle and sheep, which have not been previously well recognized in goats.

The NANOS2 gene, encoding an RNA binding protein, is known to play a critical role in the development of germline for all organisms studied to date. The male mice with biallelic NANOS2 knockouts (KOs) are sterile due to apoptosis of prospermatogonia shortly after birth but with morphologically intact seminiferous tubules. Thus, the choice of NANOS2 for targeting could be a viable strategy to develop germline ablated males that would serve as recipients for exogenous spermatogonial stem cell transplantation. The goat is a potential model of human physiology and an agriculturally important species. Here, we report successful generation of NANOS2 KO goats using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. We first designed 4 single-guide RNAs (sgRNAs) specific for the single exon of goat NANOS2 (GenBank: NC_030825.1). The targeting vectors were constructed by using the pX330 plasmid (Addgene: 42230) and transfected into sheep fetal fibroblasts. Mutation efficiency analysis showed that 3 of them (out of 4, 75.0%) were efficient in directing Cas9 to generate targeted cleavages, with mutation efficiencies of 10-30%. We established single cell-derived fetal fibroblast colonies by limiting dilution of the cells transfected with one of targeting vectors (sgRNA: GCTGGAGACCCAAGGGACTG). Colony screening with PCR/restriction fragment length polymorphism (RFLP) assays confirmed that we achieved biallelic mutations in the targeting site in 6 of 89 (6.7%) male and 6 of 172 (3.5%) female colonies. Sanger sequencing analysis of genomic DNA isolated from cell colonies with biallelic mutations showed that typical nucleotide deletions and insertions (indels), caused by repairing double-strand DNA breaks during the error-prone non-homologous end joining (NHEJ) process, were generated at the targeting site of NANOS2. Three male and two female colonies with NANOS2 null mutations were identified and used as cell donors for SCNT. In total, 202 cloned 1-cell stage embryos (130 male or 72 female) were generated and surgically transferred into 12 synchronized recipients. Six of them (6 of 12, 50.0%) were confirmed pregnant by ultrasonography on Day 40-45 of gestation. Four pregnancies developed to term, resulting in six offspring (five males and one female). Sequence analysis and PCR/RFLP assays showed that both male and female offspring carried the mutations in NANOS2, which were identical to the donor colonies from which they originated. Our results indicated that CRISPR/Cas9 combined with SCNT is an efficient system for generating NANOS2 KO goats. The phenotypic analysis to assess the effects of NANOS2 KO on the development of germline in male cloned goats is in progress.

Cystic fibrosis (CF) is an autosomal recessive genetic disease that affects over 30 000 people in the United States and is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The CFTR protein is a cAMP-regulated C− channel responsible for regulation of anion transport, primarily in the epithelial cells. We have previously generated a sheep model of CF by genetically inactivating the CFTR gene (Fan et al. 2018 JCI Insight 3, e123529). The newborn CFTR −/− sheep develops severe disease consistent with CF pathology in humans. The CF model is extremely valuable for understanding the developmental aspects of CF disease, as sheep have been used extensively in the study of human fetal growth and development. Sheep, like humans, typically give birth to only one or two offspring in each pregnancy, which make them more suitable than many other species for testing prenatal gene-editing treatments. Thus, in this new study, we are working on the generation of F508del sheep CF model. The F508del mutation was chosen because it is the most common mutation in the human CFTR gene (~70%). This mutation is characterised by the deletion of the CTT nucleotides, which ultimately deletes the phenylalanine residue at position 508. The F508del mutation causes misfolding of the CFTR protein, which is further degraded by proteases. Even though several CFTR modulators are available, they are not effective in all patients. Additionally, they cannot reverse deleterious prenatal CF manifestations. Hence, this model will be valuable for evaluating both prenatal drug and gene therapies. Here, we used a CRISPR/Cas9 gene-editing approach to introduce the F508del mutation into the sheep genome. We designed an sgRNA targeting exon 11 of the sheep CFTR gene using the Benchling software (https://benchling.com/academic). The sgRNA was synthesised by Synthego and Cas9 purchased from ThermoFisher. Using the Lonza-4D-Nucleofector system, Cas9/sgRNA ribonucleoprotein complex was transfected into sheep fetal fibroblasts (SFFs), along with 100bp single-stranded oligodeoxynucleotide, flanking the F508del mutation, for the homology-directed repair. The transfected cells were subsequently cultured in Dulbecco's modified Eagle's medium, supplemented with 15% fetal bovine serum and 1% penicillin, and incubated at 38.5°C. Two days post-transfection, SFFs were seeded individually into five 96-well plates by limited dilution. After seven days, the individual colonies were expanded into 24-well plates and cultured for three more days. A total of 56 single-cell-derived SFF colonies were isolated. The presence of F508del mutation was confirmed by amplifying the PCR products of the exon 11 flanking the mutation site and subjecting each amplicon to Sanger sequencing. The sequencing results indicated that the indels (insertion/deletion) were introduced in 49 out of 56 (87.5%) of the colonies, and four (7.14%) of them were confirmed to have biallelic F508del mutations based on sequencing peaks. Therefore, we successfully introduced the F508del mutation in SFFs that will be used for the production of F508del CF sheep by somatic cell nuclear transfer.

While knowledge of early embryo development and viability has continually increased, there is still a need for noninvasive methods to identify embryos with the highest chances of development to term when transferred. The most widely used technique, morphological assessment, is highly subjective and limited by personnel experience. Spent media from invitro culture could be used as a valuable noninvasive marker for embryo quality assessment. Raman spectroscopy has proven to be a powerful tool for identifying the molecular characteristics of spent culture media by measuring vibration of chemical bonds, allowing for metabolomic profiling of varying stages and quality of embryos. It is well documented that embryos produced through somatic cell nuclear transfer (SCNT) result in lower pregnancy rates and higher incidences of pregnancy loss when compared with embryos produced through IVF (Heyman et al. 2002 Biol. Reprod. 66, 1-13). This study was designed to examine differences in spent media between bovine embryos produced by IVF and SCNT. The SCNT embryos with a metabolomic profile more similar to IVF embryos may have a higher developmental competence. Bovine cumulus-oocyte complexes (COCs) were retrieved from abattoir-derived ovaries and matured for 21h in maturation medium. After IVM, COCs were either used for IVF or SCNT and cultured in 50μL droplets of synthetic oviductal fluid medium + fetal bovine serum in groups of 45 from Day 0-5. On Day 5, embryos that had reached morula stage were placed in individual droplets of 13μL of synthetic oviductal fluid + bovine serum albumin until Day 7. All embryos were cultured at 38.5°C and 5% CO2. On Day 7 embryos were assessed for developmental stage and quality and 10μL of medium from individual culture drops was collected for Raman spectroscopy. Samples were loaded on an MgF2 optical window, dried, and analysed using a 785nm near-infrared laser in the spectral range of 600 to 1800cm−1. Raw Raman data were first pre-processed by baseline correction (asymmetric least-squares smoothing) and normalization. Principal component analysis and partial least squares were then applied to reduce data dimensions. The score of the most significant principal components from principal component analysis and the optimum number of scores from partial least squares were used for linear discriminant analysis. Spent media samples from 4 SCNT embryos, 3 IVF embryos, and 3 empty media samples were analysed, with 50 spectra obtained from each sample. Preliminary data showed grouping of medium containing embryos developed to blastocyst from medium containing embryos arrested at morula or empty medium. We also saw grouping of medium containing SCNT embryos from medium containing IVF embryos within both the morula and blastocyst stage from empty medium. This shows evidence of metabolomic differences between embryos of different developmental potential and embryos produced by IVF and SCNT. Further investigation of the Raman profile of these groups can display specific differences in chemical components and help to identify candidate genes causing differing metabolism of these groups.

The efficiency of assisted reproductive technologies is critically dependent on the quality of the oocytes used to produce the embryos. The aim of the present research was to study dose-dependent effects of three cytokines: fibroblast growth factor 2 (FGF2), leukemia inhibitory factor (LIF), and insulin-like growth factor 1 (IGF1) individually on IVM in bovine oocytes and their consecutive development to blastocysts after artificial activation. Slaughterhouse-derived cumulus-oocyte complexes (COC) (n = 2052 COC) were cultured for 22 h in either standard maturation medium [TCM-199 supplemented with 10% fetal calf serum (FCS), 0.2 mM sodium pyruvate, 10 μg mL−1porcine FSH, and 10 μg mL−1 ovine LH; control] or maturation medium supplemented with different concentrations (5-160 ng mL−1) of FGF2, LIF, and IGF1. After IVM, matured oocytes were activated by culturing in 5 μM ionomycin solution for 5 min followed by 4 h in 2 mM 4-dimethylaminopyridine (DMAP) and 10 mg mL−1 cyclohexamide. Activated oocytes were cultured in CR1aa medium until Day 5 and then transferred to the same medium supplemented with 5% FCS and cultured until Day 7. All cultures were performed at 38.5°C and 5% CO2 in humidified air. At Days 2 and 7 after activation, cleavage and blastocyst rates were determined. In addition, obtained blastocysts were fixed with 4% paraformaldehyde, and the total cell number was determined by 4′,6-diamidino-2-phenylindole (DAPI) staining. The data from 4 to 6 replicates (77-140 oocytes per treatment) were analysed by ANOVA. After 22 h of culture, the rate of MII oocytes, assessed by the presence of the first polar body, did not differ between the groups and ranged from 74.4 to 90.7%. No statistical differences were found in the cleavage rate between oocytes matured in cytokine-treated groups compared with the control. Cleavage rates for the LIF experimental groups was 63.5 to 77.2%, for the IGF1 experimental groups was 68.1 to 80.7%, and for the FGF experimental groups 63.7 to 77.0%. Optimal concentrations of LIF (5 and 20 ng mL−1), and FGF2 (20 and 40 ng mL−1) increased (P

The combination of CRISPR/Cas9 and SCNT techniques greatly facilitates the production of gene-edited livestock. Here, we describe the detailed procedure to create gene knockout goats using this strategy starting from the construction of CRISPR/Cas9 targeting vectors to the transfer of cloned embryos into recipient females. In this procedure, the transfection conditions for goat fibroblasts were optimized due to their high sensitivity to electrotransfection, which enabled the isolation of single-cell colonies carrying simultaneous disruption of multiple genes for SCNT with a single co-transfection of pooled CRISPR/Cas9 targeting vectors.

The combination of CRISPR/Cas9 and SCNT techniques greatly facilitates the production of gene-edited livestock. Here, we describe the detailed procedure to create gene knockout goats using this strategy starting from the construction of CRISPR/Cas9 targeting vectors to the transfer of cloned embryos into recipient females. In this procedure, the transfection conditions for goat fibroblasts were optimized due to their high sensitivity to electrotransfection, which enabled the isolation of single-cell colonies carrying simultaneous disruption of multiple genes for SCNT with a single co-transfection of pooled CRISPR/Cas9 targeting vectors.

Serial cloning by somatic cell nuclear transfer (SCNT) is a critical tool for the expansion of precious transgenic lines or resetting the lifespan of primary transgenic cells for multiple genetic modifications. We successfully produced second-generation cloned goats using donor neonatal fibroblasts from first-generation clones. However, our attempts to produce any third-generation clones failed. SCNT efficiency decreased progressively with the clonal generations. The rate of pregnancy loss was significantly greater in recloning groups (P

Cystic fibrosis (CF) is a human autosomal genetic disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is responsible for Cl − anion transport in epithelial cells. We previously generated CFTR +/− and CFTR −/− lambs using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. The CFTR −/− lambs display many features similar to humans with CF, including meconium ileus (MI), pancreatic fibrosis, portal fibrosis and biliary hyperplasia, small gallbladder, and absence of the vas deferens. Although MI affects only 15 to 20% of human babies with CF, it was observed in 100% of newborn CFTR −/− lambs and was the primary cause of death. We here hypothesized that the transgenic expression of ovine CFTR cDNA under regulation of the rat intestinal fatty acid binding protein (iFABP) promoter would promote the correction of MI in CFTR −/− sheep. In this study, we constructed the pcDNA3.1>iFABP>CFTR expression vector in order to generate iFABP>CFTR transgenic CFTR −/− sheep. PCR and sequence analysis of all junction regions confirmed the presence of the inserts in the vector. We transfected male and female CFTR −/− sheep fetal fibroblasts with the construct. Three days after transfection, limiting dilution and G418 selection were used for the isolation of resistant single cell derived colonies. A total of 15 male colonies containing the pcDNA3.1>iFABP>CFTR vector was confirmed by PCR and sequence analysis. Three male cell colonies were used as nuclear donors for SCNT. In total, 129 one-cell-stage cloned embryos were generated and transferred into 11 estrus-synchronized recipients. Four recipients (4/11; 36.3%) were confirmed pregnant at Day 40 to 45 of gestation. One pregnancy went to term and resulted in the birth of a single lamb. The necropsy indicated the same abnormalities, including MI, seen in CFTR −/− lambs. A PCR assay confirmed the presence of the iFABP>CFTR transgene in the genome of the cloned offspring. The lack of MI correction is likely due to the low expression of CFTR in this particular colony. Western blot analysis is in progress. Additional embryo transfers will be performed using different single-cell-derived colonies.

In vitro maturation (IVM) is an important process in the in vitro production of embryos. It has been recently shown that 3 cytokines: fibroblast growth factor 2 (FGF2), leukemia inhibitory factor (LIF), and insulin-like growth factor 1 (IGF1) have increased the efficiency of IVM, blastocyst production, and in vivo development in pig (Yuan et al. 2017 Proc. Natl. Acad. Sci. USA 114, E5796-E5804). In vitro maturation in medium supplemented with cytokines doubled the blastocyst rate and quadrupled the litter size when transferred. It was observed that the addition of cytokines to IVM medium had an effect on the regulation of pMAPK1/3, cumulus cell expansion, and transzonal projections in cumulus-oocyte complexes (COC). This study was designed to assess the effect of these 3 cytokines on IVM in bovine oocytes and their consecutive development to blastocyst. Intracellular glutathione level (GSH), frequently used as an indicator of metaphase II (MII) oocyte quality, was also evaluated. The COC were retrieved from abattoir-derived ovaries and matured for 21h in either our standard maturation medium [TCM-199 (Gibco/Life Technologies, Grand Island, NY, USA), containing 10% fetal bovine serum, 0.5µg mL−1 FSH, 5µg mL−1 LH, and 100U mL−1 penicillin/streptomycin] or maturation medium supplemented with 20ng mL−1 human LIF, 20ng mL−1 human IGF1, and 40ng mL−1 human FGF2. After IVM, COC were placed in fertilization medium and incubated with frozen-thawed sperm for 20h. Cumulus cells were removed from fertilized COC and cultured in SOF culture medium at 38.5°C in 5% CO2/humidified air. Cleavage and blastocyst rates were assessed at 48h and Day 8 post-IVF, respectively. To assess GSH level, MII oocytes were incubated in 20 µM CellTracker Blue CMF2HC (Thermo Fisher Scientific, Waltham, MA, USA) and observed under blue fluorescent light. All statistical analysis was performed using one-way ANOVA and data are presented as mean±s.e.m. The MII rate, assessed by the presence of the first polar body, was significantly higher in the maturation medium supplemented with cytokines compared with the control medium (167/202; 82.4±2.02% v. 136/198; 68.8±1.1%; P0.05, 5 replicates), respectively. However, a significant increase in blastocyst rate was observed in the cytokine-containing medium (64/351; 17.7±2.06%) compared with the control group (42/358; 11.0±1.96%; P

We have previously reported that inactivation of endogenous immunoglobulin (Ig) genes can enhance the production of human polyclonal antibodies (hpAb) in transchromosomic (Tc) cattle containing a human artificial chromosome (HAC) comprising the entire human Ig gene repertoire. Goats offer the advantages of having a shorter gestation period and growing to adult size much faster than larger ungulates. Therefore, based upon our previously established Tc cattle platform, in this study, we aimed to generate immunoglobulin lambda light chain knockout (IGLλ −/− )/HAC Tc goats expressing hpAb using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. First, we designed multiple specific single-guide RNAs (sgRNA) targeting the coding sequences of constant regions of goat IGLλ1, IGLλ2 (both in NC_030824.1), and IGLλ3 (NW_017189530.1) and constructed corresponding gene targeting vectors. Gene targeting efficiency analysis in goat fibroblasts showed that the sgRNA were efficient in directing Cas9 to generate targeted indels in corresponding IGLλ genes with efficiencies ranging between 20 and 30%. We then targeted the IGLλ genes and generated a cloned IGLλ −/− fetus by SCNT (first round of cloning; G1) using single cell-derived IGLλ −/− fibroblast colonies as nuclear donors and established IGLλ −/− fetal fibroblast cell lines. Second, we established IGLλ −/− /HAC fibroblast colonies by transferring the isKcHACΔ, a HAC containing the entire unrearranged human immunoglobulin heavy-chain and kappa-chain sequences, into the IGLλ −/− fetal fibroblast cells via microcell-mediated chromosome transfer (MMCT; Matsushita et al. 2014 PLoS One 9, e90383). The resulting IGLλ −/− /HAC fibroblasts were used as nuclear donors for the production of IGLλ −/− /HAC goats by SCNT (second round of cloning; G2). A total of 311 one-cell stage G2 embryos were generated using 4 IGLλ −/− /HAC fetal fibroblast colonies and surgically transferred into 19 oestrus-synchronized recipients. Seven pregnancies were confirmed (7/19; 36.8%) with ultrasonography at Day 60±3 of gestation, and 1 pregnancy (1/7; 14.3%) developed to term, leading to the birth of a live and healthy kid. Genetic and serological characterisation of this Tc goat produced by the second round of SCNT is in progress.

The hypothesis of this study was that the leukocyte populations and expression levels of genes related to immune response, growth factors and apoptosis would be altered at the fetal-maternal interface in somatic cell nuclear transfer (SCNT)-generated sheep pregnancies. Placental and endometrial samples from sheep pregnancies established by SCNT and natural breeding (control) were collected at 45 days and at term. Expression of genes related to growth factors, apoptosis and immune response was examined using quantitative reverse transcription polymerase chain reaction. Endometrial leukocyte populations and major histocompatibility class I (MHC-I) protein expression were examined by immunohistochemistry. At term we observed altered expression of genes related to apoptosis, growth factors and immune response in placental and endometrial tissue of SCNT pregnancies. In Day-45 pregnancies there was less-pronounced abnormal expression and only genes related to apoptosis and growth factors were abnormal in the placenta. Endometrial gene expression profiles were similar to age-matched controls. Placental MHC-I protein expression was similar in SCNT and controls at 45 days but increased in the SCNT at term. The altered gene expression at the fetal-maternal interface likely contributes to the placental dysfunction and overgrowth observed in sheep SCNT pregnancies.

Here, we report the 10,807-nucleotide-long consensus RNA genome sequences of three spatiotemporally distinct and genetically divergent Zika virus strains, with the functionality of their genomic sequences substantiated by reverse genetics: MR-766 (African lineage, Uganda, 1947), P6-740 (Asian lineage, Malaysia, 1966), and PRVABC-59 (Asian lineage-derived American strain, Puerto Rico, 2015).