Search

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain '37B', which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3'-untranslated region (3'-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3'-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3'-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Background: We evaluated a new, 2-min blood creatinine method using the hand-held i-STAT analyzer. Good results have already been reported using this analyzer for 10 methods including electrolytes, TCO2, pH, PCO2, bicarbonate, glucose, hemoglobin and urea for uremic blood, hemodialysate and peritoneal effluent., Methods: Evaluation included study of imprecision and accuracy., Results: Imprecision studies gave excellent results, including those for reproducibility of 6 solutions with a mean of 10 repeats and coefficients of variation (CVs) of 0.4-3.4%, and also the mean of the differences between 33 duplicate blood specimens which was 2.2% of the specimen mean. To assess accuracy, we compared results of 149 tests by i-STAT and Beckman Synchron CX7 methods. The difference between the two means was 2.6% and the mean of all differences was 10.9% with i-STAT results higher, especially when blood creatinine values were < 100 micromol/l (1.1 mg/dl) indicating the need for a slightly higher upper limit of the normal range. The correlation coefficient between the two methods was 0.99, the slope 1.0 and the intercept -5.0 micromol/l (-0.06 mg/dl). We assessed the recommended creatinine correction for variation in PCO2 above and below 40 mm Hg, but our results did not suggest the need for such a correction in our range of 27-64 mm Hg; omission would remove a major method disadvantage. Assays of hemodialysate and peritoneal effluent were also satisfactory., Conclusions: The i-STAT creatinine method is simple and rapid and our evaluation showed satisfactory accuracy and precision. However, results were on average slightly higher than for the Beckman Synchron CX7 method., (Copyright 2001 S. Karger AG, Basel)

Flat apple disease-associated virus (FAV) was mechanically transmitted to the propagation host Chenopodium quinoa and double-stranded (ds)RNA recovered using CFII chromatography. Purified dsRNA was used to generate cDNA clones which were sequenced and the information used to design oligonucleotide primers for reverse transcription-polymerase chain reaction (RT-PCR) and tube capture (TC)/RT-PCR analyses. Oligonucleotide primers for RT-PCR analysis and dot blot hybridization using digoxigenin-labeled cDNA clones were used for the detection of FAV and Cherry rasp leaf virus (CRLV) in C. quinoa, in leaf and bud wood tissue of apple, or both. Primers JQ3D33FF/FR amplified a virus-specific 429-bp fragment and reliably detected all isolates of FAV and CRLV tested by RT-PCR and TC/RT-PCR. Primers JQ2C1FF/FR amplified a 370-bp fragment and detected FAV and some isolates of CRLV. Comparison of amino acid residues derived from the 429-bp fragments of FAV and CRLV gave 95% identity. The RT-PCR assays provided strong evidence of a relationship between FAV and CRLV. These assays were also used to confirm virus elimination in apple plants after heat therapy. Western blot analysis of FAV revealed capsid protein subunits of approximately 22 and 24 kDa. Our data support biological and serological evidence that FAV and CRLV are isolates of the same virus. Searches of the database produced sequence matches only with RNA2 of Apple latent spherical virus (ALSV), a new member of the family Comoviridae. This suggests that both primer pairs presumably target regions on RNA2 of FAV/CRLV and that these viruses may be more closely related to ALSV than to other members of this family.

Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

A filamentous virus, 752 nm long by 9.25 nm wide and with striations of 3.47 nm in pitch, was isolated from peach mosaic-affected peach. The peach mosaic-associated virus (PMV) has a coat protein subunit molecular mass of 20.5 kDa, and dsRNA bands of 7.0, 6.4, 4.2, and 1.9 × 10 6 Da, with a number of bands of lower molecular mass ranging in size from 1.3 to 0.3 × 10 6 Da. The herbaceous host range of PMV includes Chenopodium amaranticolor, C. quinoa, and Nicotiana occidentalis "37B." The virus was successfully bud-transmitted from infected peach to peach indicator plants, cv. Elberta, which displayed typical peach mosaic symptoms. Attempts to transmit PMV to Prunus avium cv. Bing and P. mahaleb were unsuccessful. In serological assays, PMV polyclonal antibody (PAb) cross-reacted with cherry mottle leaf virus (CMLV). CMLV PAb and CMLV monoclonal antibodies cross-reacted with all isolates of PMV tested. Blocking with skim milk had no effect on the cross-reactions observed. PMV was consistently associated with peach mosaic disease, and the bud transmission studies and serological data suggest that this virus is the causal agent of peach mosaic disease. Data indicating that there is no relationship between peach latent mosaic viroid and peach mosaic disease was also obtained. PMV and CMLV appear to be closely related viruses, with identical coat protein subunit size and dsRNA profiles.

The efficacy of seedlings of Prunus persica cv. GF 305, P. persica cv. Siberian C, and P. tomentosa (Nanking Cherry) as diagnostic indicators of plum pox infection, and of P. tomentosa for other Prunus viruses was evaluated by graft-inoculation with eight different strains or isolates of plum pox virus (PPV) representative of the Marcus (M) and Dideron (D) serogroups; and one isolate each of Prunus necrotic ringspot virus (PNRSV), prune dwarf virus (PDV), and sour cherry green ring mottle virus (GRMV). The initial PPV symptoms that developed in P. tomentosa within 30 days after inoculation were chlorotic banding along the midrib spreading to lateral veins from the leaf base upward, giving the appearance of a chlorotic oak-leaf pattern. Symptoms caused by PPV-M could be distinguished from those caused by PPV-D. Virus titers in infected P. tomentosa and GF 305 were higher than those in Siberian C when measured by triple antibody sandwich enzyme-linked immunosorbent assay. Infections by PNRSV, PDV, and GRMV were evident with the first flush of vegetative growth.

Acute administration of triethyltin (TET) produces a well-described sequence of pathological events characterized by intramyelinic vacuolation, edema, and histotoxic hypoxia. Recent behavioral studies have attempted to characterize the functional consequences of TET exposures. In this study, the effects of exposure on the visual evoked response (VER) and hippocampal afterdischarge (AD) were determined. Rats were administered either 0, 0.188, 0.375, 0.75, or 1.50 mg/kg TET bromide IP each day for 6 consecutive days. TET increased latencies of P1, N1, P2, N2, and N3 peaks of the VER. The increased latencies are consistent with delayed conduction produced by alterations in the myelin of the optic nerve. TET increased the frequency of spikes within ADs, increased the severity of postictal EEG depressions, and prolonged recovery of excitability following ADs. These effects may be partially explained as reflecting a generalized CNS depression.

A variety of trimethyltin (TMT)-produced sensory and behavioral dysfunctions have been reported. In this study the functional integrity of the somatosensory system was evaluated. Animals were tested using three different measures prior to (day 0) and 1, 4, and 16 days following dosing with either 0 (saline) or 7 mg/kg TMT. The tests employed were: (1) hot-plate pain threshold: (2) dorsal caudal nerve response threshold and conduction velocity; and (3) the somatosensory evoked response (SER). In the hot-plate test, TMT treated animals took longer to lick the hind paws in response to the heat. No effects were seen in the nerve function evaluation (conduction velocity and threshold), although increased N1, P1, and P2 latencies and decreased N1P1 amplitude were seen in SER recordings. The fact that no peripheral nerve function effects were observed suggests that the hot-plate and SER findings were the result of central nervous system dysfunction.

The induction and management of lambing was studied in a commercial flock of ewes. These ewes were bred at synchronized estrus and managed to lamb three times in 2 yr, with lambings occurring in the sequence of February, September and June. Ewes treated with 2 mg of estradiol benzoate in oil (i.m.) at approximately 17 d prior to term did not lamb in response to treatment. When 2 mg estradiol benzoate was given at 0800 on d 142 of gestation, lambing occurred an average of 37 +/- 5 h later in ewes treated in June or September and at 70 +/- 10 h later in ewes treated in February. The comparable figures for oil-treated ewes (control) were 70 +/- 5 h and 116 +/- 9 h, respectively. Altering the time of day of injection or using two injections 24 h apart did not alter the time for injection to lambing. Increasing the dose of estradiol benzoate to 15 mg decreased the time from injection to lambing (43 +/- 7 h, ewes treated in February) but also increased the incidence of dystocia (50% incidence). The incidence of dystocia averaged 8% for all other treatments and controls. Death loss of lambs to 1 wk of age was 12% and was not affected by treatment. The length of the lambing period was reduced from 9.0 +/- 3.3 d in control ewes to 3.6 +/- 1.1 d in induced ewes. A single injection of 2 mg estradiol benzoate given at 0800 on d 142 of gestation or a double treatment, with injections at 2000 on d 142 and 143, resulted in 53% of ewes lambing between 0800 and 1600 on each day of the lambing period, compared with 33% in control ewes.

In adults, triethyltin (TET) produces degeneration of white matter, edema, vacuolization on myelin and histotoxic hypoxia. To determine the functional consequences of perinatal exposure to TET, albino rats were administered either 0, 3, 6, or 9 mg/kg TET on postnatal day 5. Upon reaching adulthood, the rats were implanted with electrodes for recording visual evoked potentials (VEPs) and hippocampal afterdischarges (ADs). In addition to these tests, 17 days of kindling trials were administered to the rats followed by testing with pentylenetetrazol and picrotoxin for seizure susceptibility. TET increased latencies of P2, P3, and N3 of the VEP in a dose dependent fashion. TET also decreases N1P2 amplitudes and produced gender-specific alterations in both P1, N1, and N2 latencies and N2P3 amplitudes. TET produced alterations in duration of the AD recorded from cortex during kindling, but did not produce significant alterations in any of the other variables tested. The results support previous studies, since they show that the adult VEP is sensitive to perinatal toxicant exposure.

The breeding season was 157, 154, <126, 210 and 217 days for Rambouillet, Columbia, Suffolk, Rambouillet x Finnish Landrace and Columbia x Finnish Landrace ewes respectively. Treatment of cyclic ewes with pregnant mare serum gonadotropin (PMSG) (500 IU), following a 12-day treatment with progestin-containing intravaginal sponges, did not affect fertility, but did decrease the time from sponge removal to estrus, (control 48.0 +/- 3.1 hr; PMSG 39.4 +/- 1.8 hr) to the preovulatory surge of LH (control 52.7 +/- 2.8 hr; PMSG 39.0 +/- 1.7 hr) and FSH (control 52.3 +/- 2.9 hr; PMSG 42.8 +/- 1.6 hr) and caused an elevation of serum LH levels prior to the preovulatory surge (control 1.25 +/- 0.18 ng/ml; PMSG 2.31 +/- 0.22 ng/ml). Exposure of the purebred ewes to 18 hours of daylight in January, decreasing by 30 minutes a week subsequently, counteracted the seasonal reduction in the number of ewes lambing following induced breeding under natural daylight in May. Prolificacy was greatest in crossbred ewes and their fertility was not affected by season. Gestation period was longer for fall-bred ewes and varied with breed.

Trimethyltin (TMT) has been shown to produce damage in the limbic system and several other brain areas. To date, damage to sensory systems has not been reported. The present study investigated the integrity of the visual system following acute exposure to TMT. Rats were chronically implanted with electrodes for recording the evoked response from either the visual cortex or optic tract following photic stimulation. Following recovery, the animals were exposed to either 0 (saline), 4, 5, 6, or 7 mg/kg trimethyltin chloride (TMT). Evoked potentials were averaged the peak-to-peak amplitudes and latencies were determined. The results indicated that exposure to TMT produced alterations in the visual evoked response. The pattern of changes suggested two effects, an alteration in retinal processing and an alteration in arousal. The manifestation of these changes was an increase in early peak latencies recorded from the visual cortex and the optic tract, a decreased amplitude recorded from the visual cortex and optic tract early peaks (all suggestive of retinal changes) and a decreased P3N3 amplitude and N3 latency recorded from the visual cortex (suggestive of increased arousal). The results demonstrate that TMT does produce alterations in sensory systems as well as in the limbic system.

Arthrogryposis, frequently associated with cleft palate, scoliosis and kyphosis, has been investigated in pure and crossbred Charolais calves. During a 3-year study, a total of 76 congenitally malformed arthrogrypotic calves from 41 purebred and commercial Charolais herds was investigated. Investigations of the management, feeds, water and poisonous pasture plants in 6 herds reporting deformed calves did not reveal any factors which could be associated with the appearance of the defect. Analysis of pedigrees and matings which produced arthrogrypotic calves revealed that the arthrogryposis syndrome in the Charolais breed and its crosses in Canada is genetic in origin and caused by an autosomal recessive gene with complete penetrance in the homozygous state.

Previous studies have indicated that acute exposure to triethyltin (TET) increases latencies of the flash evoked response (VER) recorded from the rat cortex. TET also produces hypothermia, which may be modified by altering environmental (ambient) temperature. In this study, the role of ambient temperature in determining the effects of acute TET upon the VER was examined. Rats with chronically implanted electrodes were administered either TET (6 mg/kg) or saline, and maintained in either a warm (30 degree C) or cool (22 degrees C) environment for the next 7 hrs. VERs were recorded during this 7 hr period, and at regular intervals for the next 2 weeks. TET increased VER peak latencies. VER peak latencies recorded from animals exposed in a cool room gradually returned to pre-TET values. Latencies recorded from animals exposed to TET in a warm room remained elevated for a longer period of time, thus indicating a more severe impact of the TET exposure. This study indicates that toxicant-induced alterations in core temperature are potential determinants of other toxicant-induced effects.

The hippocampal afterdischarge (AD) has been suggested as an index of toxicant-induced CNS change [1]. The present experiments report raised AD thresholds, decreased AD durations, shorter post-stimulation latencies to AD onset, decreased numbers of AD spike complexes and increased numbers of spikes/complex following alcohol administration. Results are discussed in light of single-unit data concerning alcohol effects upon hippocampal cells, and the biphasic effects of alcohol upon behavior.