Search

Skin toning creams and turmeric powders are widely used among Bangladeshi fashion and beauty concerned women and young girls in general. However, it has been reported that excessive use of skin toning cream and turmeric powder can cause various dermatological problems, including skin cancer. These creams and turmeric powder contain a wide variety of active ingredients, including Hydroquinone (HQ), Mercury (Hg), and Lead (Pb), that are toxic, and hazardous to health, especially after prolonged application. As a result, in the current study, we tried to assess HQ and Hg level in commonly used skin toning creams and Pb in turmeric powder in the context of Bangladeshi women collected from the local markets in Dhaka city. HQ, Hg, and Pb levels were analyzed for 40 different Bangladeshi skin toning cream products and 40 different turmeric powder samples. The HQ level was determined by the high-performance liquid chromatography (HPLC) method, the Hg level was determined by Cold Vapor Atomic Absorption Spectrophotometry (CV-AAS) using an automatic mercury analyzer, and Pb was measured by the flame atomic absorption spectrometry method. Among the 40 samples, 23 samples (57.5%) did not contain HQ, whereas 17 samples (42.5%) contained a high level of HQ compared to the standard limit. In the case of Hg analysis, we found that 28 (70%) out of 40 samples complied with the standard level of Hg, whereas 12 samples (30%) contained a higher level of Hg compared to the standard limit. Among the 40 samples of turmeric powder, 20 samples (50%) complied with the standard level of Pb, whereas 20 samples (50%) contained a high level of Pb compared to the standard limit. After three and six months of storage, we had similar results in all the samples for the three cases. After combining HQ and Hg data sets, we found that 14 (35%) out of the 40 samples had HQ and Hg levels within the standard limit, and 3 samples (7.5%) had higher quantities of both HQ and Hg levels and did not comply with the standard limit. 14 samples (35%) in the data set had higher HQ levels but complied only with the standard Hg level, whereas 9 samples (22.5%) had higher Hg levels and thus complied only with the standard HQ level. So, in 65% of the samples, we found the presence of excess level of either both HQ and Hg at the same time or any one of the measured chemical parameters. The use of these creams and turmeric powders, which did not comply with the standard limit, may pose a serious health risk to consumers. So, consumers should be aware of the risks associated with using these creams and turmeric powders, and policymakers should take appropriate measures to prevent the manufacturing and marketing of skin toning creams containing high levels of HQ and Hg and turmeric powder with high levels of Pb. Bioresearch Commu. 8(2): 1132-1142, 2022 (July)

Partner and Localizer of BRCA2 or PALB2 is a typical tumor suppressor protein, that responds to DNA double stranded breaks through homologous recombination repair. Heterozygous mutations in PALB2 are known to contribute to the susceptibility of breast and ovarian cancer. However, there is no comprehensive study characterizing the structural and functional impacts of SNPs located in the PALB2 gene.Therefore, it is of interest to document a comprehensive analysis of coding and non-coding SNPs located at the PALB2 loci using in silico tools. The data for 1455 non-synonymous SNPs (nsSNPs) located in the PALB2 loci were retrieved from the dbSNP database. Comprehensive characterization of the SNPs using a combination of in silico tools such as SIFT, PROVEAN, PolyPhen, PANTHER, PhDSNP, Pmut, MutPred 2.0 and SNAP-2, identified 28 functionally important SNPs. Among these, 16 nsSNPs were further selected for structural analysis using conservation profile and protein stability. The most deleterious nsSNPs were documented within the WD40 domain of PALB2. A general outline of the structural consequences of each variant was developed using the HOPE project data. These 16 mutant structures were further modelled using SWISS Model and three most damaging mutant models (rs78179744, rs180177123 and rs45525135) were identified. The non-coding SNPs in the 3’ UTR region of the PALB2 gene were analyzed for altered miRNA target sites. The comprehensive characterization of the coding and non-coding SNPs in the PALB2 locus has provided a list of damaging SNPs with potential disease association. Further validation through genetic association study will reveal their clinical significance.

Background: The liver function tests (LFTs) remain one of the most commonly employed clinical measures for the diagnosis of hepatobiliary disease. LFTs sometimes referred to as hepatic panel help to determine the health of liver, monitor the progression of a disease and measure the severity of a disease particularly scarring or cirrhosis of the liver. Aims: In this study, we present a new approach to evaluate the natural progression of liver disease through the assessment of eight biochemical parameters: serum total bilirubin (TB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), Alkaline phosphatase (ALP), total protein (TP), albumin (ALB), albumin/globulin (A/G) ratio, and alpha-fetoprotein (AFP) as well as two machine learning (ML) tools—Random Forest and CART to substantive the outcome. Methods: The study was carried out in a total of 100 subjects which included healthy controls (group I-25 patients), patients with acute hepatitis (group II-25 patients), chronic hepatitis (group III-25 patients) and hepatocellular carcinoma (group IV-25 patients) applying both biochemical and Machine Learning methods. Results: Of the eight parameters tested, all except ALP (p = 0.426), showed an overall discriminatory ability as judged by one-factor analysis of variance (p Conclusion: Acute hepatitis (group II) shows a higher level of AST, ALT and ALP compared to chronic hepatitis (group III) and hepatocellular carcinoma (group IV). Two machine learning algorithms also predicted and supported the same biochemical results by correctly classifying liver disease patients. We also recommend that the AFP test can be performed if hepatocellular carcinoma is suspected.

PLCG1 gene is responsible for many T-cell lymphoma subtypes, including peripheral T-cell lymphoma (PTCL), angioimmunoblastic T-cell lymphoma (AITL), cutaneous T-cell lymphoma (CTCL), adult T-cell leukemia/lymphoma along with other diseases. Missense mutations of this gene have already been found in patients of CTCL and AITL. The non-synonymous single nucleotide polymorphisms (nsSNPs) can alter the protein structure as well as its functions. In this study, probable deleterious and disease-related nsSNPs in PLCG1 were identified using SIFT, PROVEAN, PolyPhen-2, PhD-SNP, Pmut, and SNPS&GO tools. Further, their effect on protein stability was checked along with conservation and solvent accessibility analysis by I-mutant 2.0, MUpro, Consurf, and Netsurf 2.0 server. Some SNPs were finalized for structural analysis with PyMol and BIOVIA discovery studio visualizer. Out of the 16 nsSNPs which were found to be deleterious, ten nsSNPs had an effect on protein stability, and six mutations (L411P, R355C, G493D, R1158H, A401V and L455F) were predicted to be highly conserved. Among the six highly conserved mutations, four nsSNPs (R355C, A401V, L411P and L455F) were part of the catalytic domain. L411P, L455F and G493D made significant structural change in the protein structure. Two mutations-Y210C and R1158H had post-translational modification. In the 5’ and 3’ untranslated region, three SNPs, rs139043247, rs543804707, and rs62621919 showed possible miRNA target sites and DNA binding sites. This in silico analysis has provided a structured dataset of PLCG1 gene for further in vivo researches. With the limitation of computational study, it can still prove to be an asset for the identification and treatment of multiple diseases associated with the target gene.

Background ß-thalassemia is one of the most common inherited blood disorders in the world and a major deterrent to the public health of Bangladesh. The management of thalassemia patients requires lifelong frequent blood transfusion and the available treatment options are unsatisfactory. A national policy on thalassemia prevention is mandatory in Bangladesh. However, precise and up-to-date information on the frequency of ß-thalassemia carriers are missing due to lack of accurate diagnostic approaches, limited access to information and absence of national screening program. This study aims to determine the nationwide carrier frequency of hemoglobin E (HbE) and β- thalassemia and mutation spectrum among the carriers using molecular, hematological and biochemical methods. Methods The study enrolled a total of 1877 individuals (60.1% male and 39.9% female) aged between 18 and 35 years. Total sample size and its division-wise breakdown were calculated in proportion to national and division-wise population. Venous blood was collected and subjected to CBC analysis and Hb-electrophoresis for each participant. Serum ferritin was measured to detect coexistence of iron deficiency anemia with thalassemia carrier. DNA-based High Resolution Melting (HRM) curve analysis was performed for confirmation of carrier status by mutation detection. Results Of 11.89% (95% CI, 10.43–13.35) carriers of β-globin gene mutations, 8.68% (95% CI, 7.41–9.95) had HbE trait (ETT) and 2.24% (95% CI, 1.57–2.91) had beta-thalassemia trait (BTT). Among eight divisions, Rangpur had the highest carrier frequency of 27.1% (ETT-25%, BTT-2.1%), whereas Khulna had the lowest frequency of 4.2% (ETT-4.2% only). Moreover, α- thalassemia, HbD trait, HbE disease, hereditary persistence of HbF were detected in 0.11, 0.16, 0.43 and 0.16% participants, respectively. HRM could identify two individuals with reported pathogenic mutations in both alleles who were erroneously interpreted as carriers by hematological indices. Finally, a total of nine different mutations including a novel mutation (c.151A > G) were detected in the β-globin gene. Conclusions Since carrier frequency for both HbE and β-thalassemia is alarmingly high in Bangladesh, a nationwide awareness and prevention program should be made mandatory to halt the current deteriorating situations. Mutation-based confirmation is highly recommended for the inconclusive cases with conventional carrier screening methods to avoid any faulty detection of thalassemia carriers.

In Bangladesh, the poultry products are now severely contaminated with toxic heavy metals from different means including natural and man-made pollutions. Interestingly, poultry-based fast foods, which have a quicker preparation time, low price, good taste and easy availability, are very famous among people of all ages. Therefore, burger, sandwich, samosa, shingara, sauce, and noodles were analyzed for the detection of Lead (Pb), Chromium (Cr), Cadmium (Cd), Arsenic (As) and Nickel (Ni) by graphite furnace atomic absorption spectrometry. It has been found that chicken burger contains the highest concentration of Pb (1.14 mg/kg fresh weight), Ni (0.31 mg/kg fw), and As (0.28 mg/kg fw). On the other hand, the highest concentration of Cr (0.101 mg/kg fw) and Cd (0.04 mg/kg fw) was found in the sauce. Unfortunately, all the examined foods contained the heavy metals to an extent that crosses the safety level for human consumption set by different international public health agencies like WHO. Moreover, evaluation of poultry feeds showed high amounts of Pb (range 1.40–6.59 mg/kg fw), which exceeds the safety level set by WHO (0.5 mg/kg). When Pb containing poultry feed was supplied to the chicks and sacrificed after 6 months, Pb was found in all the tissues examined that cross the safety limit. Afterwards, burgers were made from these chickens and high amount of Pb was observed in those burgers too. All these results showed that heavy metals from different sources could make access to the human food chain and impose an immense health risk.

Lassa virus (LASV) is an arena virus causing hemorrhagic fever and it is endemic in several regions of West Africa. The disease-causing virus records high mortality rate in endemic regions due to lack of appropriate treatment and prevention strategies. Therefore, it is of interest to design and develop viable vaccine components against the virus. We used the Lassa virus envelope glyco-proteins as a vaccine target to identify linear peptides as potential epitopes with immunogenic properties by computer aided epitope prediction tools. We report a T-cell epitope 'LLGTFTWTL' and a B-cell epitope 'AELKCFGNTAVAKCNE' with predicted potential immunogenicity for further in vivo and in vitro consideration.

Bangladesh, although being a small country, contains more than 5000 floral species of which around 1500 are now recognized to be used as medicinal plants. Such plants are used in the classical formats of traditional medicine like Ayurveda, Unani, and homeopathy; and by folk medicinal practitioners, folk herbalists, and tribal medicinal practitioners; and in home remedies. Since these plants have a history of usage dating back at least 3500 years ago, the plants present a potentially rich source for the discovery of lead compounds and novel drugs. This is important because changes in lifestyle (leading to disorders like metabolic syndrome, diabetes, and hypertension) and emergence of new diseases and drug-resistant vectors are causing a dire necessity for discovery of new drugs. A number of plants of Bangladesh have already been recognized to contain compounds of therapeutic importance. These include curcumin from Curcuma longa, withanolide from Withania somnifera, arjunolic acid from Terminalia arjuna, reserpine from Rauwolfia serpentina, and vincristine and vinblastine from Catharanthus roseus, to name only a few. This review will attempt to explore the drug discovery potential of some anti-diarrheal medicinal plants of Bangladesh based on their reported pharmacological activities and known phytochemicals. Diarrhea is extremely common in Bangladesh, particularly in rural children, rotavirus being one of the main causative agents. Where possible, we will use molecular docking studies to determine the possible efficacy of a given phytochemical against a target rotavirus protein.

Philadelphia (Ph) chromosome or the BCR-ABL fusion gene is used to diagnose, determine treatment strategy of chronic myelogenic leukemia (CML) and acute lymphoblastic leukemia (ALL). The fusion gene transcript may vary depending on the reciprocal translocation between chromosome 9 and 22. Hence, identification and characterization of the BCR-ABL transcripts are important for the treatment and management of leukemia patients. In this study, a primer set and clinical molecular diagnosis assay were established to identify the BCR-ABL transcripts by conventional polymerase chain reaction (PCR). A parallel analysis was done for quantitative real-time polymerase chain reaction (Q-PCR) and conventional PCR. This study is based on reverse transcriptase PCR (RT-PCR) of 87 CML patients’ RNA to generate total cDNAs and the selection of the BCR-ABL transcripts by conventional polymerase chain reaction using specific primer set. A BCR primer BCR-e12: GCAGAGTGGAGGGAGAACAT and a reverse ABL primer ABL-a3: GCTTCACACCATTCCCCATT was established to select three different Philadelphia major transcripts (b3a2, b2a2 and b3a3). Sixty-one Philadelphia positive samples (35 b3a2, 22 b2a2 and 4 b3a3 fragments) were detected out of 87 CML patients. Q-RT-PCR was then performed, and ten discrepancies were found in the study. Four samples found positive in conventional PCR resulted negative in Q-PCR and other six samples (positive in Q-PCR) gave the negative result in conventional PCR. Though Q-PCR is quantitative and highly specific, it is expensive and can’t characterize BCR-ABL fragments. On the other hand, conventional PCR is less reliable but is inexpensive and helpful for characterization of the target fusion gene. Performing both Q-PCR and conventional PCR can detect each and every positive case of CML as well as give no false positive or false negative result.

Different mutations in the beta-globin gene impose clinical heterogeneity in the affected individuals, such as patients with Hb E disease are asymptomatic and non-transfusion-dependent. Conversely, the transfusion-dependent patients with EBT require blood transfusion with varying degrees of transfusion intervals among individuals; whereas the patients with beta-thalassemia major (BTM) must require blood transfusion with chelation therapy. Different mutations are expected to affect red blood cell (RBC) volume and size differently as they impose different levels of heterogeneity. Thus, this present study focused to associate red blood cell distribution width (RDW) with different disease states of beta-globin gene. Accordingly, 31 patients with BTM, 73 transfusion-dependent patients with EBT, and 40 healthy controls were recruited. Hematological indices revealed higher RDWs in both BTM and EBT patients compared to controls. Hematological indices and genetic analysis revealed irrespective of mutational status EBT patients had higher RDWs compared to patients with BTM. Moreover, analysis of EBT patients with different transfusion intervals revealed patients who need blood transfusion less frequently had highest RDW values implying diverse population of microcytic RBCs play an important role in heterogeneous disease manifestations. In conclusion, the RDW has an association with different disease manifestations involving the beta-globin gene mutations.

Although thyroid dyshormonogenesis (TDH) accounts for 10-20% of congenital hypothyroidism (CH), the molecular etiology of TDH is unknown in Bangladesh. Thyroid peroxidase (TPO) is most frequently associated with TDH and the present study investigated the spectrum of TPO mutations in Bangladeshi patients and analyzed the effects of mutations on TPO protein structure through in silico approach. Sequencing-based analysis of TPO gene revealed four mutations in 36 diagnosed patients with TDH including three nonsynonymous mutations, namely, p.Ala373Ser, p.Ser398Thr, and p.Thr725Pro, and one synonymous mutation p.Pro715Pro. Homology modelling-based analysis of predicted structures of MPO-like domain (TPO142-738) and the full-length TPO protein (TPO1-933) revealed differences between mutant and wild type structures. Molecular docking studies were performed between predicted structures and heme. TPO1-933 predicted structure showed more reliable results in terms of interactions with the heme prosthetic group as the binding energies were -11.5 kcal/mol, -3.2 kcal/mol, -11.5 kcal/mol, and -7.9 kcal/mol for WT, p.Ala373Ser, p.Ser398Thr, and p.Thr725Pro, respectively, implying that p.Ala373Ser and p.Thr725Pro mutations were more damaging than p.Ser398Thr. However, for the TPO142-738 predicted structures, the binding energies were -11.9 kcal/mol, -10.8 kcal/mol, -2.5 kcal/mol, and -5.3 kcal/mol for the wild type protein, mutant proteins with p.Ala373Ser, p.Ser398Thr, and p.Thr725Pro substitutions, respectively. However, when the interactions between the crucial residues including residues His239, Arg396, Glu399, and His494 of TPO protein and heme were taken into consideration using both TPO1-933 and TPO142-738 predicted structures, it appeared that p.Ala373Ser and p.Thr725Pro could affect the interactions more severely than the p.Ser398Thr. Validation of the molecular docking results was performed by computer simulation in terms of quantum mechanics/molecular mechanics (QM/MM) and molecular dynamics (MD) simulation. In conclusion, the substitutions mutations, namely, p.Ala373Ser, p.Ser398Thr, and p.Thr725Pro, had been involved in Bangladeshi patients with TDH and molecular docking-based study revealed that these mutations had damaging effect on the TPO protein activity.

Lead exposure can damage cells directly by effecting DNA or indirectly by modifying proteins and enzymes. In Bangladesh, many working children are exposed to a very high level of lead during their early life due to their involvement with lead-oriented professions. This imposes a severe threat to the growth and development of the children. Therefore to study the effect of lead, we enrolled 60 age-matched male children, from an area of old Dhaka city, where battery-recycling shops are located, depending on their blood lead concentration. If the children had a plasma lead concentration above the WHO recommended threshold level of 10 µg/dl, we grouped them as test subjects and others as control subjects to determine the effect of lead on different biochemical parameters of the body. Compared to the controls, acculumlation of the lipid peroxidation product, malondialdehyde, increased significantly in test subjects ( p < 0.01). Lead exposure also increased the protein carbonyl content ( p < 0.05) and significantly decreased the plasma glutathione levels of test subjects compared to the controls ( p < 0.05). While comparing the lead-exposed group against controls, it was found that the percentage of damaged DNA, as measured using the Comet assay, significantly increased in tail ( p < 0.01) and decreased in head regions. All of these results suggest that high-plasma lead content may induce an oxidative stress to the study population, which may lead to DNA damage.

Foods (natural or processed) containing known biologically active compounds, which supplies clinically established and well-documented health benefits, are termed as functional food. Study objectives were to boost food functionality of spirulina, to optimize the required radiation dose, and to test functionality of spirulina both in vitro and in vivo. For this purpose fat binding capacity, sugar binding capacity, hydration property, antioxidative property, total polyphenol content were assessed at different radiation doses. A total of 30 rats were divided into three groups to carry out in vivo experiments to validate the outcomes of in vitro experiments. Targeted physico-chemical properties of spirulina were increased at their maximum level at 15 kGy radiation dose. In vivo experiments validated the outcomes of in vitro experiments. Though gamma radiation improves food functionality of spirulina at various radiation doses, but the optimum dose is recommended as 15 kGy.

Various cancers including skin cancer are increasing in 45 million people exposed to arsenic above the World Health Organization's guideline value of 10 μg l -1 . However, there is limited information on key molecules regulating arsenic-mediated carcinogenesis. Our fieldwork in Bangladesh demonstrated that levels of placental growth factor (PlGF) in urine samples from residents of cancer-prone areas with arsenic-polluted drinking water were higher than those in urine samples from residents of an area that was not polluted with arsenic. Our experimental study in human nontumorigenic HaCaT skin keratinocytes showed that arsenite promoted anchorage-independent growth with increased expression and secretion of PlGF, a ligand of vascular endothelial growth factor receptor1 (VEGFR1), and increased VEGFR1/mitogen-activated protein kinase/ERK kinase (MEK)/extracellular signal–regulated kinase (ERK) activities. The arsenite-mediated promotion of anchorage-independent growth was strongly inhibited by PlGF depletion with decreased activities of the PlGF/VEGFR1/MEK/ERK pathway. Moreover, arsenite proteasome-dependently degrades metal-regulatory transcription factor-1 (MTF-1) protein, resulting in a decreased amount of MTF-1 protein binding to the PlGF promoter. MTF-1 negatively controlled PlGF transcription in HaCaT cells, resulting in increased PlGF transcription. These results suggest that arsenite-mediated MTF-1 degradation enhances the activity of PlGF/VEGFR1/MEK/ERK signaling, resulting in promotion of the malignant transformation of keratinocytes. Thus, this study proposed a molecular mechanism for arsenite-mediated development of skin cancer.

Sickle cell anemia is defined as homozygosity caused by the mutation of the glutamic acid residue to valine in the β-globin gene. Sickle cell disease is an increasing global health burden with the estimated number of patients increasing in a concerning manner. Here we report a very interesting and clinically insightful case of hemoglobinopathy which was initially suspected to be Hb S/D Punjab- a rare type of hemoglobinopathy as diagnosed by the hemoglobinelectrophoresis technique. Despite the diagnosis report indicating the rare Hb S/D Punjab, the uncharacteristic clinical presentation of the patient which was not coherent with the classical symptoms of Hb S/D Punjab, forced the clinicians to turn their attention to molecular diagnosis. To clarify the etiology of the clinical case, a sequencing-based molecular diagnosis approach was adopted that revealed the mutational signature of sickle cell anemia (SCA). This case can be regarded as a prominent example where the molecular techniques lead to the correct diagnosis matching with the clinical symptoms while the conventional diagnostic approach failed.

The acquisition of cancer hallmarks requires molecular alterations at multiple levels including genome, epigenome, transcriptome, proteome, and metabolome. In the past decade, numerous attempts have been made to untangle the molecular mechanisms of carcinogenesis involving single OMICS approaches such as scanning the genome for cancer-specific mutations and identifying altered epigenetic-landscapes within cancer cells or by exploring the differential expression of mRNA and protein through transcriptomics and proteomics techniques, respectively. While these single-level OMICS approaches have contributed towards the identification of cancer-specific mutations, epigenetic alterations, and molecular subtyping of tumors based on gene/protein-expression, they lack the resolving-power to establish the casual relationship between molecular signatures and the phenotypic manifestation of cancer hallmarks. In contrast, the multi-OMICS approaches involving the interrogation of the cancer cells/tissues in multiple dimensions have the potential to uncover the intricate molecular mechanism underlying different phenotypic manifestations of cancer hallmarks such as metastasis and angiogenesis. Moreover, multi-OMICS approaches can be used to dissect the cellular response to chemo- or immunotherapy as well as discover molecular candidates with diagnostic/prognostic value. In this review, we focused on the applications of different multi-OMICS approaches in the field of cancer research and discussed how these approaches are shaping the field of personalized oncomedicine. We have highlighted pioneering studies from “The Cancer Genome Atlas (TCGA)” consortium encompassing integrated OMICS analysis of over 11,000 tumors from 33 most prevalent forms of cancer. Accumulation of huge cancer-specific multi-OMICS data in repositories like TCGA provides a unique opportunity for the systems biology approach to tackle the complexity of cancer cells through the unification of experimental data and computational/mathematical models. In future, systems biology based approach is likely to predict the phenotypic changes of cancer cells upon chemo-/immunotherapy treatment. This review is sought to encourage investigators to bring these different approaches together for interrogating cancer at molecular, cellular, and systems levels.

not available DOI: http://dx.doi.org/10.3329/dujps.v13i2.21904 Dhaka Univ. J. Pharm. Sci. 13(2): 221-224, 2014 (December)

Cardiovascular disease is one of many reverberating ailments that affect and kill hundreds of thousands of people around the world. To date treatments that offer improvement in the health condition of diseased people include the most promising nanomedicine although it is in its infancy, yet attaining attention from researchers of top notch day by day. In this current review importance is given on the application of nanomedicine in the diagnosis as well as treatment of cardiovascular disease.

This study aims to design epitope-based peptides for the utility of vaccine development by targeting outer membrane protein F (Omp F), because two available licensed vaccines, live oral Ty21a and injectable polysaccharide, are 50% to 80% protective with a higher rate of side effects. Conventional vaccines take longer time for development and have less differentiation power between vaccinated and infected cells. On the other hand, Peptide-based vaccines present few advantages over other vaccines, such as stability of peptide, ease to manufacture, better storage, avoidance of infectious agents during manufacture, and different molecules can be linked with peptides to enhance their immunogenicity. Omp F is highly conserved and facilitates attachment and fusion of Salmonella typhi with host cells. Using various databases and tools, immune parameters of conserved sequences from Omp F of different isolates of Salmonella typhi were tested to predict probable epitopes. Binding analysis of the peptides with MHC molecules, epitopes conservancy, population coverage, and linear B cell epitope prediction were analyzed. Among all those predicted peptides, ESYTDMAPY epitope interacted with six MHC alleles and it shows highest amount of interaction compared to others. The cumulative population coverage for these epitopes as vaccine candidates was approximately 70%. Structural analysis suggested that epitope ESYTDMAPY fitted well into the epitope-binding groove of HLA-C*12:03, as this HLA molecule was common which interact with each and every predicted epitopes. So, this potential epitope may be linked with other molecules to enhance its immunogenicity and used for vaccine development.

The new age of cytopathology: applications of maldi imaging and super-resolution microscopy

Rice is a fundamental food in many cultural cuisines around the world, and it is an important cereal crop that feeds more than half of the world's population. The two main categories are white rice and whole grain rice or bow ice. Whole grain rice is not processed very much, so it is high in nutritional value, whereas white rice is processed so that the bran or outer covering is removed, leaving it with less nutritional value. People choose different styles of rice for particular flavors, depending on their culinary needs, the availability, and the potential for healthy benefits as well.

Functional food can be either natural or processed. Food contains known biologically active compounds, which provides clinically proven and documented health benefit. So far, no database is available in Bangladesh regarding the functionality of the indigenous foods. As a primary step, this study had been conducted with an aim to identify and characterize functionality of the indigenous foods of Bangladesh. Eight fruits and vegetables, which are very popular for their taste, price and easy availability, have been selected for in vitro screening of their functionality. High levels of fat and sugar binding capacity were observed in Pineapple (500% and 270.891% respectively). High nuplli mortality rate was found in cytotoxicity test with Pomelo extract (100%), which also contained high level of vitamin C (155 mg/100g). Pomelo contained the highest level of antioxidant among all these foods (0.674 nMol/100μl/mg protein). Red amaranth contained highest amount of protein (4.31 g/100g). In stem amaranth, Iron level was highest (1855.67 mg/kg). Total phenolics content of Water spinach and Stem amaranth were found higher than the other samples (59.339 and 55.728 mg GAE/g respectively). All these experiments showed these vegetables and fruits have high health impacts and can be act as potential functional foods.

Our fieldwork showed more than 1 μM (145.1 μg/L) barium in about 3 μM (210.7 μg/L) arsenic-polluted drinking well water (n = 72) in cancer-prone areas in Bangladesh, while the mean concentrations of nine other elements in the water were less than 3 μg/L. The types of cancer include squamous cell carcinomas (SCC). We hypothesized that barium modulates arsenic-mediated biological effects, and we examined the effect of barium (1 μM) on arsenic (3 μM)-mediated apoptotic cell death of human HSC-5 and A431 SCC cells in vitro. Arsenic promoted SCC apoptosis with increased reactive oxygen species (ROS) production and JNK1/2 and caspase-3 activation (apoptotic pathway). In contrast, arsenic also inhibited SCC apoptosis with increased NF-κB activity and X-linked inhibitor of apoptosis protein (XIAP) expression level and decreased JNK activity (antiapoptotic pathway). These results suggest that arsenic bidirectionally promotes apoptotic and antiapoptotic pathways in SCC cells. Interestingly, barium in the presence of arsenic increased NF-κB activity and XIAP expression and decreased JNK activity without affecting ROS production, resulting in the inhibition of the arsenic-mediated apoptotic pathway. Since the anticancer effect of arsenic is mainly dependent on cancer apoptosis, barium-mediated inhibition of arsenic-induced apoptosis may promote progression of SCC in patients in Bangladesh who keep drinking barium and arsenic-polluted water after the development of cancer. Thus, we newly showed that barium in the presence of arsenic might inhibit arsenic-mediated cancer apoptosis with the modulation of the balance between arsenic-mediated promotive and suppressive apoptotic pathways.

Redox degenerative reactions of the biological system inevitably produce reactive oxygen species (ROS) and their derivatives. Oxidative stress is the result of an imbalance in pro-oxidant/antioxidant homeostasis that leads to the generation of toxic reactive oxygen species (ROS), such as hydrogen peroxide, organic hydro peroxides, nitric oxide, superoxide and hydroxyl radicals etc. Information are accumulating steadily, supporting the general importance of oxidative damage of tissue and cellular components as a primary or secondary causative factor in many different human diseases and aging processes. Many of the recent landmarks in scientific research have shown that in human beings, oxidative stress has been implicated in the progression of major health problems by inactivating the metabolic enzymes and damaging important cellular components, oxidizing the nucleic acids, leading to cardiovascular diseases, eye disorders, joint disorders, neurological diseases (Alzheimer’s disease, Parkinson’s disease and amyotrophic lateral sclerosis), atherosclerosis, lung and kidney disorders, liver and pancreatic diseases, cancer, ageing, disease of the reproductive system including the male and female infertility etc. The advent of a growing number of in vitro and in vivo models for evaluating the human disease pathology is aiding scientists in deciphering the detailed mechanisms of the point of intersection of the oxidative stress with other cellular components or events in the growing roadmap leading to different human disorders. The toxic effect of reactive oxygen and nitrogen species in human is balanced by the antioxidant action of non-enzymatic antioxidants, as well as by antioxidant enzymes. Such antioxidant defences are extremely important as they represent the direct removal of free radicals (prooxidants), thus providing maximal protection for biological sites. These systems not only assert with the problem of oxidative damage, but also play a crucial role in wellness, health maintenance, and prevention of chronic and degenerative diseases. In this review we have tried to generate a gross picture on the critical role of ROS in deteriorating human health and the importance of antioxidative defense system in ameliorating the toxicity of ROS.

Toxic elements present in well water that is used for drinking pose a threat to the human health in many countries. However, there are few reports on the toxic elements in well water in Malaysia. Since a native doctor informed us about the increasing number of patients with depigmented skin (vitiligo) in Rosob Village, Sabah State, Malaysia, the origin of diseases associated with well water was suspected. Thus, the concentrations of 15 toxic elements in 52 well water samples from Rosob (n = 21), and the control areas of Pitas (n = 8) and Telaga (n = 23) within the same state were measured. No toxic elements with levels exceeding that of the WHO health-based guidelines were detected in the well water samples from Pitas and Telaga. On the other hand, the concentration levels of arsenic (As), uranium (U), and manganese (Mn), independently found in 19% (4/21), 4.8% (1/21), and 19% (4/21), respectively, of the well water samples from Rosob, exceeded the levels given in the WHO health-based guidelines. In the w...

In this research, a highly volatile membrane forming solution of gelatin with quick membrane forming property (30 sec) was prepared to investigate the suitability of solution spray system in the treatment of wound at dermal surface. A nontoxic Aromatic Ketone (AK) and a highly volatile solvent (VS) were introduced in gelatin solution to ensure high volatility. The solution was subjected to antibiotic dosing using Ciprofloxacin to ensure its anti-infectiveness. The pH of the raw gelatin solution and the highly volatile gelatin solution were 4.95 and 6.17 respectively. Viscosity of gelatin/AK/VS solution was 62.12mPa.s. Wound healing characteristic of the highly volatile solution (gelatin/AK/VS) was evaluated using a rat (Rattus norvegicus) model. Full-thickness wounds were created on the ventral side of the Rattus norvegicus and were dressed with the volatile solution and “eco-plaster” (control). Wound healing and bioadhesion were monitored in 3-days interval. The results revealed that prepared volatile solution was more effective in preventing blood loss as well as healing wounds than the conventional wound dresser.

Background: Oxidative stress is intimately associated with many diseases, including β-thalassemia. Aim: The study was to estimate the status of respiratory burst enzymes, pro-oxidants, and antioxidants in β-thalassemia major patients in Bangladesh and to compare with apparently healthy individuals. Materials and Methods: A total of 49 subjects were recruited which included 25 patients (age range 5 to 40 years) with β-thalassemia major and 24 controls (age and sex matched). Superoxide dismutase (SOD) and catalase (CAT) represented respiratory burst enzymes; malondialdehyde (MDA), lipid hydroperoxide (LHP), and xanthine oxidase (XO) were measured as pro-oxidants; and glutathione S transferase (GST), vitamin C (Vit.C), and glutathione (GSH) were the measured antioxidants. Results: The activity of SOD was significantly (P < 0.001) increased by about 79% and the activity of CAT was significantly (P < 0.001) decreased by more than 34% in the blood of β-thalassemia major patients compared to the control group. The content of pro-oxidants such as MDA, LHP, and XO was significantly (P < 0.001) higher in patients by about 228%, 241.3% and 148.1% respectively compared to control group. The level of GSH and Vit.C were significantly (P = 0.000) decreased in patients by about 59% and 81% versus the healthy group, respectively; and GST activity was significantly (P < 0.001) declined by 44.25% in patients group. Conclusion: β-thalassemia major patients demonstrate raised oxidative stress compared to healthy subjects.

BMH1 and BMH2 encode Saccharomyces cerevisiae 14-3-3 homologues whose exact functions have remained unclear. The present work compares the transcriptomic and proteomic profiles of the wild type and a BMH1/2-deficient S. cerevisiae mutant (bmhDelta) using DNA microarrays and two-dimensional polyacrylamide gel electrophoresis. It is reported here that, although the global patterns of gene and protein expression are very similar between the two types of yeast cells, a subset of genes and proteins (a total of 220 genes) is significantly induced or reduced in the absence of Bmh1/2p. These genes include approximately 60 elements that could be linked to the reported phenotypes of the bmhDelta mutant (e.g., accumulation of glycogen and hypersensitivity to environmental stress) and/or could be the potential downstream targets of interacting partners of Bmh1/2p such as Msn2p and Rtg3p. Importantly,30% of the identified genes (71 genes) were found to be associated with carbon (C) and nitrogen (N) metabolism and transport, thereby suggesting that Bmh1/2p may play a major role in the regulation of C/N-responsive cellular processes. This study presents the first comprehensive overview of the genes and proteins that are affected by the depletion of Bmh1/2p and extends the scope of knowledge of the regulatory roles of Bmh1/2p in S. cerevisiae.