Search

Wheat yellow (stripe) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most devastating diseases of wheat worldwide. Pst populations are composed of multiple genetic groups, each carrying one or more races characterized by different avirulence/virulence combinations. Since the severe epidemics in 2017, yellow rust has become the most economically important wheat foliar disease in Uruguay. A set of 124 Pst isolates collected from wheat fields in Uruguay between 2017 and 2021 were characterized phenotypically, and 27 of those isolates were subsequently investigated in-depth by additional molecular genotyping and race phenotyping analyses. Three genetic groups were identified, PstS7 , PstS10 , and PstS13 , with the latter being the most prevalent. Two races previously reported in Europe, Warrior ( PstS7 ) and Benchmark ( Pst S10), were detected in four and two isolates, respectively. A third race, known as Triticale2015 ( PstS13 ), that was first detected in Europe in 2015 and in Argentina in 2017 was detected at several locations. Additional virulence to Yr3 , Yr17 , Yr25 , Yr27 , or Yr32 was detected in three new race variants within PstS13 . The identification of these new races, which have not been reported outside South America, provides strong evidence of the local evolution of virulence in Pst during the recent epidemic years., Competing Interests: The author(s) declare no conflict of interest.

Since the emergence of Ug99 wheat stem rust in Uganda in 1998 (Pretorius et al. 2000), the threat of movement into South Asia has been a concern due to long-distance dispersal capacity of airborne spores (Brown and Hovmøller 2002; Singh et al. 2008; Meyer et al. 2017). Increased preparedness by comprehensive rust surveillance efforts and development and deployment of resistant cultivars in advance of an incursion into South Asia has been one of the success stories of the Borlaug Global Rust Initiative (Sharma et al. 2013). In November 2023, an off-season rust survey was conducted in Marpha, Gandaki and Bagmati provinces in Nepal. Rust was only observed at two sites, Dangdunge of Dolakha district and Mude of Sindhupalchok district, where spring wheat was grown as fodder crop outside the main cropping season. Rust infected wheat leaves (10-15 leaves per site) were air dried and sealed in envelopes that were shipped under permit to the Global Rust Reference Center, Denmark. Bulk samples of stem rust, Puccinia graminis f.sp. tritici (Pgt), were recovered from both envelopes, and single pustule isolates were raised and multiplied on Morocco and McNair. Meanwhile, specimens of dry leaves were subjected to SSR genotyping according to standard procedures (Patpour et al. 2022). One distinct multi-locus Pgt genotype was observed, identical to and representing 99% of Ug99 isolates within Clade I collected in East Africa between 2012-2022. A Pgt single pustule isolate from each of the sampling sites were inoculated onto 20 internationally agreed stem rust differential lines using standard procedures, and 14 supplementary lines providing additional resolution of pathogen virulence (Patpour et al. 2022). The pathotyping was repeated in two independent experiments, which resulted in the infection type pattern of Pgt race TTKTT (Supplementary Table 1). Additional independent SSR genotype assays of recovered isolates confirmed the prevalent genotype of Clade I (Patpour et al. 2022; Szabo et al. 2022). This first detection of Ug99 race TTKTT in South Asia emphasizes the need for continued coordinated international surveillance efforts and utilization of diverse sources of resistance to control stem rust in wheat. New surveillance efforts in Nepal during February-March 2024 did not reveal additional cases of wheat stem rust. However, more detailed and sustained rust surveillance efforts, assessment of the vulnerability of current wheat crops to Ug99 and other races of stem-, stripe/yellow- and leaf rust, as well as intensified breeding for rust resistance throughout the region is strongly recommended to meet current and future plant health risks.

Rye ( Secale cereale L .) is an important cereal crop used for food, beverages, and feed, especially in North-Eastern Europe. While rye is generally more tolerant to biotic and abiotic stresses than other cereals, it still can be infected by several diseases, including scald caused by Rhynchosporium secalis . The aims of this study were to investigate the genetic architecture of scald resistance, to identify genetic markers associated with scald resistance, which could be used in breeding of hybrid rye and to develop a model for genomic prediction for scald resistance. Four datasets with records of scald resistance on a population of 251 hybrid winter rye lines grown in 2 years and at 3 locations were used for this study. Four genomic models were used to obtain variance components and heritabilities of scald resistance. All genomic models included additive genetic effects of the parental components of the hybrids and three of the models included additive-by-additive epistasis and/or dominance effects. All models showed moderate to high broad sense heritabilities in the range of 0.31 (SE 0.05) to 0.76 (0.02). The model without non-additive genetic effects and the model with dominance effects had moderate narrow sense heritabilities ranging from 0.24 (0.06) to 0.55 (0.08). None of the models detected significant non-additive genomic variances, likely due to a limited data size. A genome wide association study was conducted to identify markers associated with scald resistance in hybrid winter rye. In three datasets, the study identified a total of twelve markers as being significantly associated with scald resistance. Only one marker was associated with a major quantitative trait locus (QTL) influencing scald resistance. This marker explained 11-12% of the phenotypic variance in two locations. Evidence of genotype-by-environment interactions was found for scald resistance between one location and the other two locations, which suggested that scald resistance was influenced by different QTLs in different environments. Based on the results of the genomic prediction models and GWAS, scald resistance seems to be a quantitative trait controlled by many minor QTL and one major QTL, and to be influenced by genotype-by-environment interactions., Competing Interests: Authors KM, MM, JO, PS and AJ were employed by the company Nordic Seed A/S. The research was conducted in a collaboration between Aarhus University and the plant breeding company Nordic Seed A/S. The funders had no role in the design of the study, in collection, analysis, or interpretation of data, or in the decision to publish the results. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Madsen, Kristensen, Mahmood, Thach, Mohlfeld, Orabi, Sarup, Jahoor, Hovmøller, Rodriguez-Algaba and Jensen.)

The comeback of wheat stem rust in Europe, caused by Puccinia graminis f. sp. tritici , and the prevalence of the alternate (sexual) host in local areas have recently regained attention as a potential threat to European wheat production. The aim of this study was to investigate a potential epidemiological link between the aecia found on an indigenous barberry species and stem rust infections on nearby cereals and grasses. Aecial infections collected from Berberis vulgaris subsp. seroi were inoculated on a panel of susceptible genotypes of major cereal crop species. In total, 67 stem rust progeny isolates were recovered from wheat (51), barley (7), and rye (9), but none from oat, indicating the potential of barberry derived isolates to infect multiple cereals. Molecular genotyping of the progeny isolates and 20 cereal and grass stem rust samples collected at the same locations and year, revealed a clear genetic relatedness between the progeny isolated from barberry and the stem rust infections found on nearby cereal and grass hosts. Analysis of Molecular Variance indicated that variation between the stem rust populations accounted for only 1%. A Principal Components Analysis using the 62 detected multilocus genotypes also demonstrated a low degree of genetic variation among isolates belonging to the two stem rust populations. Lastly, pairwise comparisons based on fixation index (Fst), Nei's genetic distances and number of effective migrants (Nm) revealed low genetic differentiation and high genetic exchange between the two populations. Our results demonstrated a direct epidemiological link and functionality of an indigenous barberry species as the sexual host of P . graminis in Spain, a factor that should be considered when designing future strategies to prevent stem rust in Europe and beyond., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Rodriguez-Algaba, Villegas, Cantero-Martínez, Patpour, Berlin, Hovmøller, Jin and Justesen.)

Long-distance dispersal of plant pathogens at the continental scale may have strong implications on plant health, in particular when incursions result in spread of disease to new territories where the disease was previously absent or insignificant. These dispersions may be caused by airborne transmission of spores or accidental spread via human travel and trade. Recent surveillance efforts of cereal rust fungi have demonstrated that incursion of new strains with superior fitness into areas where the disease is already established may have similar implications on plant health. Since dispersal events are highly stochastic, irrespective of transmission mechanism, critical mitigation efforts include preparedness by coordinated pathogen surveillance activities, host crop diversification, and breeding for disease resistance with low vulnerability to sudden changes in the pathogen population., (Copyright © 2022 Elsevier Ltd. All rights reserved.)

Climate changes over the past 25 years have led to conducive conditions for invasive and transboundary fungal disease occurrence, including the re-emergence of wheat stem rust disease, caused by Puccinia graminis f.sp. tritici (Pgt) in East Africa, Europe, and the Mediterranean basin. Since 2018, sporadic infections have been observed in Tunisia. In this study, we investigated Pgt occurrence at major Tunisian wheat growing areas. Pgt monitoring, assessment, and sampling from planted trap nurseries at five different locations over two years (2021 and 2022) revealed the predominance of three races, namely TTRTF (Clade III-B), TKKTF (Clade IV-F), and TKTTF (Clade IV-B). Clade III-B was the most prevalent in 2021 as it was detected at all locations, while in 2022 Pgt was only reported at Beja and Jendouba, with the prevalence of Clade IV-B. The low levels of disease incidence during these two years and Pgt population diversity suggest that this fungus most likely originated from exotic incursions and that climate factors could have caused disease establishment in Tunisia. Further evaluation under the artificial disease pressure of Tunisian wheat varieties and weather-based modeling for early disease detection in the Mediterranean area could be helpful in monitoring and predicting wheat stem rust emergence and epidemics.

The increased emergence of cereal stem rust in southern and western Europe, caused by the pathogen Puccinia graminis , and the prevalence of alternate (sexual) host, Berberis species, have regained attention as the sexual host may serve as source of novel pathogen variability that may pose a threat to cereal supply. The main objective of the present study was to investigate the functional role of Berberis species in the current epidemiological situation of cereal stem rust in Europe. Surveys in 11 European countries were carried out from 2018 to 2020, where aecial infections from five barberry species were collected. Phylogenetic analysis of 121 single aecial clusters of diverse origin using the elongation factor 1-α gene indicated the presence of different special forms (aka formae speciales ) of P. graminis adapted to different cereal and grass species. Inoculation studies using aecial clusters from Spain, United Kingdom, and Switzerland resulted in 533 stem rust isolates sampled from wheat, barley, rye, and oat, which confirmed the presence of multiple special forms of P. graminis . Microsatellite marker analysis of a subset of 192 sexually-derived isolates recovered on wheat, barley and rye from the three populations confirmed the generation of novel genetic diversity revealed by the detection of 135 multilocus genotypes. Discriminant analysis of principal components resulted in four genetic clusters, which grouped at both local and country level. Here, we demonstrated that a variety of Berberis species may serve as functional alternate hosts for cereal stem rust fungi and highlights the increased risks that the sexual cycle may pose to cereal production in Europe, which calls for new initiatives within rust surveillance, epidemiological research and resistance breeding., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Rodriguez-Algaba, Hovmøller, Schulz, Hansen, Lezáun, Joaquim, Randazzo, Czembor, Zemeca, Slikova, Hanzalová, Holdgate, Wilderspin, Mascher, Suffert, Leconte, Flath and Justesen.)

Key Message: Stem rust resistance genes, SrRL5271 and Sr672.1 as well as SrCPI110651, from Aegilops tauschii, the diploid D genome progenitor of wheat, are sequence variants of Sr46 differing by 1-2 nucleotides leading to non-synonymous amino acid substitutions. The Aegilops tauschii (wheat D-genome progenitor) accessions RL 5271 and CPI110672 were identified as resistant to multiple races (including the Ug99) of the wheat stem rust pathogen Puccinia graminis f. sp. tritici (Pgt). This study was conducted to identify the stem rust resistance (Sr) gene(s) in both accessions. Genetic analysis of the resistance in RL 5271 identified a single dominant allele (SrRL5271) controlling resistance, whereas resistance segregated at two loci (SR672.1 and SR672.2) for a cross of CPI110672. Bulked segregant analysis placed SrRL5271 and Sr672.1 in a region on chromosome arm 2DS that encodes Sr46. Molecular marker screening, mapping and genomic sequence analysis demonstrated SrRL5271 and Sr672.1 are alleles of Sr46. The amino acid sequence of SrRL5271 and Sr672.1 is identical but differs from Sr46 (hereafter referred to as Sr46_h1 by following the gene nomenclature in wheat) by a single amino acid (N763K) and is thus designated Sr46_h2. Screening of a panel of Ae. tauschii accessions identified an additional allelic variant that differed from Sr46_h2 by a different amino acid (A648V) and was designated Sr46_h3. By contrast, the protein encoded by the susceptible allele of Ae. tauschii accession AL8/78 differed from these resistance proteins by 54 amino acid substitutions (94% nucleotide sequence gene identity). Cloning and complementation tests of the three resistance haplotypes confirmed their resistance to Pgt race 98-1,2,3,5,6 and partial resistance to Pgt race TTRTF in bread wheat. The three Sr46 haplotypes, with no virulent races detected yet, represent a valuable source for improving stem resistance in wheat., (© 2022. This is a U.S. Government work and not under copyright protection in the US; foreign copyright protection may apply.)

The objective of this study was to investigate the re-emergence of a previously important crop pathogen in Europe, Puccinia graminis f.sp. tritici, causing wheat stem rust. The pathogen has been insignificant in Europe for more than 60 years, but since 2016 it has caused epidemics on both durum wheat and bread wheat in local areas in southern Europe, and additional outbreaks in Central- and West Europe. The prevalence of three distinct genotypes/races in many areas, Clade III-B (TTRTF), Clade IV-B (TKTTF) and Clade IV-F (TKKTF), suggested clonal reproduction and evolution by mutation within these. None of these genetic groups and races, which likely originated from exotic incursions, were detected in Europe prior to 2016. A fourth genetic group, Clade VIII, detected in Germany (2013), was observed in several years in Central- and East Europe. Tests of representative European wheat varieties with prevalent races revealed high level of susceptibility. In contrast, high diversity with respect to virulence and Simple Sequence Repeat (SSR) markers were detected in local populations on cereals and grasses in proximity to Berberis species in Spain and Sweden, indicating that the alternate host may return as functional component of the epidemiology of wheat stem rust in Europe. A geographically distant population from Omsk and Novosibirsk in western Siberia (Russia) also revealed high genetic diversity, but clearly different from current European populations. The presence of Sr31 -virulence in multiple and highly diverse races in local populations in Spain and Siberia stress that virulence may emerge independently when large geographical areas and time spans are considered and that Sr31 -virulence is not unique to Ug99. All isolates of the Spanish populations, collected from wheat, rye and grass species, were succesfully recovered on wheat, which underline the plasticity of host barriers within P. graminis . The study demonstrated successful alignment of two genotyping approaches and race phenotyping methodologies employed by different laboratories, which also allowed us to line up with previous European and international studies of wheat stem rust. Our results suggest new initiatives within disease surveillance, epidemiological research and resistance breeding to meet current and future challenges by wheat stem rust in Europe and beyond., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Patpour, Hovmøller, Rodriguez-Algaba, Randazzo, Villegas, Shamanin, Berlin, Flath, Czembor, Hanzalova, Sliková, Skolotneva, Jin, Szabo, Meyer, Valade, Thach, Hansen and Justesen.)

Stem rust, caused by Puccinia graminis , is a destructive group of diseases. The pathogen uses Berberis species as alternate hosts to complete its life cycle. B . vulgaris and the endemic species B. hispanica and B. garciae are present in Spain. The objective of this study was to investigate the functionality of the indigenous barberry as alternate hosts. Field surveys were conducted in 2018 and 2019 in Huesca, Teruel and Albacete provinces of Spain. Aecial samples on barberry were analysed via infection assays and DNA analysis. B . garciae was predominant in Huesca and Teruel provinces, often found in the field margins of cereal crops. Aecial infections on B . garciae were observed in May and uredinial infections on cereal crops in June. Scattered B . hispanica bushes were occasionally found near cereal crops in Albacete, where aecial infections on B . hispanica were observed in June when most cereal crops were mature. Infection assays using aeciospores resulted in stem rust infections on susceptible genotypes of wheat, barley, rye and oat, indicating the presence of the sexual cycle for P . graminis f. sp. tritici , f. sp. secalis and f. sp. avenae . Sequence analyses from aecial samples supported this finding as well as the presence of Puccinia brachypodii . This study provides the first evidence that indigenous Berberis species play an active role in the sexual cycle of P . graminis under natural conditions in Spain., (© 2022 The Authors. Plant Pathology published by John Wiley & Sons Ltd on behalf of British Society for Plant Pathology. This article has been contributed to by U.S. Government employees and their work is in the public domain in the USA.)

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. ( Pst ) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 μm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 μm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the β-tubulin 1 gene (tub1) (Kuzdraliński et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.

The majority of released rye cultivars are susceptible to leaf rust because of a low level of resistance in the predominant hybrid rye-breeding gene pools Petkus and Carsten. To discover new sources of leaf rust resistance, we phenotyped a diverse panel of inbred lines from the less prevalent Gülzow germplasm using six distinct isolates of Puccinia recondita f. sp. secalis and found that 55 out of 92 lines were resistant to all isolates. By performing a genome-wide association study using 261,406 informative SNP markers, we identified five resistance-associated QTLs on chromosome arms 1RS, 1RL, 2RL, 5RL and 7RS. To identify candidate Puccinia recondita ( Pr ) resistance genes in these QTLs, we sequenced the rye nucleotide-binding leucine-rich repeat (NLR) intracellular immune receptor complement using a Triticeae NLR bait-library and PacBio ® long-read single-molecule high-fidelity (HiFi) sequencing. Trait-genotype correlations across 10 resistant and 10 susceptible lines identified four candidate NLR-encoding Pr genes. One of these physically co-localized with molecular markers delimiting Pr3 on chromosome arm 1RS and the top-most resistance-associated QTL in the panel.

Leaf rust constitutes one of the most important foliar diseases in rye ( Secale cereale L.). To discover new sources of resistance, we phenotyped 180 lines belonging to a less well-characterized Gülzow germplasm at three field trial locations in Denmark and Northern Germany in 2018 and 2019. We observed lines with high leaf rust resistance efficacy at all locations in both years. A genome-wide association study using 261,406 informative single-nucleotide polymorphisms revealed two genomic regions associated with resistance on chromosome arms 1RS and 7RS, respectively. The most resistance-associated marker on chromosome arm 1RS physically co-localized with molecular markers delimiting Pr3 . In the reference genomes Lo7 and Weining, the genomic region associated with resistance on chromosome arm 7RS contained a large number of nucleotide-binding leucine-rich repeat (NLR) genes. Residing in close proximity to the most resistance-associated marker, we identified a cluster of NLRs exhibiting close protein sequence similarity with the wheat leaf rust Lr1 gene situated on chromosome arm 5DL in wheat, which is syntenic to chromosome arm 7RS in rye. Due to the close proximity to the most resistance-associated marker, our findings suggest that the considered leaf rust R gene, provisionally denoted Pr6 , could be a Lr1 ortholog in rye.

Long-distance migration and host adaptation by transboundary plant pathogens often brings detrimental effects to important agroecosystems. Efficient surveillance as a basis for responding to the dynamics of such pathogens is often hampered by a lack of information on incursion origin, evolutionary pathways and the genetic basis of rapidly evolving virulence across larger timescales. Here, we studied these genetic features by using historical isolates of the obligate biotrophic pathogen Puccinia striiformis f. sp. tritici (Pst), which causes one of the most widespread and devastating diseases, stripe (yellow) rust, of wheat. Through a combination of genotypic, phenotypic and genomic analyses, we assigned eight Pst isolates representing putative exotic Pst incursions into Australia to four previously defined genetic groups, PstS0, PstS1, PstS10 and PstS13. We showed that isolates of an additional incursion of P. striiformis, known locally as P. striiformis f. sp. pseudo-hordei, had a new and unique multilocus SSR genotype (MLG). We provide results of overall genomic variation of representative Pst isolates from each genetic group by comparative genomic analyses. We showed that isolates within the PstS1 and PstS13 genetic groups are most distinct at the whole-genome variant level from isolates belonging to genetic group PstS0, whereas the isolate from the PstS10 genetic group is intermediate. We further explored variable gene content, including putative effectors, representing both shared but also unique genetic changes that have occurred following introduction, some of which may additionally account for local adaptation of these isolates to triticale. Our genotypic and genomic data revealed new genetic insights into the evolution of diverse phenotypes of rust pathogens following incursion into a geographically isolated continental region., (© 2021 John Wiley & Sons Ltd.)

Puccinia striiformis f. sp. tritici , which causes yellow (or stripe) rust on wheat, is a macrocyclic and heteroecious fungus. In this study, we investigated whether Berberis vulgaris subsp. seroi and B. vulgaris subsp. australis , which are indigenous in Spain, may serve as alternate hosts for P. striiformis f. sp. tritici . Wheat leaves bearing telia of an isolate of P. striiformis f. sp. tritici were harvested and used to inoculate plants of both barberry subspecies. Pycnia were observed on the adaxial side of the leaves from 10 days after inoculation (dai). Following successful fertilization, aecia were observed on the abaxial side of the leaves from 16 dai. At 27 dai, barberry leaves bearing aecia were detached and used to inoculate susceptible wheat seedlings of cultivar Morocco. Uredinia were observed on wheat seedlings from 12 days after aeciospore exposure. Eighty-three single lesions were recovered from individual wheat leaves, of which 43 were genotyped using 19 P. striiformis f. sp. tritici simple sequence repeat markers (SSR). In total, 19 multilocus genotypes (MLGs) were identified among the 43 progeny isolates. The SSR genotyping confirmed that all 43 isolates were derived from the parental isolate. Seven heterozygous SSR markers showed segregation among the progenies, whereas none of the 12 homozygous markers resulted in segregation. These results demonstrated that B. vulgaris subspp. seroi and australis can serve as alternate hosts for P. striiformis f. sp. tritici , which may result in novel virulence combinations that can have a detrimental impact on wheat production. Although P. striiformis f. sp. tritici has not been detected on these barberry species in nature, this study highlights the importance of rust surveillance in barberry areas where suitable conditions for completion of the sexual life cycle may be present.

Wheat ( Triticum aestivum L.) is one of the world's staple food crops and one of the most devastating foliar diseases attacking wheat is powdery mildew (PM). In Denmark only a few specific fungicides are available for controlling PM and the use of resistant cultivars is often recommended. In this study, two Chinese wheat landraces and two synthetic hexaploid wheat lines were used as donors for creating four multi-parental populations with a total of 717 individual lines to identify new PM resistance genetic variants. These lines and the nine parental lines (including the elite cultivars used to create the populations) were genotyped using a 20 K Illumina SNP chip, which resulted in 8,902 segregating single nucleotide polymorphisms for assessment of the population structure and whole genome association study. The largest genetic difference among the lines was between the donors and the elite cultivars, the second largest genetic difference was between the different donors; a difference that was also reflected in differences between the four multi-parental populations. The 726 lines were phenotyped for PM resistance in 2017 and 2018. A high PM disease pressure was observed in both seasons, with severities ranging from 0 to >50%. Whole genome association studies for genetic variation in PM resistance in the populations revealed significant markers mapped to either chromosome 2A, B, or D in each of the four populations. However, linkage disequilibrium between these putative quantitative trait loci (QTL) were all above 0.80, probably representing a single QTL. A combined analysis of all the populations confirmed this result and the most associated marker explained 42% of the variation in PM resistance. This study gives both knowledge about the resistance as well as molecular tools and plant material that can be utilised in marker-assisted selection. Additionally, the four populations produced in this study are highly suitable for association studies of other traits than PM resistance., Competing Interests: The study was performed in a collaboration between Aarhus University and the plant breeding company Nordic Seed A/S. NN, PS, JA, AJ, and JO were employed by company Nordic Seed A/S. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2021 Nordestgaard, Thach, Sarup, Rodriguez-Algaba, Andersen, Hovmøller, Jahoor, Jørgensen and Orabi.)

Nonhost resistance, a resistance of plant species against all nonadapted pathogens, is considered the most durable and efficient immune system in plants. To increase our understanding of the response of barley plants to infection by powdery mildew, Blumeria graminis f. sp. tritici, we used quantitative proteomic analysis (LC-MS/MS). We compared the response of two genotypes of barley cultivar Golden Promise, wild type (WT) and plants with overexpression of phytoglobin (previously hemoglobin) class 1 (HO), which has previously been shown to significantly weaken nonhost resistance. A total of 8804 proteins were identified and quantified, out of which the abundance of 1044 proteins changed significantly in at least one of the four comparisons ('i' stands for 'inoculated')- HO/WT and HOi/WTi (giving genotype differences), and WTi/WT and HOi/HO (giving treatment differences). Among these differentially abundant proteins (DAP) were proteins related to structural organization, disease/defense, metabolism, transporters, signal transduction and protein synthesis. We demonstrate that quantitative changes in the proteome can explain physiological changes observed during the infection process such as progression of the mildew infection in HO plants that was correlated with changes in proteins taking part in papillae formation and preinvasion resistance. Overexpression of phytoglobins led to modification in signal transduction prominently by dramatically reducing the number of kinases induced, but also in the turnover of other signaling molecules such as phytohormones, polyamines and Ca 2+ . Thus, quantitative proteomics broaden our understanding of the role NO and phytoglobins play in barley during nonhost resistance against powdery mildew.

Stripe rust of wheat, caused by the obligate biotrophic fungus Puccinia striiformis f.sp. tritici, is a major threat to wheat production worldwide with an estimated yearly loss of US $1 billion. The recent advances in long-read sequencing technologies and tailored-assembly algorithms enabled us to disentangle the two haploid genomes of Pst. This provides us with haplotype-specific information at a whole-genome level. Exploiting this novel information, we perform whole-genome comparative genomics of two P. striiformis f.sp. tritici isolates with contrasting life histories. We compare one isolate of the old European lineage (PstS0), which has been asexual for over 50 years, and a Warrior isolate (PstS7 lineage) from a novel incursion into Europe in 2011 from a sexual population in the Himalayan region. This comparison provides evidence that long-term asexual evolution leads to genome expansion, accumulation of transposable elements, and increased heterozygosity at the single nucleotide, structural, and allele levels. At the whole-genome level, candidate effectors are not compartmentalized and do not exhibit reduced levels of synteny. Yet we were able to identify two subsets of candidate effector populations. About 70% of candidate effectors are invariant between the two isolates, whereas 30% are hypervariable. The latter might be involved in host adaptation on wheat and explain the different phenotypes of the two isolates. Overall, this detailed comparative analysis of two haplotype-aware assemblies of P. striiformis f.sp. tritici is the first step in understanding the evolution of dikaryotic rust fungi at a whole-genome level., (© The Author(s) 2020. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.)

Background: Effective disease management depends on timely and accurate diagnosis to guide control measures. The capacity to distinguish between individuals in a pathogen population with specific properties such as fungicide resistance, toxin production and virulence profiles is often essential to inform disease management approaches. The genomics revolution has led to technologies that can rapidly produce high-resolution genotypic information to define individual variants of a pathogen species. However, their application to complex fungal pathogens has remained limited due to the frequent inability to culture these pathogens in the absence of their host and their large genome sizes., Results: Here, we describe the development of Mobile And Real-time PLant disEase (MARPLE) diagnostics, a portable, genomics-based, point-of-care approach specifically tailored to identify individual strains of complex fungal plant pathogens. We used targeted sequencing to overcome limitations associated with the size of fungal genomes and their often obligately biotrophic nature. Focusing on the wheat yellow rust pathogen, Puccinia striiformis f.sp. tritici (Pst), we demonstrate that our approach can be used to rapidly define individual strains, assign strains to distinct genetic lineages that have been shown to correlate tightly with their virulence profiles and monitor genes of importance., Conclusions: MARPLE diagnostics enables rapid identification of individual pathogen strains and has the potential to monitor those with specific properties such as fungicide resistance directly from field-collected infected plant tissue in situ. Generating results within 48 h of field sampling, this new strategy has far-reaching implications for tracking plant health threats.

In our recent Communications Biology article, we reported the first occurrence of wheat stem rust in the UK in nearly six decades. An increased incidence of wheat stem rust in Western Europe, caused by the fungus Puccinia graminis f. sp. tritici , could signify the return of this formidable foe. As pathologists fight back against this devastating disease we outline the continuing research and strategies being employed to bridle its onslaught., Competing Interests: The authors declare no competing interests.

Yellow rust, caused by Puccinia striiformis f. sp. tritici (Pst), is a devastating fungal disease threatening much of global wheat production. Race-specific resistance (R)-genes are used to control rust diseases, but the rapid emergence of virulent Pst races has prompted the search for a more durable resistance. Here, we report the cloning of Yr15, a broad-spectrum R-gene derived from wild emmer wheat, which encodes a putative kinase-pseudokinase protein, designated as wheat tandem kinase 1, comprising a unique R-gene structure in wheat. The existence of a similar gene architecture in 92 putative proteins across the plant kingdom, including the barley RPG1 and a candidate for Ug8, suggests that they are members of a distinct family of plant proteins, termed here tandem kinase-pseudokinases (TKPs). The presence of kinase-pseudokinase structure in both plant TKPs and the animal Janus kinases sheds light on the molecular evolution of immune responses across these two kingdoms.

Wheat stem rust, a devastating disease of wheat and barley caused by the fungal pathogen Puccinia graminis f. sp. tritici , was largely eradicated in Western Europe during the mid-to-late twentieth century. However, isolated outbreaks have occurred in recent years. Here we investigate whether a lack of resistance in modern European varieties, increased presence of its alternate host barberry and changes in climatic conditions could be facilitating its resurgence. We report the first wheat stem rust occurrence in the United Kingdom in nearly 60 years, with only 20% of UK wheat varieties resistant to this strain. Climate changes over the past 25 years also suggest increasingly conducive conditions for infection. Furthermore, we document the first occurrence in decades of P. graminis on barberry in the UK . Our data illustrate that wheat stem rust does occur in the UK and, when climatic conditions are conducive, could severely harm wheat and barley production., Competing Interests: The authors declare no competing financial interests.

We investigated whether the recent worldwide epidemics of wheat yellow rust were driven by races of few clonal lineage(s) or populations of divergent races. Race phenotyping of 887 genetically diverse Puccinia striiformis isolates sampled in 35 countries during 2009-2015 revealed that these epidemics were often driven by races from few but highly divergent genetic lineages. PstS1 was predominant in North America; PstS2 in West Asia and North Africa; and both PstS1 and PstS2 in East Africa. PstS4 was prevalent in Northern Europe on triticale; PstS5 and PstS9 were prevalent in Central Asia; whereas PstS6 was prevalent in epidemics in East Africa. PstS7, PstS8 and PstS10 represented three genetic lineages prevalent in Europe. Races from other lineages were in low frequencies. Virulence to Yr9 and Yr27 was common in epidemics in Africa and Asia, while virulence to Yr17 and Yr32 were prevalent in Europe, corresponding to widely deployed resistance genes. The highest diversity was observed in South Asian populations, where frequent recombination has been reported, and no particular race was predominant in this area. The results are discussed in light of the role of invasions in shaping pathogen population across geographical regions. The results emphasized the lack of predictability of emergence of new races with high epidemic potential, which stresses the need for additional investments in population biology and surveillance activities of pathogens on global food crops, and assessments of disease vulnerability of host varieties prior to their deployment at larger scales.

An isolate of the fungus Puccinia striiformis, causing yellow (stripe) rust on cereals and grasses, was selfed on the alternate (sexual) host, Berberis vulgaris. This enabled us to investigate genetic variability of progeny isolates within and among aecia. Nine aecial clusters each consisting of an aecium (single aecial cup) and nine clusters containing multiple aecial cups were selected from 18 B. vulgaris leaves. Aeciospores from each cluster were inoculated on susceptible wheat seedlings and 64 progeny isolates were recovered. Molecular genotyping using 37 simple sequence repeat markers confirmed the parental origin of all progeny isolates. Thirteen molecular markers, which were heterozygous in the parental isolate, were used to analyse genetic diversity within and among aecial cups. The 64 progeny isolates resulted in 22 unique recombinant multilocus genotypes and none of them were resampled in different aecial clusters. Isolates derived from a single cup were always of the same genotype whereas isolates originating from clusters containing up to nine aecial cups revealed one to three genotypes per cluster. These results implied that each aecium was the result of a successful fertilization in a corresponding pycnium and that an aecium consisted of genetically identical aeciospores probably multiplied via repetitive mitotic divisions. Furthermore, the results suggested that aecia within a cluster were the result of independent fertilization events often involving genetically different pycniospores. The application of molecular markers represented a major advance in comparison to previous studies depending on phenotypic responses on host plants. The study allowed significant conclusions about fundamental aspects of the biology and genetics of an important cereal rust fungus., (Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.)

Information about temporal and spatial variability of fungal structures and host responses is scarce in comparison to the vast amount of genetic, biochemical, and physiological studies of host-pathogen interactions. In this study, we used avirulent wild type and virulent mutant isolates of Puccinia striiformis to characterize the interactions in wheat carrying yellow rust Yr 2 resistance. Both conventional and advanced microscopic techniques were used for a detailed study of morphology and growth of fungal colonies and associated host cell responses. The growth of the wild type isolates was highly restricted due to hypersensitive response (HR, plant cell death) indicated by autofluorescence and change in the shape of the affected plant cells. The host response appeared post-haustorial, but large variation in the time and stage of arrest was observed for individual fungal colonies, probably due to a delay between detection and response. Some colonies were stopped right after the formation of the primary infection hyphae whereas others formed highly branched mycelia. HR was first observed in host cells in direct contact with fungal structures, after which the defense responses spread to adjacent host cells, and eventually led to encasement of the fungal colony. Several cells with HR contained haustoria, which were small and underdeveloped, but some cells contained normal sized haustoria without signs of hypersensitivity. The growth of the virulent mutants in the resistant plants was similar to the growth in plants without Yr 2 resistance, which is a strong indication that the incompatible phenotype was associated with Yr 2. The interaction between P. striiformis and wheat with Y r2 resistance was highly variable in time and space, which demonstrate that histological studies are important for a deeper understanding of host-pathogen interactions and plant defense mechanisms in general.

A procedure for virulence phenotyping of isolates of yellow (stripe) rust using spray inoculation of wheat seedlings by spores suspended in an engineered fluid, Novec™ 7100, is presented. Differential sets consisting of near-isogenic Avocet lines, selected lines from the "World" and "European" sets, and additional varieties showing race-specificity facilitate a robust assessment of race, irrespectively of geographical and evolutionary origin of isolates. A simple procedure for purification of samples consisting of multiple races is also presented.

A simple point-inoculation method using Novec™ 7100, a volatile engineered fluid, is presented for the assessment of aggressiveness of Puccinia striiformis isolates on seedlings of wheat. The method allows for quantification of the applied inoculum with a minimal risk of cross-contamination of rust from leaves grown side by side. The method is also applicable for the assessment of qualitative differences inferred by compatible and incompatible host-pathogen interactions, and it can be adjusted to other cereal rust and powdery mildew fungi on other host species, and other plant growth stages as appropriate.

Wheat is grown worldwide in diverse geographical regions, environments, and production systems. Although many diseases and pests are known to reduce grain yield potential and quality, the three rusts and powdery mildew fungi have historically caused major crop losses and continue to remain economically important despite the widespread use of host resistance and fungicides. The evolution and fast spread of virulent and more aggressive race lineages of rust fungi have only worsened the situation. Fusarium head blight, leaf spotting diseases, and, more recently, wheat blast (in South America and Bangladesh) have become diseases of major importance in recent years largely because of intensive production systems, the expansion of conservation agriculture, undesirable crop rotations, or increased dependency on fungicides. High genetic diversity for race-specific and quantitative resistance is known for most diseases; their selection through phenotyping reinforced with molecular strategies offers great promise in achieving more durable resistance and enhancing global wheat productivity.

Frequent emergence of new variants in the Puccinia graminis f. sp. tritici Ug99 race group in Kenya has made pathogen survey a priority. We analyzed 140 isolates from 78 P. graminis f. sp. tritici samples collected in Kenya between 2008 and 2014 and identified six races, including three not detected prior to 2013. Genotypic analysis of 20 isolates from 2013 and 2014 collections showed that the new races TTHST, TTKTK, and TTKTT belong to the Ug99 race group. International advanced breeding lines were evaluated against an isolate of TTKTT (Sr31, Sr24, and SrTmp virulence) at the seedling stage. From 169 advanced lines from Kenya, 23% of lines with resistance to races TTKSK and TTKST were susceptible to TTKTT and, from two North American regional nurseries, 44 and 91% of resistant lines were susceptible. Three lines with combined resistance genes were developed to facilitate pathogen monitoring and race identification. These results indicate the increasing virulence and variability in the Kenyan P. graminis f. sp. tritici population and reveal vulnerabilities of elite germplasm to new races.

We identified a wheat stripe rust (Puccinia striiformis) effector candidate (PEC6) with pattern-triggered immunity (PTI) suppression function and its corresponding host target. PEC6 compromised PTI host species-independently. In Nicotiana benthamiana, it hampers reactive oxygen species (ROS) accumulation and callose deposition induced by Pseudomonas fluorescens. In Arabidopsis, plants expressing PEC6 were more susceptible to Pseudomonas syringae pv. tomato (Pto) DC3000 ΔAvrPto/ΔAvrPtoB. In wheat, PEC6-suppression of P. fluorescens-elicited PTI was revealed by the fact that it allowed activation of effector-triggered immunity by Pto DC3000. Knocking down of PEC6 expression by virus-mediated host-induced gene silencing decreased the number of rust pustules, uncovering PEC6 as an important pathogenicity factor. PEC6, overexpressed in plant cells without its signal peptide, was localized to the nucleus and cytoplasm. A yeast two-hybrid assay showed that PEC6 interacts with both wheat and Arabidopsis adenosine kinases (ADKs). Knocking down wheat ADK expression by virus-induced gene silencing reduced leaf growth and enhanced the number of rust pustules, indicating that ADK is important in plant development and defence. ADK plays essential roles in regulating metabolism, cytokinin interconversion and methyl transfer reactions, and our data propose a model where PEC6 may affect one of these processes by targeting ADK to favour fungal growth., (© 2016 University of Copenhagen. New Phytologist © 2016 New Phytologist Trust.)

The fungus Puccinia striiformis causes yellow (stripe) rust on wheat worldwide. In the present article, new methods utilizing an engineered fluid (Novec 7100) as a carrier of urediniospores were compared with commonly used inoculation methods. In general, Novec 7100 facilitated a faster and more flexible application procedure for spray inoculation and it gave highly reproducible results for virulence phenotyping. Six point inoculation methods were compared to find the most suitable for assessment of pathogen aggressiveness. The use of Novec 7100 and dry dilution with Lycopodium spores gave an inoculation success rate of 100% in two independent trials, which was significantly higher and more consistent than for spore suspension in Soltrol 170, water, water + Tween 20, and Noble agar + Tween 20. Both Soltrol 170 and Novec 7100 allowed precise quantification of inoculum, which is important for the assessment of quantitative epidemiological parameters. New protocols for spray and point inoculation of P. striiformis on wheat are presented, along with the prospect for applying these in rust research and resistance breeding activities.

Investigating the origin and dispersal pathways is instrumental to mitigate threats and economic and environmental consequences of invasive crop pathogens. In the case of Puccinia striiformis causing yellow rust on wheat, a number of economically important invasions have been reported, e.g., the spreading of two aggressive and high temperature adapted strains to three continents since 2000. The combination of sequence-characterized amplified region (SCAR) markers, which were developed from two specific AFLP fragments, differentiated the two invasive strains, PstS1 and PstS2 from all other P. striiformis strains investigated at a worldwide level. The application of the SCAR markers on 566 isolates showed that PstS1 was present in East Africa in the early 1980s and then detected in the Americas in 2000 and in Australia in 2002. PstS2 which evolved from PstS1 became widespread in the Middle East and Central Asia. In 2000, PstS2 was detected in Europe, where it never became prevalent. Additional SSR genotyping and virulence phenotyping revealed 10 and six variants, respectively, within PstS1 and PstS2, demonstrating the evolutionary potential of the pathogen. Overall, the results suggested East Africa as the most plausible origin of the two invasive strains. The SCAR markers developed in the present study provide a rapid, inexpensive, and efficient tool to track the distribution of P. striiformis invasive strains, PstS1 and PstS2.

Puccinia striiformis is a basidiomycete causing yellow rust on wheat. The availability of historic samples of this pathogen from the 'Stubbs collection' enabled us to investigate past population structure and temporal dynamics on a global scale. A set of 212 single genotype urediniospore isolates, representing samples collected from five continents between 1958 and 1991, were genotyped using 19 polymorphic microsatellite markers. The population genetic analyses revealed the existence of seven genetic groups in the past worldwide P. striiformis population. This genetic grouping generally corresponded with geographical sample origin except for the Middle East, where six of the seven genetic groups were represented. The presence of many genetic groups in the Middle Eastern population reflected a low differentiation from the populations in East Africa (FST=0.052) and in South Asia (FST=0.064). A high diversity and recombinant population structure was observed in China and South Asia, while a clonal population structure was observed in NW Europe, East Africa and the Mediterranean region. The high genetic diversity in the Himalayan region supported recent studies suggesting a putative center of diversity for P. striiformis in this area. Four of the 89 multilocus genotypes detected were resampled in different geographical regions suggesting long-distance migration in the past. Comparison of the past populations with more recent ones, represented by 309 isolates mainly collected between 2001 and 2009, revealed temporal divergence for all populations except for Northwest Europe. Overall, we observed a clear subdivision within the worldwide population structure of P. striiformis and migration in the past., (Copyright © 2015 Elsevier Inc. All rights reserved.)

Race Ug99 (TTKSK) of Puccinia graminis f. sp. tritici, detected in Uganda in 1998, has been recognized as a serious threat to food security because it possesses combined virulence to a large number of resistance genes found in current widely grown wheat (Triticum aestivum) varieties and germplasm, leading to its potential for rapid spread and evolution. Since its initial detection, variants of the Ug99 lineage of stem rust have been discovered in Eastern and Southern African countries, Yemen, Iran, and Egypt. To date, eight races belonging to the Ug99 lineage are known. Increased pathogen monitoring activities have led to the identification of other races in Africa and Asia with additional virulence to commercially important resistance genes. This has led to localized but severe stem rust epidemics becoming common once again in East Africa due to the breakdown of race-specific resistance gene SrTmp, which was deployed recently in the 'Digalu' and 'Robin' varieties in Ethiopia and Kenya, respectively. Enhanced research in the last decade under the umbrella of the Borlaug Global Rust Initiative has identified various race-specific resistance genes that can be utilized, preferably in combinations, to develop resistant varieties. Research and development of improved wheat germplasm with complex adult plant resistance (APR) based on multiple slow-rusting genes has also progressed. Once only the Sr2 gene was known to confer slow rusting APR; now, four more genes-Sr55, Sr56, Sr57, and Sr58-have been characterized and additional quantitative trait loci identified. Cloning of some rust resistance genes opens new perspectives on rust control in the future through the development of multiple resistance gene cassettes. However, at present, disease-surveillance-based chemical control, large-scale deployment of new varieties with multiple race-specific genes or adequate levels of APR, and reducing the cultivation of susceptible varieties in rust hot-spot areas remains the best stem rust management strategy.

A severe stem rust epidemic occurred in southern Ethiopia during November 2013 to January 2014, with yield losses close to 100% on the most widely grown wheat cultivar, 'Digalu'. Sixty-four stem rust samples collected from the regions were analyzed. A meteorological model for airborne spore dispersal was used to identify which regions were most likely to have been infected from postulated sites of initial infection. Based on the analyses of 106 single-pustule isolates derived from these samples, four races of Puccinia graminis f. sp. tritici were identified: TKTTF, TTKSK, RRTTF, and JRCQC. Race TKTTF was found to be the primary cause of the epidemic in the southeastern zones of Bale and Arsi. Isolates of race TKTTF were first identified in samples collected in early October 2013 from West Arsi. It was the sole or predominant race in 31 samples collected from Bale and Arsi zones after the stem rust epidemic was established. Race TTKSK was recovered from 15 samples from Bale and Arsi zones at low frequencies. Genotyping indicated that isolates of race TKTTF belongs to a genetic lineage that is different from the Ug99 race group and is composed of two distinct genetic types. Results from evaluation of selected germplasm indicated that some cultivars and breeding lines resistant to the Ug99 race group are susceptible to race TKTTF. Appearance of race TKTTF and the ensuing epidemic underlines the continuing threats and challenges posed by stem rust not only in East Africa but also to wider-scale wheat production.

Resistance to Puccinia striiformis was examined in nine wheat recombinant inbred lines (RILs) from a cross between 'Camp Rémy' (resistant parent) and 'Récital' (susceptible parent) using an isolate of a strain common to the northwestern European population before 2011 (old) and two additional isolates, one representing an aggressive and high-temperature-adapted strain (PstS2) and another representing a virulence phenotype new to Europe since 2011 (new). The RILs carried different combinations of quantitative trait loci (QTL) for resistance to P. striiformis. Under greenhouse conditions, the three isolates gave highly contrasting results for infection type, latent period, lesion length, and diseased leaf area. The PstS2 isolate revealed Yr genes and QTL which conferred complete resistance in adult plants. Six QTL had additive effects against the old isolate whereas the effects of these QTL were significantly lower for the new isolate. Furthermore, the new isolate revealed previously undetected resistance in the susceptible parent. Disease severity under field conditions agreed with greenhouse results, except for Camp Rémy being fully resistant to the new isolate and for two RILs being susceptible in the field. These results stress the need of maintaining high genetic diversity for disease resistance in wheat and of using pathogen isolates of diverse origin in studies of host resistance genetics.

An isolate of the basidiomycete Puccinia striiformis, which causes yellow (stripe) rust on wheat, was selfed on the newly discovered alternate host, Berberis vulgaris. This allowed a study of the segregation of molecular markers and virulence in the progeny isolates, and of the development of fungal sexual structures and spore forms. Pycnia and aecia were obtained after inoculation of B. vulgaris with basidiospores resulting from germinating teliospores from infected wheat leaves. Subsequent inoculation of wheat with aeciospores from bulked aecia resulted in 16 progeny isolates of the S1 generation. Genotyping with 42 simple sequence repeat (SSR) markers confirmed a parental origin of progeny isolates. Of the 42 analyzed loci, 15 were heterozygous in the parental isolate and 14 revealed segregation in the progenies. This resulted in 11 new multilocus genotypes (MLGs), which confirmed segregation following sexual reproduction. Additionally, parental and progeny isolates were phenotyped using a genetic stock of wheat genotypes representing 21 resistance genes. All S1 progeny isolates had virulence for 14 out of 15 loci where the parental isolate was virulent. This was consistent with the hypothesis that virulence in plant pathogens is often recessive to avirulence, i.e., only expressed in a homozygous state. Furthermore, no segregation was observed for five out of six loci, for which the parental isolate had an avirulent phenotype. The results for one of the two segregating virulence/avirulence loci suggested that the parental isolate was heterozygous with Avr alleles resulting in different but clearly avirulent phenotypes. The other locus indicated that additional genes modifying the phenotypic expression of avirulence were involved., (Copyright © 2014 Elsevier Inc. All rights reserved.)

Understanding the mode of temporal maintenance of plant pathogens is an important domain of microbial ecology research. Due to the inconspicuous nature of microbes, their temporal maintenance cannot be studied directly through tracking individuals and their progeny. Here, we suggest a series of population genetic analyses on molecular marker variation in temporally spaced samples to infer about the relative contribution of sexual reproduction, off-season survival and migration to the temporal maintenance of pathogen populations. We used the proposed approach to investigate the temporal maintenance of wheat yellow rust pathogen, Puccinia striiformis f.sp. tritici (PST), in the Himalayan region of Pakistan. Multilocus microsatellite genotyping of PST isolates revealed high genotypic diversity and recombinant population structure across all locations, confirming the existence of sexual reproduction in this region. The genotypes were assigned to four genetic groups, revealing a clear differentiation between zones with and without Berberis spp., the alternate host of PST, with an additional subdivision within the Berberis zone. The lack of any differentiation between samples across two sampling years, and the very infrequent resampling of multilocus genotypes over years at a given location was consistent with limited over-year clonal survival, and a limited genetic drift. The off-season oversummering population in the Berberis zone, likely to be maintained locally, served as a source of migrants contributing to the temporal maintenance in the non-Berberis zone. Our study hence demonstrated the contribution of both sexual recombination and off-season oversummering survival to the temporal maintenance of the pathogen. These new insights into the population biology of PST highlight the general usefulness of the analytical approach proposed., (© 2013 John Wiley & Sons Ltd.)

Analyses of large-scale population structure of pathogens enable the identification of migration patterns, diversity reservoirs or longevity of populations, the understanding of current evolutionary trajectories and the anticipation of future ones. This is particularly important for long-distance migrating fungal pathogens such as Puccinia striiformis f.sp. tritici (PST), capable of rapid spread to new regions and crop varieties. Although a range of recent PST invasions at continental scales are well documented, the worldwide population structure and the center of origin of the pathogen were still unknown. In this study, we used multilocus microsatellite genotyping to infer worldwide population structure of PST and the origin of new invasions based on 409 isolates representative of distribution of the fungus on six continents. Bayesian and multivariate clustering methods partitioned the set of multilocus genotypes into six distinct genetic groups associated with their geographical origin. Analyses of linkage disequilibrium and genotypic diversity indicated a strong regional heterogeneity in levels of recombination, with clear signatures of recombination in the Himalayan (Nepal and Pakistan) and near-Himalayan regions (China) and a predominant clonal population structure in other regions. The higher genotypic diversity, recombinant population structure and high sexual reproduction ability in the Himalayan and neighboring regions suggests this area as the putative center of origin of PST. We used clustering methods and approximate Bayesian computation (ABC) to compare different competing scenarios describing ancestral relationship among ancestral populations and more recently founded populations. Our analyses confirmed the Middle East-East Africa as the most likely source of newly spreading, high-temperature-adapted strains; Europe as the source of South American, North American and Australian populations; and Mediterranean-Central Asian populations as the origin of South African populations. Although most geographic populations are not markedly affected by recent dispersal events, this study emphasizes the influence of human activities on recent long-distance spread of the pathogen.

Differentiation of haustoria on primary infection hyphae of the fungal pathogen Puccinia striiformis was studied in wheat seedlings with two-photon microscopy in combination with a classical staining technique. Our results showed a significant increase in the average haustorium size 22, 44, 68, 92 and 116 h after inoculation (hai). After 116 hai no significant change was observed until 336 hai. Haustorium morphology also changed significantly during the time of infection. Initially small spherical haustoria were seen, but as they grew the haustoria gradually became apically branched. At 22 hai all observed haustoria were spherical, but at 44 hai most haustoria had an irregular structure, and at 92 hai all observed haustoria appeared branched. Along with the changes of the haustorial body the haustorial neck changed from narrow and slender to having an expanded appearance with a rough and invaginated structure. The structural changes were similar in two susceptible wheat varieties, 514W and Cartago, although the mean haustorium size was larger in 514W than in Cartago at all intervals.

Yellow (stripe) rust is a common fungal disease on cereals and grasses. It is caused by Puccinia striiformis sensu lato, which is biotrophic and heteroecious. The pathogen is specialized on the primary host at both species and cultivar levels, whereas several Berberis spp. may serve as alternate hosts. One lineage infects mainly cereals and at least two lineages are restricted to grasses. P. striiformis on cereals has a typical clonal population structure in many areas, resulting from asexual reproduction, but high diversity, suggesting frequent recombination, has been observed in certain areas in Asia. Yellow rust is spreading by airborne spores potentially across long distances, which may contribute to sudden disease epidemics in new areas. This has been the case since 2000, where large-scale epidemics in warmer wheat-growing areas have been ascribed to the emergence of two closely related yellow rust strains with increased aggressiveness and tolerance to warm temperatures., (Copyright © 2011 by Annual Reviews. All rights reserved.)

Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based on virulence phenotype and amplified fragment length polymorphism. The objective of this research was to quantify differences in aggressiveness among isolates representative of the pre-2000 and post-2000 populations. Representative isolates were evaluated at low (10 to 18 degrees C) and high (12 to 28 degrees C) temperature regimes for latent period, lesion length, lesion width, lesion area, and spore production on adult plants of a susceptible wheat cultivar with no known genes for resistance to stripe rust. "New" isolates (since 2000) were significantly more aggressive than "old" isolates (before 2000) for all variables. At the low temperature regime, new isolates sporulated 2.1 days (16%) sooner, grew 0.3 mm per day (18%) faster, produced 999 (140%) more spores per inoculation site per day, and produced 6.5 (71%) more spores per mm2 of lesion per day compared with old isolates. At the high temperature regime, new isolates sporulated 3 days (26%) sooner, grew 0.2 mm per day (18%) and 2.2 mm2 per day (88%) faster, grew 1.2 mm (50%) wider, produced 774 (370%) more spores per inoculation site per day, and produced 6.2 (159%) more spores per mm2 of lesion per day than old isolates. New isolates showed significant adaptation to the warm temperature regime for all variables. Based on these results and previously published models for stripe rust epidemics, recent severe stripe rust epidemics were most likely enhanced by the pathogen's increased aggressiveness, especially at higher temperature. Furthermore, these results demonstrate that wheat rust fungi can adapt to warmer temperatures and cause severe disease in previously unfavorable environments.

Rust fungi can overcome the effect of host resistance genes rapidly, and spores can disperse long distance by wind. Here we demonstrate a foreign incursion of similar strains of the wheat yellow rust fungus, Puccinia striiformis f. sp. tritici, in North America, Australia and Europe in less than 3 years. One strain defined by identity at 15 virulence loci and 130 amplified fragment length polymorphism (AFLP) fragments was exclusive to North America (present since 2000) and Australia (since 2002). Another strain of the same virulence phenotype, but differing in two AFLP fragments, was exclusive to Europe (present since 2000-2001) as well as Western and Central Asia and the Red Sea Area (first appearance unknown). This may be the most rapid spread of an important crop pathogen on the global scale. The limited divergence between the two strains and their derivatives, and the temporal-spatial occurrence pattern confirmed a recent spread. The data gave evidence for additional intercontinental dispersal events in the past, that is, many isolates sampled before 2000 in Europe, North America and Australia had similar AFLP fingerprints, and isolates from South Africa, which showed no divergence in AFLP, differed by only two fragments from particular isolates from Central Asia, West Asia and South Europe, respectively. Previous research has demonstrated that isolates of the two new strains produced up to two to three times more spores per day than strains found in USA and Europe before 2000, suggesting that increased aggressiveness at this level may accelerate global spread of crop pathogens.

The effects of evolutionary processes in fungal pathogen populations may occur more rapidly and display larger effects in agricultural systems than in wild ecosystems because of human involvement by plant breeding and crop management. In this study, we analysed the rate of evolution in three lineages of a northwest European population of a biotrophic and asexual reproduced fungal pathogen, Puccinia striiformis f. sp. tritici, causing yellow rust on wheat. Pathogen samples were collected between 1975 and 2002 in the UK and Denmark, and assayed for 14 individual avirulence/virulence alleles and up to 234 amplified fragment length polymorphism (AFLP) primer pairs producing approximately 17,000 AFLP fragments. The large number of fragments and a targeted sampling of isolates allowed a reconstruction of phylogenies in great detail, i.e. no homoplasy and a representation of sequential, evolutionary steps by pathogen samples. A recent, phenotypic loss of avirulence was observed at least once for loci corresponding to P. striiformis f. sp. tritici resistance Yr2, Yr3, Yr4, Yr7, Yr9, and Yr15, whereas Avr6 and Avr17 were lost independently in all three lineages, corresponding to 16 events of loss of avirulence (emergence of virulence). The opposite process, restoration of avirulence, was observed for Yr9 and Yr32. An interpretation of phenotypic changes within lineages as independent mutation events resulted in mutation frequencies from 1.4x10(-6) to 4.1x10(-6) per AFLP fragment (locus) per generation, whereas the effective rate by which a mutation from avirulence to virulence was established in the pathogen population, when subject to selection by host resistance genes, was approximately three orders of magnitude faster.

Puccinia striiformis f. sp. tritici (PST), a clonal basidiomycete causing yellow rust disease on wheat, has a long record of 'overcoming' cultivar resistance introduced by breeders. Despite the long dispersal capacity of its spores, the French population of PST presents a strong geographical structure, with the presence of a specific pathotype (array of avirulence genes) at high frequencies in the south of France. The genetic diversity underlying this differentiation was analysed by microsatellite and AFLP markers. A total of 213 French isolates belonging to 10 pathotypes collected over a 15-year period were investigated. For each of the 12 microsatellites used, polymorphism resulted from a unique allelic variant associated to the south-specific pathotype. This pathotype was characterized by 40 specific markers over the total of 63 polymorphins detected using 15 AFLP primer combinations. Phylogeographical analysis indicated a strictly clonal structure of the population, and a strong genomic divergence between the northern population and a south-specific clone. Both virulence and molecular data show that the northern French population belongs to the northwestern European population, whereas the southern clone is most likely related to a Mediterranean population, the two subpopulations resulting from the ancient divergence of two clonal lineages. While the virulence complexity in the northern population may be explained by the successive introduction of corresponding resistance genes in cultivars, the maintenance of a simple virulence type in southern France, despite gene flow between the two populations, may be explained in terms of host cultivars repartition and local adaptation to specific host or climatic conditions.

Some of the most striking and extreme consequences of rapid, long-distance aerial dispersal involve pathogens of crop plants. Long-distance dispersal of fungal spores by the wind can spread plant diseases across and even between continents and reestablish diseases in areas where host plants are seasonally absent. For such epidemics to occur, hosts that are susceptible to the same pathogen genotypes must be grown over wide areas, as is the case with many modern crops. The strongly stochastic nature of long-distance dispersal causes founder effects in pathogen populations, such that the genotypes that cause epidemics in new territories or on cultivars with previously effective resistance genes may be atypical. Similar but less extreme population dynamics may arise from long-distance aerial dispersal of other organisms, including plants, viruses, and fungal pathogens of humans.