Search

Pallido-ponto-nigral degeneration (PPND) is one of the most well characterized familial neurodegenerative disorders linked to chromosome 17q21-22. These hereditary disorders are known collectively as frontotemporal dementia (FTD) and parkinsonism linked to chromosome 17 (FTDP-17). Although the clinical features and associated regional variations in the neuronal loss observed in different FTDP-17 kindreds are diverse, the diagnostic lesions of FTDP-17 brains are tau-rich filaments in the cytoplasm of specific subpopulations of neurons and glial cells. The microtubule associated protein (tau) gene is located on chromosome 17q21-22. For these reasons, we investigated the possibility that PPND and other FTDP-17 syndromes might be caused by mutations in the tau gene. Two missense mutations in exon 10 of the tau gene that segregate with disease, Asn[279.sup.Lys] in the PPND kindred and Pro[301.sup.Leu] in four other FTDP-17 kindreds, were found. A third mutation was found in the intron adjacent to the 3[prime] splice site of exon 10 in patients from another FTDP-17 family. Transcripts that contain exon 10 encode tau isoforms with four microtubule (MT)-binding repeats (4Rtau) as opposed to tau isoforms with three MT-binding repeats (3Rtau). The insoluble tau aggregates isolated from brains of patients with each mutation were analyzed by immunoblotting using tau-specific antibodies. For each of three mutations, abnormal tau with an apparent [M.sub.r] of 64 and 69 was observed. The dephosphorylated material comigrated with tau isoforms containing exon 10 having four MT-binding repeats but not with 3Rtau. Thus, the brains of patients with both the missense mutations and the splice junction mutation contain aggregates of insoluble 4Rtau in filamentous inclusions, which may lead to neurodegeneration.

The distamycin A-sensitive fragile site FRA16B is due to the expansion of perfect-repeat copies of the 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(super c/sub a)TA)sub n, located at the site of repeat-copy number polymorphism in the normal population. This was gleaned from the isolation by positional cloning of FRA16B and comparison with folate-sensitive fragile sites, which found that the FRA16B repeat motif has striking homology with the polymorphic variable number tandem repeat at the COL2A1 collagen gene locus. Findings also indicate that the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats.

Choroideraemia an sex-linked inherited disease that is present only in males, in which the retina of the eye degenerates, leading to blindness. The gene that is defective in choroideraemia has recently been identified. The location of the defective gene had been isolated to a small segment on the X chromosome. Genes in this area of chromosome X were characterized. A gene was identified which was expressed in the various regions of the eye, such as the retina, the choroid, and the pigment epithelium of the retina. The gene was shown to be defective in nine patients with choroideraemia. Eight of the patients had portions of the gene missing or deleted, and one patient had a portion of the gene moved to another site on the chromosome. Identification of this defective gene will help the elucidation of the function of the normal gene. If the mechanisms behind the defect in the disease state can be understood, they can perhaps be corrected. It is hoped that this study provides insight into the elucidation of the defects in other diseases of the retina as well. (Consumer Summary produced by Reliance Medical Information, Inc.)

* The association of Apert syndrome with a translocation (2p-;Cq+) was previously reported in this journal. On reexamination using high-resolution chromosome banding, results showed both the patient and her unaffected father carry the balanced translocation (2;9)(p11.2;q34.2). This finding suggests the rearrangement is unlikely to be the cause of her disorder. Other chromosomal anomalies and genes known to be located at or near these breakpoints and a cytogenetic survey of patients with Apert syndrome are reviewed. (AJDC. 1993;147:1306-1308), Apert syndrome may not be caused by an abnormal chromosome translocation. Apert syndrome is a genetic disorder characterized by a misshapen skull and webbed hands and feet. The case of a patient with Apert syndrome and her chromosomal anomaly is discussed. High resolution chromosome banding was used to analyze blood samples from the patient and her father. A chromosomal rearrangement in the patient, originally thought to cause her Apert syndrome, was also found in the father. Physical examination of the father confirmed that he did not have Apert syndrome. The mother's chromosome set was found to be normal. Many patients with Apert syndrome have no detectable chromosome abnormalities. The genetic mutation responsible for this syndrome is still unknown.

The fragile X chromosome is familial disorder characterized by mental retardation. The abnormality associated with this condition may be visualized directly under the microscope. However, the preparation of chromosomes for viewing is laborious and the microscopic examination of chromosomes requires some expertise. Even with expertise, the misdiagnosis rate for such cytogenetic analysis is about 5 percent. This error rate is significant, since fragile X syndrome is the single most common cause of inherited mental retardation. Researchers have now shown that it is possible to use the techniques of molecular biology to obtain a more reliable diagnosis. The fragile region on the X chromosome, which is located near the end of the long arm, is characterized by a repeated triplet, CCG (the DNA bases cytosine, cytosine, guanine). Apparently, the more this sequence is repeated, the more serious is the resulting fragile X syndrome. A combination of specific DNA probes and gel electrophoresis were used to evaluate this repeated genetic structure in a pregnant woman. The woman had one normal X chromosome, which revealed a repeated sequence about 1,000 bases in length. The other X chromosome had a repeated sequence of 1,200 bases, suggesting that the woman was a carrier of the fragile X syndrome. A sample from the chorionic villi revealed that the fetus was male. DNA analysis of the male fetus revealed a repeated sequence of 2,300 bases, strongly suggesting the presence of the full fragile X gene, which would mean the child would be mentally retarded. Previous research has shown that the fragile X gene in affected males is methylated to varying degrees; that is, the DNA is chemically modified by the presence of methyl groups. DNA analysis performed after the termination of this affected pregnancy confirmed that this was the case for many tissues of the fetus. However, the fragile X gene in the chorionic villi was not methylated, indicating that the methylation of DNA in a biopsy of chorionic villi is not satisfactory for the prenatal diagnosis of fragile X syndrome. The DNA analysis method appears to be appropriate not only for prenatal diagnosis of fragile X syndrome, but also for the identification of unaffected gene carriers as well. (Consumer Summary produced by Reliance Medical Information, Inc.)

Males with fragile X syndrome are mentally retarded, and have long, thin faces with prominent jaws and protuberant ears. These patients tend to have large testes and autistic characteristics. It is now appreciated that the fragile X syndrome is the most common inherited cause of mental retardation. The diagnosis of fragile X syndrome is generally made by chromosome analysis, which is not only laborious, but is also inaccurate about 5 percent of the time. Most often the error is a false negative. In the December 12, 1991 issue of The New England Journal of Medicine, two research groups report the efficacy of using DNA probes to diagnose the presence of the fragile X gene. This may prove to be one of the first genetic disorders in which DNA analysis becomes the primary means of diagnosis. The disease has a particularly unusual mode of inheritance. Unlike most X-linked diseases, in which males with the gene are invariably afflicted, about one-fifth of males carrying the fragile X gene are unaffected. Conversely, about half the women carrying the gene are affected to some degree, and 35 percent are mentally retarded. Another peculiar feature of the inheritance of this disorder is that there seem to be no cases in which the disorder occurs as a spontaneous mutation; all affected individuals are born to mothers carrying the gene. This fact is surprising; since affected males are not likely to reproduce, it was anticipated that new mutations must occur frequently. The apparent lack of new mutations may be due to an unusual sequence of events. The fragile X mutation apparently must be preceded by a 'premutation'. This is a smaller region of fragile DNA than is observed in the full fragile X syndrome. Males with the premutation may or may not be retarded, but males with the full mutation are invariably retarded. Traditional chromosome studies cannot reliably distinguish the extent of the affected DNA, and therefore can not account for the difference between males who are carriers of the gene and males who are actually affected by fragile X syndrome. Further studies will be necessary to determine the actual prevalence of the fragile X mutation in the population. These studies should also determine the frequency with which the smaller premutation increases in size to become the full fragile X mutation. (Consumer Summary produced by Reliance Medical Information, Inc.)

Cystic fibrosis is a disease that affects 1 in 1,600 Caucasians. It is characterized by abnormally thick mucous secretions by glands in the lungs, which can lead to respiratory infection and death. In the disease state, there is defective regulation of chloride ion transport in the cells of the exocrine glands. The disease is inherited and the defect has been isolated to an area on chromosome 7. The gene coding for the defect has recently been cloned. This gene codes for a protein which is involved in the regulation of ion conduction across the membrane. Mutations of the gene are seen in patients with cystic fibrosis. A deletion of three nucleotides of deoxyribose nucleic acid (DNA) at a particular site of the gene has been found in 70 percent of the patients with cystic fibrosis. A common mutation has not been found in the other cases of cystic fibrosis. A defective cystic fibrosis gene has been characterized in a family in which the genes of the parents do not contain this common deletion. The mother's genes contain two extra nucleotides which are inserted into the cystic fibrosis gene. This gene then codes for a shortened protein which is nonfunctional. The identification of different mutations in the gene that causes cystic fibrosis is important to the understanding of protein function in the disease process, and the types of defects that may result. (Consumer Summary produced by Reliance Medical Information, Inc.)

Geneticists have been puzzled by fragile X syndrome ever since it was discovered back in the 1970s. From the curious constituion of the affected chromosome to the unusual inheritance pattern [...]

Many genes are involved in the structure and function of the eye. There are only a few rare inherited forms retina degeneration for which the biochemical defects that characterize the disease state are known. However, with the use of molecular biological techniques, insights are being gained into the defects that cause other diseases of the eye. The gene that is defective in choroideraemia, a sex-linked (present only in males) inherited form of retinal degeneration, has recently been identified. Researchers were able to isolate the gene involved in the defect by its location on the chromosome. In patients with this defect, the gene was found to contain portions that were either deleted, missing, or had moved to other chromosomal sites. Another scientific approach to isolating genes that are defective in disease is called the candidate gene approach. Genes and the proteins that are encoded by the gene that are known to be involved in malfunctions resulting in disease are analyzed for defects in individuals with the particular disease. For example, in diseases of the retina, proteins involved in phototransduction, the structure of the retina, and vitamin A metabolism can be examined for defects which accompany a disease. It is known that mutations of genes that code for these proteins can lead to the disease state. The goal of genetic research on the retina is to identify genes and their mutations that are present in particular disease states, and to understand the biological defects so that therapies can be developed for specific diseases. (Consumer Summary produced by Reliance Medical Information, Inc.)