Search

Development of new plant protection strategies has become an urgent matter in modern agriculture, in view of the evidently proved negative effect of currently used active ingredients of pesticides. In recent years, much effort has been made to eliminate the use of pesticides established to be toxic to pollinators.In this study, we present a group of new bifunctional ionic liquids based on dodine (N-dodecylguanidine) cation whose physical and biological properties have been modified relative to those of the commercially available N-dodecylguanidine acetate. The decreased level of residue of active substances in plant tissues reduces their availability to pollinators, which increases the safety of their use. Moreover, lower environmental impact in combination with high antifungal activity and an additional biological function, that is the systemic acquired resistance induction, are in line with the goals of sustainable agriculture.The presented approach shows the possibility of derivatization of commonly used fungicide into the form of bifunctional salts whose physical and biological properties can be easily modified. The paper reports successful design and synthesis of new sustainable and green chemicals for the modern agriculture, being less toxic to the environment and human health but still effective against pathogens. © 2021 Society of Chemical Industry.

Viruses are thought to be the ultimate parasites, using host resources for multiplication. Interestingly, many viruses also have their own 'parasites', such as defective interfering RNAs (DI RNAs). One of the plant viruses whose infection can be accompanied by subviral RNAs is the Tomato black ring virus (TBRV). DI RNAs associated with the TBRV genome were generated de novo as a result of prolonged passages in one host. DI RNAs modulate the TBRV accumulation and the severity of the symptoms induced on the infected plants. In this study, we have addressed the question of whether DI RNAs can also affect TBRV vertical transmission through seeds. The experiments were conducted using the TBRV-Pi isolate and Chenopodium quinoa plants. C. quinoa plants were infected with TBRV-Pi with and without DI RNAs. Overall, 4 003 seeds were tested, and the analysis showed that the presence of DI RNAs made the TBRV-Pi seed transmission 44.76% more efficient. Moreover, for the first time, we showed that DI RNAs are being transferred from generation to generation., Supported by the National Science Center in Poland, Project Nos 2013/11/B/NZ9/02510 and 2017/25/B/NZ9/01715. Work in València was supported by the Spain Ministerio de Ciencia e Innovación – FEDER, Project No. BFU2015-65037-P.

One of the major problems in environmental industries is plant protection using ecologically and human friendly plant resistance inducers. To address this problem in an advantageous way, we used pl...

In Poland, a phytoplasma belonging to the subgroup 16SrI-B of ‘Ca. Phytoplasma asteris’ species causes disease in winter oilseed rape (Brassica napus), named rapeseed phyllody (RP). Affected plants exhibit malformations of flowers – phyllody, leading to losses in seed production. However, the potential sources of RP phytoplasma (RPp) outside oilseed rape are poorly understood. A screening survey of non-crop wild plants associated with winter oilseed rape was performed in order to identify alternative plant hosts of RPp. Nested polymerase chain reaction (PCR) and sequencing of PCR-amplified 16S rDNA fragments were employed for the detection and identification of phytoplasma strains affecting oilseed rape crops and adjacent wild plants. Phytoplasmas belonging to subgroups 16SrI-B, 16SrI-L, 16SrI-(B/L)L and 16SrI-C, as well as subgroup 16SrXII-H, were detected in non-crop plants. All investigated oilseed rapes manifesting RP disease were positive to ‘Ca. Phytoplasma asteris’ ribosomal subgroup 16SrI-B or heterogenic variant 16SrI-(B/L)L. Wild plants species were predominantly infected with the same phytoplasma subgroups as oilseed rapes. However, comparative sequence analysis revealed single nucleotide polymorphisms that indicate divergence of 16SrI-B and 16SrI-(B/L)L phytoplasma strains in non-crop species. Surprisingly, most of the weeds which tested positive for phytoplasma did not exhibit any characteristic symptoms of infection. In this study we identified for the first time perennial (Elymus repens, Lolium perenne) and annual (Echinochloa crus-galli, Polygonum aviculare, Viola arvensis, Matricaria perforata, Stelaria media) plants as asymptomatic reservoirs of RPp related strains in the winter oilseed rape agroecosystem. We also confirmed RPp related infections in diseased Apera spica-venti, Sisymbrium officinale, Matricaria discoidea, and Papaver rhoeas. These plants potentially play a significant role in RPp evolution and disease aetiology and epidemiology.

Open Access CAAS Agricultural Journals., Tomato black ring virus (TBRV) infects a wide range of economically important plants, and is distributed worldwide. TBRV is transmitted by soil-inhabiting nematodes. However, a long-distance dispersion is possible via seeds and pollen. In this study, we provided evidence that virus can be efficiently transmitted through tomato seeds. Three tomato varieties (Beta Lux, Grace and Money Maker) and four genetically diverse TBRV isolates collected originally from different hosts were used in the experiments. The seedlings were grown in an insect-proof glasshouse and the presence of TBRV was verified by immunoassay (ELISA). The seed transmission was significantly dependent on tomato cultivar and virus isolate ranging from 1.69% up to 14.57%. Bioassays using Chenopodium quinoa plants confirmed the presence of infectious virus in the seeds., Supported by by the National Science Centre of Poland, Project Nos 2013/11/B/NZ9/02510 and 2017/25/B/NZ9/01715, and by the Spain’s Agencia Estatal de Investigación – FEDER, Grant No. BFU2015-65037-P.

Systemic acquired resistance (SAR) is one of the most promising ways to support plants in the fight against viruses. Using this approach biological or chemical factors interact with plants and stimulate their immune system against infections before infection occurs. This paper presents synthesis, physical properties, phytotoxicity and SAR induction efficacy of 15 ionic liquids, derivatives of SAR inducers paired with the cholinium cation, an essential nutrient for organisms. SAR induction efficacy tests were performed on tobacco Nicotiana tabacum var. Xanthi infected by tobacco mosaic virus (TMV).

Nowadays, plant protection against viral diseases is one of the most challenging tasks faced by modern agriculture. One of the possible ways of plant protection is utilization of systemic acquired resistance phenomenon. In this approach biological or chemical factors interact with plants and stimulate their immune system against infections before infection occurs. This paper presents 11 ionic derivatives of benzo[1.2.3]thiadiazole-7-carboxy-S-methyl ester, a synthetic plant resistance inducer, with counterions specifically selected to modify the physical and biological properties of the resulting salts. We present the synthesis methods, as well as physical and biological properties, of these newly obtained anionic bifunctional salts.

Pepino mosaic virus (PepMV) has emerged as an important pathogen of greenhouse tomato crops and is currently distributed worldwide. Population genetic studies have revealed a shift in the dominant PepMV genotype from European (EU) to Chilean 2 (CH2) in North America and several European countries. New genetic variants are constantly being created by mutation and recombination events. Single nucleotide substitutions in different parts of the genome were found to affect on development of symptoms resulting in new pathotypes and accumulation of viral RNA. The variability of the PepMV population has a great impact on designing specific diagnostic tools and developing efficient and durable strategies of disease control. In this paper we review the current knowledge about the PepMV population, the evolutionary dynamics of this highly infective virus, methods for its detection and plant protection strategies.

Systemic acquired resistance (SAR) induction is one of the primary defence mechanisms of plants against a broad range of pathogens. It can be induced by infectious agents or by synthetic molecules, such as benzo(1,2,3)-thiadiazole-7-carbothioic acid S-methyl ester (BTH). SAR induction is associated with increases in salicylic acid (SA) accumulation and expression of defence marker genes (e.g., phenylalanine ammonia-lyase (PAL), the pathogenesis-related (PR) protein family, and non-expressor of PR genes (NPR1)). Various types of pathogens and pests induce plant responses by activating signalling pathways associated with SA, jasmonic acid (JA) and ethylene (ET). This work presents an analysis of the influence of BTH and its derivatives as resistance inducers in healthy and virus-infected plants by determining the expression levels of selected resistance markers associated with the SA, JA, and ET pathways. The phytotoxic effects of these compounds and their influence on the course of viral infection were also studied. Based on the results obtained, the best-performing BTH derivatives and their optimal concentration for plant performance were selected, and their mode of action was suggested. It was shown that application of BTH and its derivatives induces increased expression of marker genes of both the SA- and JA-mediated pathways.

Beet necrotic yellow vein virus (BNYVV), the casual agent of rhizomania disease, was identified in sugar beet plants from several fields in the Wielkopolska Region of Poland (1). In greenhouse studies, sugar beets were grown in the soil from one of these fields to bait soilborne viruses. Of 200 sugar beet plants, three developed symptoms of vein clearing, vein banding, and mosaic. Crude sap from symptomatic plants was used for mechanical inoculation of various plants species. In Chenopodium quinoa, C. amaranticolor, and Tetragonia expansa only local lesions were observed. Electron microscope examination of negatively stained leaf-dip preparations from symptomatic sugar beet plants showed a mixture of rod-shape particles from 70 to 400 nm long. Using double-antibody sandwich enzyme-linked immunosorbent assay tests, two symptomatic sugar beet plants gave positive reactions with antiserum against BNYVV (Bio-Rad, Hercules, CA) and a third plant gave a positive reaction with antisera against BNYVV and Beet soilborne virus (BSBV). Total RNA was extracted from roots and leaves of the symptomatic plants and used in a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) assay. Specific primers were designed to amplify a fragment of the RNA1 for BSBV and RNA2 for BNYVV and Beet virus Q (BVQ) (2). Two mRT-PCR products amplified with the primers specific to BNYVV and BSBV were obtained and sequenced. A 274-nt amplicon sequence (GenBank Accession No. DQ012156) had 98% nucleotide sequence identity with the German BNYVV isolate F75 (GenBank Accession No. AF19754) and a 376-nt amplicon sequence (GenBank Accession No. AY999690) had 98% nucleotide and 98% amino acid sequence identity with the German BSBV isolate (GenBank Accession No. Z97873). The Polish BSBV isolate had 88% nucleotide and 62% amino acid sequence identity with BVQ, another pomovirus (GenBank Accession No. AJ 223596 formerly known as serotype Wierthe of BSBV (2). In 2005, mRT-PCR was used on samples collected from two fields of the Wielkopolska Region. Of 15 tested sugar beet plants, 12 gave positive reactions with primers specific for BSBV and nine with primers specific to BNYVV. To our knowledge, this is first report of BSBV in Poland. In Europe, BSBV was previously reported in England, the Netherlands, Belgium, Sweden, Germany, France, and Finland (2,3). References: (1) M. Jezewska and J. Piszczek. Phytopathol. Polonica, 21:165, 2001. (2) A. Maunier et al. Appl. Environ. Microbiol. 69:2356, 2003. (3) C. M. Rush and G. B. Heidel. Plant Dis. 79:868, 1995.

In 2003 and 2004, unusual disease symptoms, including severe stunting, malformation, and necrosis of the leaves on tomato cv. Grace, were observed in the Wielkopolska Region of Poland. The disease appeared to be associated with the presence of the greenhouse whitefly Trialeurodes vaporariorium. An electron microscopic examination of a negatively stained leaf-dip preparation from an infected plant showed the presence of spherical virus particles approximately 25 to 28 nm in diameter. The virus (designated Wal'03) was shown to be vectored efficiently (100%) by T. vaporariorium and poorly (50 to 70%) by mechanical transmission to tomato. Mechanical inoculation or whitefly transmission caused systemic infection on Nicotiana tabacum (cvs. Xanthi nc, Samsun, and White Burley), N. benthamiana, N. clevelandii, N. debneyi, N. affinis, N. glutinosa, Lycopersicon esculentum, Petunia hybrida, Capsicum annuum, Nicandra physaloides, Physalis floridana, and Solanum tuberosum. The virus did not infect Phaseolus vulgaris, Pisum sativum, Cucumis sativus, Chenopodium quinoa, or Beta vulgaris. Partially purified virus preparations from N. bethamiana or N. tabacum cv. Xanthi centrifuged in a sucrose density gradient sedimented as two separated zones. Viral RNA was extracted from the purified viral preparations with phenol-chloroform, and analysis by denaturing agarose gel electrophoresis revealed RNA 1 (approximately 7,800 bp) and RNA 2 (approximately 5,400 bp). The biological properties and the genomic RNA composition showed significant similarities to that of Tomato necrotic dwarf virus (ToNDV) described from California (1) and the newly identified Tomato torrado virus (ToTV) in Spain (2). Immuno-specific electron microscopy (ISEM) showed Wal'03 virus particles reacted with ToNDV antiserum (provided by W. Wintermantel, Salinas, CA). The genomic sequence of ToTV (GenBank Accession Nos. DQ388879 and DQ388880) was used to design specific primers for analysis by reverse transcription (RT)-PCR: TR1F (5′ CAATGTGCCAAAGATGAGCG 3′), TR1R (5′ ACTCCCGTGTCTATGTTTTC 3′), TR2F (5′ GAAGGACGAAGAGCGACTG 3′), and TR2R (5′ AAGGTAGGTATGCGTTTGC 3′), which amplified products of 573 and 892 bp for RNA 1 and RNA 2, respectively. These RT-PCR fragments from Wal'03 were sequenced (GenBank Accession Nos. EF635007 and EF635008) and comparisons with ToTV showed 99 and 98% nucleotide identity for RNA1 and RNA2, respectively. Immunocapture-RT-PCR with leaf tissue from N. benthamiana infected by Wal'03, antiserum against ToNDV, and ToTV-specific primers TR2F and TR2R produced a fragment of the expected size. Sequence of this product showed 100% identity with previously obtained RT-PCR fragments. The similarity of the symptoms on tomato plants, the morphology of virus particles, genome composition and nucleotide sequence identities suggest that Wal'03 and ToTV are the same. References: (1) R. C. Larsen et al. Phytopathology 74:795, 1984. (2) M. Verbeek et al. Arch. Virol. 152:881, 2007.

During 2006, two tomato plants exhibiting dwarfing, twisting of shoots and leaves, and virescence and phyllody of flowers were observed in a greenhouse in western Poland. Total genomic DNA was extracted from approximately 3.5 g of leaf midribs and petioles using the modified cetyltrimethylammoniumbromide (CTAB) buffer method (3). Direct PCR was done with universal phytoplasma primers P1/P7 for amplification of ribosomal 16S rDNA. The PCR product (1.8 kb) was diluted 1:30 with sterile distilled water and used as DNA template for nested PCR with primers R16F2n/R16R2 (1). The final product was an expected 1.2-kb rDNA fragment amplified from infected tomato tissues. The DNA extracted from a Vinca sp. infected with phytoplasma of 16SrI-B subgroup and from a healthy tomato plant were used as positive and negative assay controls, respectively. Restriction fragment length polymorphism analysis of the final PCR product (1.2 kb) using enzymes MseI, KpnI, AluI, HhaI, HpaII, RsaI, TaqI, and TruI (1) indicated that phytoplasma from the tomato belonged to the subgroup 16SrI-C (1,2). The sequence obtained from the final PCR product (746 bp) was deposited in the GenBank database under accession number EF164961. Multiple sequence alignments with sequences of phytoplasma available from GenBank were performed using ClustalW software. The analysis revealed that the Polish isolate was co-identical (100%) to two phytoplasma sequences (GenBank Accession Nos. AY839617 and DQ078304) that belong to 16SrI-C subgroup. To our knowledge, this is the first report of a phytoplasma affecting tomato plant in Poland. References: (1) I.-M. Lee et al. Inst. J. Syst. Bacteriol. 48:1153, 1998. (2) I.-M. Lee et al. Cell-wall free bacteria. Page 283 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et a.l, eds. The American Phytopathology Society, 2001. (3) A. C. Padovan et al. Austral. J. Grape Wine Res. 1:25, 1995.

Lavandula angustifolia Mill. (synonym Lavandula officinalis Chaix), belonging to the Lamiaceae family, is a plant that is widespread in Mediterranean countries. The species is widely grown as an ornamental crop in Poland. Currently, only Alfalfa mosaic virus (AMV) is known to infect L. latifolia × L. officinalis in Italy (3). In the spring of 2005, we observed yellow mottling, leaf deformation, and growth reduction of L. angustifolia plants from the Agricultural Academy of Kraków collection of medicinal herbs and spices. Mechanical inoculation of a range of indicator plant species, Chenopodium quinoa, Cucumis sativus, Datura strammonium, Nicotiana glutinosa, N. tabacum cv. Xanthi, Lycopersicon esculentum, and Spinacia oleracea, with sap from symptomatic L. angustifolia plants resulted in symptoms typical of Cucumber mosaic virus (CMV). Chlorotic local lesions and systemic mosaic were observed after a few days on the tested plant species. However, local lesions did not develop on inoculated C. sativus cotyledons. A lack of systemic infection on Chenopodium quinoa excluded infection by AMV. The sap from symptomatic N. tabacum cv. Xanthi leaves contained spherical virus particles of 29 nm in diameter when examined with electron microscopy. Symptomatic N. tabacum cv. Xanthi leaves were positive for CMV in a double-antibody-ELISA using commercial CMV antiserum (Loewe Biochemica GmbH, Sauerlach, Germany). Total RNA was extracted from infected N. tabacum cv. Xanthi plants by the phenolchloroform method. Reverse transcription-PCR was carried out using specific primers CMVF 5′-CCCACAGGTAGAATCAAAT-3′ and CMVR 5′-ATGGACAAATCTGAATCAAC-3′ (1). The 367-bp amplicon representing a portion of the coat protein gene located in RNA3 was cloned into pGEM-T Easy Vector (Promega, Madison, WI) and two clones were sequenced. The fragment sequence (Accession No. EU303304) was compared with homologous sequences of CMV isolates from the GenBank database. Multiple sequence alignment was performed by using Mega 4 (Center for Evolutionary Functional Genomics, Tempe, AZ) (4) and revealed 99% nucleotide and amino acid identity between the Polish isolate of CMV-PL and the RT67 (subgroup II) isolate from the Netherlands (2) To our knowledge, this is the first report on the occurrence of CMV on Lavandula angustifolia Mill. in Poland or worldwide. References: (1) N. Borodynko et al. Prog. Plant Protect. 44:604, 2004. (2) Z. Deyong et al. J Virol. Methods 123:101, 2005. (3) L. Giunchedi et al. Phytopathol. Mediterr. 11:74, 1972. (4) K. Tamura et al. Mol. Biol. Evol. 24:1596, 2007.

Winter oilseed rape (Brassica napus L.) is widely grown in Poland to produce vegetable oil for industrial processing of human and animal feed. In recent years, according to European Union directives on the use of biofuels (Directive 2003/30/EC), the area under oilseed rape cultivation in Poland has dramatically increased to 810,000 ha in 2009 and is still increasing. Morphological deformations of winter oilseed rape indicative of phytoplasma infection have been observed sporadically in Poland since 2000 (3). Plants exhibiting floral virescence, phyllody, as well as auxiliary bud proliferation, reduced leaves, and malformation of siliques were identified during surveys of research fields in Wielkopolska during May and June of 2009 and 2010. To confirm phytoplasma infection of these plants, inflorescence and leaf tissues were collected from nine diseased and three symptomless plants from three different field locations with 1 to 16% disease incidence. Total DNA was extracted from each plant tissue sample with a modified cetyltrimethylammoniumbromide method (2). Samples were analyzed for phytoplasma DNA with a nested PCR assay employing phytoplasma universal rRNA operon primer pair P1/P7 followed by R16F2n/R16R2, using previously described conditions (1). PCR products of 1.8 and 1.2 kb were obtained from all diseased plants only following PCRs with P1/P7 and nested primer pair R16F2n/R16R2, respectively. PCR products were not obtained from symptomless plants. Eight 1.2-kb amplicons were sequenced (GenBank Accession Nos. JN193475 to JN193482). Comparative analysis of the R16F2n/R16R2 rDNA sequences confirmed the phytoplasma origin of the rDNA sequences that shared 100 to 99% identity with Maize bushy stunt phytoplasma (GenBank Accession No. HQ530152), Alfalfa stunt phytoplasma (GenBank Accession No. GU289675), Primula green yellows phytoplasma (GenBank Accession No. HM590623), and other aster yellows group phytoplasmas. A 1.8-kb amplicon of isolate designated RzW14 was sequenced (GenBank Accession No. HM561990) and had 99% identity with Aster yellow group phytoplasmas from Lithuania (GenBank Accession Nos.GU223208 and AY744071). A virtual restriction fragment length polymorphism analysis of the 16S rDNA sequences from the R16F2n/R16R2 amplicons was performed with iPhyClassifier (4). Restriction profile comparisons identified all aster yellows group phytoplasmas as subgroup 16SrI-B strains. To our knowledge, this is the first report of a ‘Candidatus Phytoplasma asteris’-related strain infecting oilseed rape in Poland. References: (1) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (2) A. C. Padovan et al. Aust. J. Grape Wine Res. 1:25, 1995. (3) M. Starzycki and E. Starzycka. Oilseed Crops 21:399, 2000. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

Efficient dispersion of Tomato torrado virus (ToTV), an emerging virus affecting tomato crops worldwide, is linked to its principal vectors, Bemisia tabaci and Trialeurodes vaporariorum. To evaluate whether ToTV can be seed-transmitted, we collected seeds from tomato varieties Beta Lux, Grace and Money Maker that had been mechanically inoculated with two ToTV isolates; seedlings were grown in an insect-proof glasshouse, then tested for ToTV by immunocapture-qRT-PCR. Among 17,985 plants, 69 were ToTV-positive (0.38% overall vertical transmission). Bioassays using indicator plants confirmed the presence of infectious virus in the seedlings. This is the first report of tomato seed transmission of ToTV., This study was supported by project N N310 732040 from National Science Centre of Poland. Work in Valencia was supported by grant BFU2015-65037-P from Spain’s Agencia Estatal de Investigación – FEDER.

Plant resistance induction is one of the most promising ways to support plants in fights against pathogens, especially viruses, due to the fact there are no plant protection agents acting directly on them. Certain chemicals, including benzo[1.2.3]thiadiazole-7-carbothioic acid, S-methyl ester (BTH) and its derivatives, were discovered as effective inducers of plant immunity. In this article, new BTH derivatives, in the form of organic salts composed of cations based on the plant resistance inducer BTH and anions introduced in order to modify physical (solubility in water, dissolution rate, thermal stability, melting points, pKa and logP values), and biological (antibacterial) properties are presented. The physical properties of resulting salts were altered by, for example, changing water solubility and also through the introduction of a second ion with a biological function (bacteriostatic and bactericidal properties against Gram-positive and Gram-negative bacteria). The major impact this new approach in ...

Peanut stunt virus (PSV) is a widespread pathogen infecting legumes. The PSV strains are classified into four subgroups and some are defined by the association of satellite RNAs (satRNAs). In the case of PSV, the presence of satRNAs alters the symptoms of disease in infected plants. In this study, we elucidated the plant response to PSV-G strain, which occurs in natural conditions without satRNA. However, it was found that it might easily acquire satRNA, which exacerbated pathogenesis in Nicotiana benthamiana. To explain the mechanisms underlying PSV infection and symptoms exacerbation caused by satRNA, we carried out transcriptome profiling of N. benthamiana challenged by PSV-G and satRNA using species-specific microarrays. Co-infection of plants with PSV-G + satRNA increased the number of identified differentially expressed genes (DEGs) compared with the number identified in PSV-G-infected plants. In both treatments, the majority of up-regulated DEGs were engaged in translation, ribosome biogenesis, RNA metabolism, and response to stimuli, while the down-regulated DEGs were required for photosynthesis. The presence of satRNA in PSV-G-infected plants caused different trends in expression of DEGs associated with phosphorylation, ATP binding, and plasma membrane.

A reverse transcription loop-mediated isothermal amplification assay (RT-LAMP) has been developed for detection of tomato black ring virus (TBRV) isolates collected from different hosts. One-step RT-LAMP was performed with a set of four primers, the design of which was based on the coat protein gene. Results of RT-LAMP were visualized by direct staining of products with fluorescent dyes, agarose gel electrophoresis, and analysis of amplification curves. The sensitivity of RT-LAMP was 100-fold greater than that of RT-PCR. The RT-LAMP assay developed here is a useful and practical method for diagnosis of TBRV.

The Pepino mosaic virus (PepMV) is one of the most important pathogens infecting tomato crops worldwide. Four major genotypes have been identified so far: Peruvian (LP), European (EU), Chilean 1 (CH1) and Chilean 2 (CH2). In Poland isolates representing the EU and CH2 genotypes have been found. The isolates belonging to the CH2 genotype induce a wide range of symptoms from very mild mosaic or even a lack of symptoms, through severe yellowing, up to necrosis of leaves. Therefore, the characterization of different genetic variants of PepMV is important to clarify processes of disease emergence caused by this virus. The necrotic and yellowing pathotypes representing the Chilean 2 genotype have been extensively studied. Development of infectious clones facilitates manipulation of the viral genome by site-directed mutagenesis. The studies performed made it possible to identify the viral genetic determinants responsible for the induction of different symptoms on infected plants. The introduction of single nucleotide substitutions in particular positions of triple gene block 3 (TGB3) resulted in changes of symptoms on tomato plants. Moreover, the mutations affect significantly viral accumulation, which has been measured by real-time RT-PCR. Single nucleotide substitutions introduced to the genome of genetically different European isolates also had an effect on biological properties and accumulation of the virus. Identified mutations in the viral genome are responsible for the development of symptoms and virus accumulation, and may play an important role during infection.

We have synthesized, new salt derivatives of benzo[1,2,3]thiadiazole-7-carbothioic acid S-methyl ester (BTH) containing BTH as the cation in combination with anions, which modify the physical and antibacterial properties of the resulting product while preserving the systemic acquired resistance (SAR) induction properties. The obtained compounds were tested toward induction of resistance in tobacco (Nicotiana tabacum var. Xanthi), which was later infected with OLV-1 and TMV viruses. Moreover in vitro tests on bacteria confirmed the preservation of antibacterial properties brought about by a docusate anion.

Electron microscopy studies were carried out to investigate the cytopathological changes induced in tomato leaves by Tomato torrado virus (ToTV) that infects tomato plants worldwide causing severe necrotic symptoms. Plants infected with one of the Polish isolates of ToTV were used for cytopathological research. The results revealed severe cellular alterations, especially in Solanum lycopersicum. Moreover, it was shown that crystalline aggregates of virions occurred not only within the phloem cells as it has been previously reported.

In this manuscript we provide evidence for the seed transmission of Pepino mosaic virus (PepMV) in tomato. Fruit was harvested from a tomato crop artificially infected with both European and CH2 genotypes of PepMV and more than 100,000 seeds were extracted and cleaned using an enzymatic treatment without disinfection. Infection assays using indicator plants confirmed the presence of viable virus on the seeds. Seeds were distributed to ten different laboratories in three separate batches, where they were germinated and the young plants tested by ELISA. In total over 87,000 plants were tested and 23 positives detected, indicating an overall transmission rate of 0.026%. However, the observed seed transmission rates varied from 0.005% to 0.057%, depending on the seed batch used. Results clearly showed that PepMV can be transmitted from seeds contaminated with virus to seedlings, highlighting the risk of using seeds from PepMV-infected plants and the potential for seed transmission to contribute to the further spread of PepMV.

Two symptomatic tomato plants exhibiting dwarfing, twisting of shoots and leaves, virescence and phyllody of flowers were collected, respectively, from a greenhouse (Soly07fi) or the field (Soly06gh) in the western region of Poland. Direct and nested polymerase chain reactions (PCR) were performed using universal phytoplasma primers P1/P7 and R16F2n/R16R2. Restriction fragment length polymorphism (RFLP) analysis of the PCR products showed that the RFLP profiles of both tested phytoplasma isolates are the same and that they belong to the phytoplasma 16S rRNA I-C subgroup. The homology between the two strains was 99%. Phylogenetic analysis of the 16S rRNA gene sequences of the phytoplasma isolates and other phytoplasma sequences available in the GenBank database indicated that the Polish phytoplasma isolates are most closely related to the phytoplasma 16S rRNA I-C subgroup.

For the first time, a full-length cDNA clone of the RNA genome of pepino mosaic virus (PepMV) was constructed. RNA was extracted from purified virions of isolate PepMV-Pa and used for cDNA synthesis. The full-length cDNA was produced as one 6.4-kb fragment representing the entire PepMV genome. This fragment was ligated into the pCR®-XL-TOPO® vector downstream of T7 RNA polymerase promoter, which was included in the 5′ primer sequence used for RT-PCR. The PepMV-Pa RNA transcripts obtained were infectious in different host plants, causing symptoms indistinguishable from those of the wild-type isolate. The presence and authenticity of the progeny virus were verified by ELISA, RT-PCR and nucleotide sequencing.

A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

A virus was isolated from Lavandula angustifolia Mill. plants exhibiting yellow mottling and distortion of leaves. After mechanical inoculation it induced in the major part of used test plants symptoms characteristic for Cucumber mosaic virus (CMV). Its standard properties regarding the stability in crude plant sap were as follows: longevity in vitro 1-2 days, thermal inactivation point 55-60°C, dilution end point log10minus 3 - 4. The virus reacted positive with diagnostic antiserum against CMV in DAS-ELISA test. RT-PCR reaction revealed similarity between the investigated isolate and the isolate of CMV from the Netherlands belonging to subgroup II. In the light of the foregoing facts the isolated pathogen can be identified as the Cucumber mosaic virus and Lavandula angustifolia may be regarded as its natural host.

Peanut stunt virus (PSV) belongs to the Cucumovirus genus of the family Bromoviridae and is widely distributed worldwide, also in Poland. PSV is a common pathogen of a wide range of economically important plants. Its coat protein (CP), similarly as in other viruses, plays an important role in many processes during viral life cycle and has great impact on the infectivity. In this study, we present the results of sequence-structure analysis of CP derived from three Polish strains of PSV: PSV Ag, G, and P. Sequences were determined using RT-PCR amplification followed by sequencing and compared with each other and also with CP from other known PSV viruses. We analyzed their phylogenetic relationship, based on CP sequence, using bioinformatic tools as well as their spatial model using homology-modeling approach with combination of ROSETTA algorithm for de novo modeling. We compared our model with those recently obtained for other cucumoviruses including PSV-Er. Our results have shown that all Polish strains probably belong to the first subgroup of PSV viruses. Homology level between strains Ag and G proved very high. Using theoretical modeling approach we obtained a model very similar to the one resolved previously with the differences caused by slightly different amino acid sequence. We have also undertaken an attempt to analyze its distant regions; however, results are not unequivocal. Analysis of symptoms and their correlation with specific amino acid position was also performed on the basis of results published elsewhere. The definite interpretation is impeded by the presence of satellite RNAs in Ag and P strains modulating symptoms' severity, though.

Some of the chitosan properties depend largely upon its molecular structure and in several applications of this polymer its lowered molecular weight is an asset. By degrading of microcrystalline chitosan in the presence of cellulolytic enzymes, the products having a reduced molecular weight were prepared, together with a water soluble blend of oligomers. The outcome of an initial assessment, made to evaluate the chance of a practical use of the obtained products of chitosan degradation, indicates that oligomers and partly degraded microcrystalline chitosan accelerate the germination of seeds, inhibit the growth of plant viruses, bacteria and milder.

This paper presents studies on an ultrastructural analysis of plant tissue infected with different pathotypes of Pepino mosaic virus (PepMV) and the immunolocalization of viral coat proteins. Because the PepMV virus replicates with a high mutation rate and exhibits significant genetic diversity, therefore, isolates of PepMV display a wide range of symptoms on infected plants. In this work, tomato plants of the Beta Lux cultivar were inoculated mechanically with three pathotypes representing the Chilean 2 (CH2) genotype: mild (PepMV-P22), necrotic (PepMV-P19) and yellowing (PepMV-P5-IY). The presence of viral particles in all infected plants in the different compartments of various cell types (i.e. spongy and palisade mesophyll, sieve elements and xylem vessels) was revealed via ultrastructural analyses. For the first time, it was possible to demonstrate the presence of crystalline inclusions, composed of virus-like particles. In the later stage of PepMV infection (14 dpi) various pathotype-dependent changes in the structure of the individual organelles (i.e. mitochondria, chloroplasts) were found. The strongest immunogold labeling of the viral coat proteins was also observed in plants infected by necrotic isolates. A large number of viral coat proteins were marked in the plant conductive elements, both xylem and phloem.

We developed a new method for inhibiting tobacco mosaic virus infection in tobacco plants based on specific RNA hydrolysis induced by a leadzyme. We identified a leadzyme substrate target sequence in genomic tobacco mosaic virus RNA and designed a 16-mer oligoribonucleotide capable of forming a specific leadzyme motif with a five-nucleotide catalytic loop. The synthetic 16-mer RNA was applied with nontoxic, catalytic amount of lead to infected tobacco leaves. We observed inhibition of tobacco mosaic virus infection in tobacco leaves in vivo due to specific tobacco mosaic virus RNA cleavage effected by leadzyme. A significant reduction in tobacco mosaic virus accumulation was observed even when the leadzyme was applied up to 2 h after inoculation of leaves with tobacco mosaic virus. This process, called leadzyme interference, is determined by specific recognition and cleavage of the target site by the RNA catalytic strand in the presence of Pb2+.

International audience; Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254thinspkDa and 149thinspkDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.

In 2012 and 2013 the presence of Potato virus Y on tomato in greenhouses and fields was analyzed. A total number of 176 samples displaying different type of symptoms: deformation, discoloration, necrosis of leaves and growth retardation were collected. The presence of viral infection using enzyme-linked immunosorbent assay (ELISA) and transmission electron microscopy (TEM) was confirmed in 147 samples. Biological and genetic diversity of the virus isolates was also analyzed. The analyses revealed that the particular strains cause different symptoms on the tested plants such as Solanum lycopersicum cv. Moneymaker, S. melongena and Datura inoxia. In contrast to previous years, in which only isolates belonging to PVY N Wi-P strains were observed, four different strains were identified: PVY N Wi-P, PVY N N242, PVY NTN and PVY O . The isolates belonging to PVY N Wi-P strain remained dominant in the population.

Olive latent virus 1 (OLV-1) is a species of the Necrovirus genus. So far, it has been reported to infect olive, citrus tree and tulip. Here, we determined and analysed the complete genomic sequence of an isolate designated as CM1, which was collected from tomato plant in the Wielkopolska region of Poland and represents the prevalent isolate of OLV-1. The CM1 genome consists of monopartite single-stranded positive-sense RNA genome sized 3,699 nt with five open reading frames (ORFs) and small inter-cistronic regions. ORF1 encodes a polypeptide with a molecular weight of 23 kDa and the read-through (RT) of its amber stop codon results in ORF1 RT that encodes the virus RNA-dependent RNA polymerase. ORF2 and ORF3 encode two peptides, with 8 kDa and 6 kDa, respectively, which appear to be involved in cell-to-cell movement. ORF4 is located in the 3' terminal and encodes a protein with 30 kDa identified as the viral coat protein (CP). The differences in CP region of four OLV-1 isolates whose sequences have been deposited in GenBank were observed. Nucleotide sequence identities of the CP of tomato CM1 isolate with those of olive, citrus and tulip isolates were 91.8%, 89.5% and 92.5%, respectively. In contrast to other OLV-1 isolates, CM1 induced necrotic spots on tomato plants and elicited necrotic local lesions on Nicotiana benthamiana, followed by systemic infection. This is the third complete genomic sequence of OLV-1 reported and the first one from tomato.

Presence of the virus associated with La France disease was confirmed in the mushrooms collected from different farms located in Western Poland. Double-stranded RNA (dsRNA) was isolated from the mushrooms exhibiting a wide range of the disease symptoms including premature veil opening, brown-colored mushrooms, and loss of crop yield. The presence of dsRNA molecules (M1, M2, and L3) was confirmed by RT-PCR and sequencing. Furthermore, La France isometric virus (LFIV)-like particles were observed in the mushrooms extracts in electron microscopy. The LFIV infection was found in 120 of 200 mushroom samples tested. The amount of the infected samples indicated the high occurrence of La France disease that could be a threat to the mushroom industry in Poland.

New necrotic isolates of Pepino mosaic virus (PepMV) were found in 2007 infecting greenhouse tomato plants in Poland. The isolates differ from previously identified PepMV isolates in host range and symptomatology. They induce severe necrosis on tomato plants (Solanum lycopersicum) and local necrotic lesions on Datura inoxia. Phylogenetic analysis, based on three distinct regions, triple gene block 1, the coat protein gene and a part of polymerase gene, revealed that the new necrotic isolates share high nucleotide sequence identity with isolates of the Ch2 genotype. This is the first report describing a necrotic type of PepMV of the Ch2 genotype.

Beet necrotic yellow vein virus (BNYVV), which causes a viral disease of sugar beet known as “rhizomania”, is widely spread throughout the sugar beet growing areas of Poland. The analysis of the molecular variability of two separate regions, namely the part of coat protein (CP) and triple gene block (TGB) genes of the BNYVV genome, revealed very low level of nucleotide sequence diversity among the isolates (98–100% sequence identity). Sequence alignments of BNYVV isolates from Poland and other isolates available to data showed also high level of nucleotide sequence identity among these isolates. Based on multiplex RT-PCR and phylogenetic analysis we distinguished types A and B of BNYVV. The sequence identity matrix between type A and B revealed 92–93% similarity. Mainly, BNYVV type A is widespread in Poland whereas type B has rarely been found. These results suggest that Polish isolates probably originated from Southern Europe rather then from Germany or France where BNYVV type B is a dominating one.

New Erwinia carotovora‐specific and Erwinia carotovora ssp.carofovora‐specific primer sets were designed and thoroughly checked in order to estimate their usefulness in practical diagnostics of soft rot erwinias on different host plants. Both primer sets proved to be specific within Erwinia genus. They did not recognise any of bacterial isolates belonging to various taxonomical groups, including pectolytic Pseudomonas associated with soft‐rot. E.carotovora primer set gave positive results with all E.carotovota isolates and strains tested. Amplification of specific DNA fragment was observed also with E.rhapontici and E.cypripedii DNA but not with the DNA of E.chrysanthemi. PCR performed with Ecc primer set showed presence of specific DNA fragment in 86% of standard Ecc strains and 89% of biochemically typical Polish Ecc isolates. Specific band could also be detected with E.c.ssp.betavasculorum, E.c.ssp.wasabiae, E.c.ssp.odorifera, Exypripedii and E.rhapontici species. No amplification of DNA was observed w...

The structure of the population of soft rot erwinias on various economically important plants in Poland was established using biochemical tests and PCR method. The results show that 29.2% of the isolates were identified as Erwinia caratovora ssp. atroseptica, 66.0% as Erwinia carotovora ssp. carotovora and 4.8% of isolates belonged to biochemically atypical E.carotovora group. Using PCR method, 50% of biochemically atypical isolates were identified as E. carotovora ssp. carotovora. Serological differentiation with E. carotovora ssp. astroseptica serogroup I‐specific antibodies showed that 83.3% of E. carotovora ssp. atroseptica isolates in Poland belonged to this serogroup. In Poland E. carotovora ssp. atroseptica is closely associated with potato. Although this subspecies is very rare on other host plants it may occur and cause soft rot. E. carotovora ssp. carotovora subspecies is common on various host plants including potato. Erwinia chrysanthemi and Erwinia carotovora ssp. betavasculorun species have ...

In Poland in 2002 and 2005 two different isolates of Pepino mosaic virus signed PepMV-SW and PepMV-PK were obtained. Both isolates were compared on the basis of their symptomatology on a series of plant species. In addition, the isolates were characterized by the nucleotide sequence analysis of the triple gene block, coat protein and a part of the polymerase genes. The studies showed that the Polish isolates differ from each other and belong to two strains. PepMV-SW was highly similar to European isolates, showing extensive sequence identity, ca. 99%. Pairwise comparisons of PepMV-PK with other PepMV isolates from the GenBank database showed that the highest nucleotide sequence identity was with two isolates: Ch2 from Chile and US2 from the USA.

Tomato black ring virus (TBRV) is an important pathogen infecting many plant species worldwide. The biological and molecular variability of the Polish isolates of TBRV was analyzed. The analysis was performed based on the symptoms induced by various isolates on test plant species as well as on phylogenetic relationships between isolates. Isolates differed in their host range and symptomatology. In addition, genetic variation among isolates was characterized by restriction fragment length polymorphism analysis and confirmed by sequencing. The phylogenetic analysis revealed that the Polish isolates differ from each other and do not form a monophyletic cluster. Finally, we identified and analyzed sequences of defective RNA forms arising from the TBRV genome.