Search

The liberation of energy stores from adipocytes is critical to support survival in times of energy deficit; however, uncontrolled or chronic lipolysis associated with insulin resistance and/or insulin insufficiency disrupts metabolic homeostasis.sup.1,2. Coupled to lipolysis is the release of a recently identified hormone, fatty-acid-binding protein 4 (FABP4).sup.3. Although circulating FABP4 levels have been strongly associated with cardiometabolic diseases in both preclinical models and humans.sup.4-7, no mechanism of action has yet been described.sup.8-10. Here we show that hormonal FABP4 forms a functional hormone complex with adenosine kinase (ADK) and nucleoside diphosphate kinase (NDPK) to regulate extracellular ATP and ADP levels. We identify a substantial effect of this hormone on beta cells and given the central role of beta-cell function in both the control of lipolysis and development of diabetes, postulate that hormonal FABP4 is a key regulator of an adipose-beta-cell endocrine axis. Antibody-mediated targeting of this hormone complex improves metabolic outcomes, enhances beta-cell function and preserves beta-cell integrity to prevent both type 1 and type 2 diabetes. Thus, the FABP4-ADK-NDPK complex, Fabkin, represents a previously unknown hormone and mechanism of action that integrates energy status with the function of metabolic organs, and represents a promising target against metabolic disease. Hormonal FABP4 is discovered to be a pivotal regulator of an adipose-beta-cell endocrine axis that coordinates energy status and metabolic organ function, and targeting this axis improved metabolic outcomes., Author(s): Kacey J. Prentice [sup.1] , Jani Saksi [sup.1] , Lauren T. Robertson [sup.1] , Grace Y. Lee [sup.1] , Karen E. Inouye [sup.1] , Kosei Eguchi [sup.1] , Alexandra [...]

Proper function of the endoplasmic reticulum (ER) and mitochondria is crucial for cellular homeostasis, and dysfunction at either site has been linked to pathophysiological states, including metabolic diseases. Although the ER and mitochondria play distinct cellular roles, these organelles also form physical interactions with each other at sites defined as mitochondria- associated ER membranes (MAMs), which are essential for calcium, lipid and metabolite exchange. Here we show that in the liver, obesity leads to a marked reorganization of MAMs resulting in mitochondrial calcium overload, compromised mitochondrial oxidative capacity and augmented oxidative stress. Experimental induction of ER-mitochondria interactions results in oxidative stress and impaired metabolic homeostasis, whereas downregulation of PACS-2 or IP3R1, proteins important for ER-mitochondria tethering or calcium transport, respectively, improves mitochondrial oxidative capacity and glucose metabolism in obese animals. These findings establish excessive ER-mitochondrial coupling as an essential component of organelle dysfunction in obesity that may contribute to the development of metabolic pathologies such as insulin resistance and diabetes., Obese individuals are at increased risk for developing insulin resistance and other comorbidities, including diabetes and cardiovascular disease (1,2). Although the molecular mechanisms that underlie these associations are not completely [...]

Eukaryotic cells coordinately control anabolic and catabolic processes to maintain cell and tissue homeostasis. Mechanistic target of rapamycin complex 1 (mTORC1) promotes nutrient-consuming-anabolic processes, such as protein synthesis (1). Here we show that as well as increasing protein synthesis, mTORC1 activation in mouse and human cells also promotes an increased capacity for protein degradation. Cells with activated mTORC1 exhibited elevated levels of intact and active proteasomes through a global increase in the expression of genes encoding proteasome subunits. The increase in proteasome gene expression, cellular proteasome content, and rates of protein turnover downstream of mTORC1 were all dependent on induction of the transcription factor nuclear factor erythroid-derived 2-related factor 1 (NRF1; also known as NFE2L1). Genetic activation of mTORC1 through loss of the tuberous sclerosis complex tumour suppressors, TSC1 or TSC2, or physiological activation of mTORC1 in response to growth factors or feeding resulted in increased NRF1 expression in cells and tissues. We find that this NRF1-dependent elevation in proteasome levels serves to increase the intracellular pool of amino acids, which thereby influences rates of new protein synthesis. Therefore, mTORC1 signalling increases the efficiency of proteasome-mediated protein degradation for both quality control and as a mechanism to supply substrate for sustained protein synthesis., In response to growth signals, mTORC1 promotes anabolic processes, such as protein synthesis, and its chronic activation is believed to underlie a variety of complex human diseases, including cancer and [...]

Food intake increases the activity of hepatic de novo lipogenesis, which mediates the conversion of glucose to fats for storage or use. In mice, this program follows a circadian rhythm that peaks with nocturnal feeding (1,2) and is repressed by Rev-erba/β and an HDAC3-containing complex (3-5) during the day. The transcriptional activators controlling rhythmic lipid synthesis in the dark cycle remain poorly defined. Disturbances in hepatic lipogenesis are also associated with systemic metabolic phenotypes (6-8), suggesting that lipogenesis in the liver communicates with peripheral tissues to control energy substrate homeostasis. Here we identify a PPARδ-dependent de novo lipogenic pathway in the liver that modulates fat use by muscle via a circulating lipid. The nuclear receptor PPARδ controls diurnal expression of lipogenic genes in the dark/feeding cycle. Liver-specific PPARδ activation increases, whereas hepatocyte-Ppard deletion reduces, muscle fatty acid uptake. Unbiased metabolite profiling identifies phosphatidylcholine 18:0/18:1 (PC(18:0/ 18:1) as a serum lipid regulated by diurnal hepatic PPARδ activity. PC(18:0/18:1) reduces postprandial lipid levels and increases fatty acid use through muscle PPARα. High-fat feeding diminishes rhythmic production of PC(18:0/18:1), whereas PC(18:0/18:1) administration in db/db mice (also known as [Lepr.sup.-/-]) improves metabolic homeostasis. These findings reveal an integrated regulatory circuit coupling lipid synthesis in the liver to energy use in muscle by coordinating the activity of two closely related nuclear receptors. These data implicate alterations in diurnal hepatic PPARδ-PC(18:0/18:1) signalling in metabolic disorders, including obesity. TGTAGATGGGCTTTACCAAAGATG CCACGAGCTTGTCACCATCTC, PPAR PPARδ promotes fatty acid (FA) synthesis in the liver (9). Surprisingly, hepatic PPARΔ overexpression (adenoviral-mediated, adPPARδ) reduced circulating triglyceride (TG) and free fatty acid (FFA) levels (Fig. 1a). FA [...]

The inflammasome regulates the release of caspase activation-dependent cytokines, including interleukin (IL)-1β, IL-18 and high-mobility group box 1 (HMGB1) (1-5). By studying HMGB1 release mechanisms, here we identify a role for double-stranded RNA-dependent protein kinase (PKR, also known as EIF2AK2) in inflammasome activation. Exposure of macrophages to inflammasome agonists induced PKR autophosphorylation. PKR inactivation by genetic deletion or pharmacological inhibition severely impaired inflammasome activation in response to double-stranded RNA, ATP, monosodium urate, adjuvant aluminium, rotenone, live Escherichia coli, anthrax lethal toxin, DNA transfection and Salmonella typhimurium infection. PKR deficiency significantly inhibited the secretion of IL-1β, IL-18 and HMGB1 in E. coli-induced peritonitis. PKR physically interacts with several inflammasome components, including NOD-like receptor (NLR) family pyrin domain-containing 3 (NLRP3), NLRP1, NLR family CARD domain-containing protein 4 (NLRC4), absent in melanoma 2 (AIM2), and broadly regulates inflammasome activation. PKR autophosphorylation in a cell-free system with recombinant NLRP3, apoptosis-associated speck-like protein containing a CARD (ASC, also known as PYCARD) and pro-caspase-1 reconstitutes inflammasome activity. These results show a crucial role for PKR in inflammasome activation, and indicate that it should be possible to pharmacologically target this molecule to treat inflammation., HMGB1, a ubiquitous nuclear and cytosolic protein, is released into the extracellular space during sterile inflammation and infection (6). Immunocompetent cells secrete HMGB1 after stimulation with microbial products and other [...]

Intra-abdominal tumors, such as ovarian cancer (1,2), have a clear predilection for metastasis to the omentum, an organ primarily composed of adipocytes. Currently, it is unclear why tumor cells preferentially home to and proliferate in the omentum, yet omental metastases typically represent the largest tumor in the abdominal cavities of women with ovarian cancer. We show here that primary human omental adipocytes promote homing, migration and invasion of ovarian cancer cells, and that adipokines including interleukin-8 (IL-8) mediate these activities. Adipocyte-ovarian cancer cell coculture led to the direct transfer of lipids from adipocytes to ovarian cancer cells and promoted in vitro and in vivo tumor growth. Furthermore, coculture induced lipolysis in adipocytes and β-oxidation in cancer cells, suggesting adipocytes act as an energy source for the cancer cells. A protein array identified upregulation of fatty acid-binding protein 4 (FABP4, also known as aP2) in omental metastases as compared to primary ovarian tumors, and FABP4 expression was detected in ovarian cancer cells at the adipocyte-tumor cell interface. FABP4 deficiency substantially impaired metastatic tumor growth in mice, indicating that FABP4 has a key role in ovarian cancer metastasis. These data indicate adipocytes provide fatty acids for rapid tumor growth, identifying lipid metabolism and transport as new targets for the treatment of cancers where adipocytes are a major component of the microenvironment., Most ovarian cancers are diagnosed at an advanced stage when the tumor is widely metastatic (1,2). The most common subtype is serous ovarian cancer, which may arise from the surface [...]

The endoplasmic reticulum (ER) is the main site of protein and lipid synthesis, membrane biogenesis, xenobiotic detoxification and cellular calcium storage, and perturbation of ER homeostasis leads to stress and the activation of the unfolded protein response (1). Chronic activation of ER stress has been shown to have an important role in the development of insulin resistance and diabetes in obesity (2). However, the mechanisms that lead to chronic ER stress in a metabolic context in general, and in obesity in particular, are not understood. Here we comparatively examined the proteomic and lipidomic landscape of hepatic ER purified from lean and obese mice to explore the mechanisms of chronic ER stress in obesity. We found suppression of protein but stimulation of lipid synthesis in the obese ER without significant alterations in chaperone content. Alterations in ER fatty acid and lipid composition result in the inhibition of sarco/endoplasmic reticulum calcium ATPase (SERCA) activity and ER stress. Correcting the obesity-induced alteration of ER phospholipid composition or hepatic Serca over-expression in vivo both reduced chronic ER stress and improved glucose homeostasis. Hence, we established that abnormal lipid and calcium metabolism are important contributors to hepatic ER stress in obesity., It has been generally accepted that a surplus of nutrients and energy stimulates synthetic pathways and may lead to client overloading in the ER. However, it has not been demonstrated [...]

Atherosclerosis and related cardiovascular diseases represent one of the greatest threats to human health worldwide. Despite important progress in prevention and treatment, these conditions still account for one third of all deaths annually. Often presented together with obesity, insulin resistance and type 2 diabetes, these chronic diseases are strongly influenced by pathways that lie at the interface of chronic inflammation and nutrient metabolism. Here I discuss recent advances in the study of endoplasmic reticulum stress as one mechanism that links immune response with nutrient sensing in the pathogenesis of atherosclerosis and its complications., A prevailing view on the pathogenesis of atherosclerosis has focused on abnormalities in lipid metabolism (1). However, it has subsequently become clear that inflammation is also central to this pathology [...]

Macrophages show endoplasmic reticulum (ER) stress when exposed to lipotoxic signals associated with atherosclerosis, although the pathophysiological importance and the underlying mechanisms of this phenomenon remain unknown. Here we show that mitigation of ER stress with a chemical chaperone results in marked protection against lipotoxic death in macrophages and prevents macrophage fatty acid-binding protein-4 (aP2) expression. Using genetic and chemical models, we show that aP2 is the predominant regulator of lipid-induced macrophage ER stress. The absence of lipid chaperones incites an increase in the production of phospholipids rich in monounsaturated fatty acids and bioactive lipids that render macrophages resistant to lipid-induced ER stress. Furthermore, the impact of aP2 on macrophage lipid metabolism and the ER stress response is mediated by upregulation of key lipogenic enzymes by the liver X receptor. Our results demonstrate the central role for lipid chaperones in regulating ER homeostasis in macrophages in atherosclerosis and show that ER responses can be modified, genetically or chemically, to protect the organism against the deleterious effects of hyperlipidemia., Organelle-mediated stress, particularly ER stress, has recently emerged as a major pathophysiological paradigm underlying chronic metabolic diseases (1-8). In conjunction with its central role in protein synthesis, folding and transportation, [...]

Although mast cell functions have classically been related to allergic responses (1-3), recent studies indicate that these cells contribute to other common diseases such as multiple sclerosis, rheumatoid arthritis, atherosclerosis, aortic aneurysm and cancer (4-8). This study presents evidence that mast cells also contribute to diet-induced obesity and diabetes. For example, white adipose tissue (WAT) from obese humans and mice contain more mast cells than WAT from their lean counterparts. Furthermore, in the context of mice on a Western diet, genetically induced deficiency of mast cells, or their pharmacological stabilization, reduces body weight gain and levels of inflammatory cytokines, chemokines and proteases in serum and WAT, in concert with improved glucose homeostasis and energy expenditure. Mechanistic studies reveal that mast cells contribute to WAT and muscle angiogenesis and associated cell apoptosis and cathepsin activity. Adoptive transfer experiments of cytokine-deficient mast cells show that these cells, by producing interleukin-6 (IL-6) and interferon-γ (IFN-γ), contribute to mouse adipose tissue cysteine protease cathepsin expression, apoptosis and angiogenesis, thereby promoting diet-induced obesity and glucose intolerance. Our results showing reduced obesity and diabetes in mice treated with clinically available mast cell-stabilizing agents suggest the potential of developing new therapies for these common human metabolic disorders., In addition to adipocytes, it has been shown that WAT in obese humans and mice contains macrophages and lymphocytes (9-11). As expected from these previous studies, we found that WAT [...]

To link to full-text access for this article, visit this link: http://dx.doi.org/10.1016/j.cell.2008.07.048 Byline: Haiming Cao (1), Kristin Gerhold (1), Jared R. Mayers (1), Michelle M. Wiest (2), Steven M. Watkins (2), Gokhan S. Hotamisligil (1) Keywords: CELLBIO; HUMDISEASE Abstract: Dysregulation of lipid metabolism in individual tissues leads to systemic disruption of insulin action and glucose metabolism. Utilizing quantitative lipidomic analyses and mice deficient in adipose tissue lipid chaperones aP2 and mal1, we explored how metabolic alterations in adipose tissue are linked to whole-body metabolism through lipid signals. A robust increase in de novo lipogenesis rendered the adipose tissue of these mice resistant to the deleterious effects of dietary lipid exposure. Systemic lipid profiling also led to identification of C16:1n7-palmitoleate as an adipose tissue-derived lipid hormone that strongly stimulates muscle insulin action and suppresses hepatosteatosis. Our data reveal a lipid-mediated endocrine network and demonstrate that adipose tissue uses lipokines such as C16:1n7-palmitoleate to communicate with distant organs and regulate systemic metabolic homeostasis. Author Affiliation: (1) Department of Genetics and Complex Diseases, Harvard School of Public Health, Boston, MA 02115, USA (2) Lipomics Technologies, West Sacramento, CA 95691, USA Article History: Received 18 December 2007; Revised 5 June 2008; Accepted 22 July 2008 Article Note: (miscellaneous) Published: September 18, 2008

Author(s): Gökhan S. Hotamisligil [1] The incidence of obesity worldwide has increased drastically during recent decades. Consequently, obesity and associated disorders now constitute a serious threat to the current and [...]

The adipocyte fatty acid-binding protein aP2 regulates systemic glucose and lipid metabolism. We report that aP2, in addition to being abundantly expressed by adipocytes, is also expressed by human airway [...]

The c-Jun N-terminal kinases (JNKs) are key regulators of inflammation and interfere with insulin action in cultured cells and whole animals. Obesity increases total JNK activity, and JNK1, but not JNK2, deficiency results in reduced adiposity and improved insulin sensitivity. Interestingly, a higher-than-normal level of JNK activation is observed in Jnk[2.sup.-/-] mice, particularly in the liver, indicating an interaction between the isoforms that might have masked the metabolic activity of JNK2 in isolated mutant mice. To address the role of the JNK2 isoform in metabolic homeostasis, we intercrossed Jnk[1.sup.-/-] and Jnk[2.sup.-/-] mice and examined body weight and glucose metabolism in the resulting mutant allele combinations. Among all of the viable genotypes examined, we observed only reduced body weight and increased insulin sensitivity in Jnk[1.sup.-/-] and Jnk[1+/-] Jnk[2.sup.-/-] mice. These two groups of mice also exhibited reduced total JNK activity and cytokine expression in liver tissue compared with all other genotypes examined. These data indicate that the JNK2 isoform is also involved in metabolic regulation, but its function is not obvious when JNK1 is fully expressed because of regulatory crosstalk between the two isoforms. diabetes | fatty liver | metabolic syndrome | inflammation | stress

Obesity contributes to the development of type 2 diabetes, but the underlying mechanisms are poorly understood. Using cell culture and mouse models, we show that obesity causes endoplasmic reticulum (ER) stress. This stress in turn leads to suppression of insulin receptor signaling through hyperactivation of c-Jun N-terminal kinase (JNK) and subsequent serine phosphorylation of insulin receptor substrate-1 (IRS-1). Mice deficient in X-box-binding protein-1 (XBP-1), a transcription factor that modulates the ER stress response, develop insulin resistance. These findings demonstrate that ER stress is a central feature of peripheral insulin resistance and type 2 diabetes at the molecular, cellular, and organismal levels. Pharmacologic manipulation of this pathway may offer novel opportunities for treating these common diseases., The cluster of pathologies known as metabolic syndrome, including obesity, insulin resistance, type 2 diabetes, and cardiovascular disease, has become one of the most serious threats to human health. The [...]

Fatty acid binding proteins (FABPs) are members of a highly conserved family of proteins with the task of protecting a cell's delicate lipid balance. Yet they fail when faced with metabolic or inflammatory stress, turning the cytosol into an inhospitable environment with less than ideal outcomes. This review will focus on how FABPs direct lipid traffic and simultaneously control inflammatory and metabolic pathways under the pressures of the Metabolic Syndrome. KEY WORDS: * fatty acid binding protein (FABP) * Metabolic Syndrome * inflammation * obesity * insulin resistance

The association of plasma adiponectin concentrations with the risk of is argued. The relationship is explained through differences in blood lipids, lack of inflammation and glycemic status.

The adipocyte fatty-acid-binding protein, aP2, has an important role in regulating systemic insulin resistance and lipid metabolism. Here we demonstrate that aP2 is also expressed in macrophages, has a significant role in their biological responses and contributes to the development of atherosclerosis. Apolipoprotein E (ApoE)-deficient mice also deficient for aP2 showed protection from atherosclerosis in the absence of significant differences in serum lipids or insulin sensitivity. aP2-deficient macrophages showed alterations in inflammatory cytokine production and a reduced ability to accumulate cholesterol esters when exposed to modified lipoproteins. Apoe[sup.-/-] mice with Ap2[sup.+/+] adipocytes and Ap2[sup.-/-] macrophages generated by bone-marrow transplantation showed a comparable reduction in atherosclerotic lesions to those with total aP2 deficiency, indicating an independent role for macrophage aP2 in atherogenesis. Through its distinct actions in adipocytes and macrophages, aP2 provides a link between features of the metabolic syndrome and could be a new therapeutic target for the prevention of atherosclerosis., Author(s): Liza Makowski [1, 7]; Jeffrey B. Boord [2, 7]; Kazuhisa Maeda [1]; Vladimir R. Babaev [2]; K. Teoman Uysal [1]; Maureen A. Morgan [5]; Rex A. Parker [5]; Jill [...]

Obesity is associated with a cluster of abnormalities, including hypertension, insulin resistance, hyperinsulinemia, and elevated levels of both plasminogen activator inhibitor 1 (PAI-1) and transforming growth factor [Beta] (TGF-[Beta]). Although these changes may increase the risk for accelerated atherosclerosis and fatal myocardial infarction, the underlying molecular mechanisms remain to be defined. Although tumor necrosis factor [Alpha] (TNF-[Alpha]) has been implicated in the insulin resistance associated with obesity, its role in other disorders of obesity is largely unknown. In this report, we show that in obese (ob/ob) mice, neutralization of TNF-[Alpha] or deletion of both TNF receptors (TNFRs) results in significantly reduced levels of plasma PAI-1 antigen, plasma insulin, and adipose tissue PAI-1 and TGF-[Beta] mRNAs. Studies in which exogenous TNF-[Alpha] was infused into lean mice lacking individual TNFRs indicate that TNF-[Alpha] signaling of PAI-1 in adipose tissue can be mediated by either the p55 or the p75 TNFR. However, TNF-[Alpha] signaling of TGF-[Beta] mRNA expression in adipose tissue is mediated exclusively via the p55 TNFR. Our results suggest that TNF-[Alpha] is a common link between the insulin resistance and elevated PAI-1 and TGF-[Beta] in obesity. The chronic elevation of TNF-[Alpha] in obesity thus may directly promote the development of the complex cardiovascular risk profile associated with this condition.

Metabolically driven, chronic, low-grade inflammation has a crucial role in the pathogenesis of obesity and type 2 diabetes, and multiple stress-signaling cascades link insulin resistance and the immune response. An approved immunomodulatory drug is now shown to inhibit the kinases IKKζ and TKB1, suppress inflammation and improve metabolic homeostasis in mouse models of obesity (pages 313-321)., Since the discovery 20 years ago that the proinflammatory cytokine tumor necrosis factor-α (TNF-α) is secreted from obese adipose tissue, an array of inflammatory mediators that are produced from various [...]

Obesity is the main risk factor linked to non-insulin-dependent diabetes mellitus. Tumour necrosis factor-alpha (TNF-alpha), which is over-expressed in the adipose tissue of mice and humans, is thought to be associated with insulin resistance. A study of obese mice with mutated TNF-alpha genes confirms that it is an important mediator of insulin resistance. The study reveals that the muscle and fat of mice without circulating TNF-alpha show large increases in insulin-sensitivity, regardless of whether the obesity is dietary or genetic.

Tumor necrosis factor-α (TNF-α) is an important mediator of insulin resistance in obesity and diabetes through its ability to decrease the tyrosine kinase activity of the insulin receptor (IR). Treatment of cultured murine adipocytes with TNF-α was shown to induce serine phosphorylation of insulin receptor substrate 1 (IRS-1) and convert IRS-1 into an inhibitor of the IR tyrosine kinase activity in vitro. Myeloid 32D cells, which lack endogenous IRS-1, were resistant to TNF-α-mediated inhibition of IR signaling, whereas transfected 32D cells that express IRS-1 were very sensitive to this effect of TNF-α. An inhibitory form of IRS-1 was observed in muscle and fat tissues from obese rats. These results indicate that TNF-α induces insulin resistance through an unexpected action of IRS-1 to attenuate insulin receptor signaling., Insulin resistance, a smaller than normal response to a given amount of insulin, is a common pathological state frequently associated with a number of diseases, including chronic infection, cancer, and [...]

To link to full-text access for this article, visit this link: http://dx.doi.org/10.1016/j.cell.2008.09.030 Byline: Ling Yang (1), Gokhan S. Hotamisligil (1) Abstract: Obesity is characterized by chronic activation of inflammatory pathways in peripheral tissues. In this issue, demonstrate that inflammation also occurs in the central nervous system where it disrupts activity of the hypothalamus leading to resistance to leptin that is mediated by activation of IKK and the endoplasmic reticulum stress response. Author Affiliation: (1) Harvard School of Public Health, Department of Genetics and Complex Diseases, Boston, MA 02115, USA