Search

A Crimean-Congo Hemorrhagic Fever Virus (CCHFV) survey in Agnam (North Senegal) permits the detection of three isolates in ticks. These isolates belong genetically to multiple genotypes (I, II, III) and clustered with strains from Uganda, Sudan, Mauritania, and Senegal. The role of ticks in CCHF emergence and widespread is highlighted.

Crimean Congo Hemorrhagic Fever (CCHF); fever, widespread pain in the body, deterioration in liver function tests; it is a tick-borne viral infectious disease that can cause bleeding and death in the skin, mucous membranes, and sometimes internal organs. In this study, we retrospectively evaluated the clinical, laboratory, and epidemiological characteristics of CCHF cases diagnosed in Afyonkarahisar.Demographic and clinical characteristics, laboratory findings, treatments, and prognoses of patients diagnosed with CCHF in Afyonkarahisar were retrospectively analyzed.In Afyonkarahisar, it was determined that 35 case reports were made between 2002 and November 2019, the date when the CCHF was first seen in Turkey. A history of tick attachment was detected in 31 subjects. Tick arrest cases were most common in June (12 cases; 34.3%) and July (9 cases; 2.9%). There was a history of living in rural areas in twenty-seven (77.1%) patients, close contact with animals in 12 patients, and a history of contact with animal blood in 4 patients. All the 35 cases that followed resulted in healing and no mortality was observed.CCHF is an endemic disease that still maintains its importance in our country. The most important factor in the control with the disease is to prevent virus contact to prevent transmission. People living in endemic areas should be informed about the precautions to be taken against tick bites, and awareness should be raised by providing education about the disease.Kırım Kongo Kanamalı Ateşi (KKKA); ateş, vücutta yaygın ağrı, karaciğer fonksiyon testlerinde bozulma ile seyreden; deri, mukozalarda, bazen iç organlarda kanamalara ve ölüme yol açabilen kene kaynaklı bir viral enfeksiyon hastalığıdır. Bu çalışmada, Afyonkarahisar ilinde tanı konulan KKKA olgularının klinik, laboratuvar ve epidemiyolojik özelliklerini retrospektif olarak değerlendirmeyi amaçladık.Afyonkarahisar ilinde KKKA tanısı alan hastaların demografik ve klinik özellikleri, laboratuvar bulguları, uygulanan tedaviler ve prognozları retrospektif olarak incelenmiştir.Afyonkarahisar ilinde; ülkemizde KKKA’nın ilk kez görüldüğü tarih olan 2002 yılından Kasım 2019 tarihine kadar toplam 35 olgu bildirimi yapıldığı belirlendi. Otuz bir olguda kene tutunması öyküsü saptandı. Kene tutunması olguları en çok Haziran (12 olgu; %34.3) ve Temmuz (9 olgu; %2.9) aylarında görüldür. Yirmi yedi (%77.1) hastada kırsal kesimde yaşama öyküsü, 12 hastada hayvanlarla yakın temas, 4 hastada hayvan kanı ile temas öyküsü mevcuttu. Takip edilen 35 olgunun tamamı şifa ile sonuçlanmış, mortalite görülmemişti.KKKA, ülkemizde halen önemini koruyan endemik bir hastalıktır. Hastalığın kontrolünde en önemli faktör, bulaşı önlemek için virüs temasını engellemektir. Endemik bölgelerde yaşayan kişiler kene tutunmasına karşı alınması gereken önlemler konusunda bilgilendirilmeli, hastalık hakkında eğitim verilerek farkındalık oluşması sağlanmalıdır.

BackgroundCrimean-Congo haemorrhagic fever (CCHF) is a priority emerging pathogen for which a licensed vaccine is not yet available. We aim to assess the feasibility of conducting phase III vaccine efficacy trials and the role of varying transmission dynamics.MethodsWe calibrate models of CCHF virus (CCHFV) transmission among livestock and spillover to humans in endemic areas in Afghanistan, Turkey and South Africa. We propose an individual randomised controlled trial targeted to high-risk population, and use the calibrated models to simulate trial cohorts to estimate the minimum trial endpoints necessary to analyse vaccine efficacy, sample size and follow-up time in the three settings.ResultsUnder assumptions of a minimum vaccine efficacy of 60%, the minimum sample size needed to accrue the required 150 clinical endpoints in a minimum follow-up time of 6 months is estimated to be 34,000 (CrI 95%, 16,750 – 88,725) and 37,000 (CrI 95%, 13,000 – 77,250) in Afghanistan and Turkey, respectively. The results suggest that for South Africa the low endemic transmission levels will not permit achieving the necessary conditions for conducting this trial within a realistic follow-up time. In a scenario of CCHFV infection (rather than clinical case) as trial endpoint, the required sample size is reduced by 70% to 80% in Afghanistan and Turkey, and in South Africa, a trial becomes feasible for large sample sizes (>75,000) and vaccine efficacy of >70%. Increased expected vaccine efficacy >60% will reduce the required number of trial endpoints and thus the sample size and follow-time in phase III trials.ConclusionsUnderlying endemic transmission levels will play a central role in defining the feasibility of phase III vaccine efficacy trials. Endemic settings in Afghanistan and Turkey offer conditions under which such studies could feasibly be conducted.

Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne disease that can be contracted by direct contact with viremic animals or humans. Domestic animals are accidental hosts and contribute to the spread and amplification of the virus. The main objective of this study was to provide updated information related to CCHF virus (CCHFV) infection in Southern Romania by assessing the seroprevalence of CCHF in small ruminants (sheep and goats) using a double-antigen sandwich enzyme-linked immunosorbent assay and by detection of CCHFV in engorged ticks and serum samples using real-time RT-PCR. The overall seroprevalence of CCHF in small ruminants was 37.7% (95% CI 31.7 to 43.7). No statistical seroprevalence difference was observed between the two species of ruminants (

The prognostic nutritional index (PNI) is calculated using total serum lymphocyte counts and albumin levels. We aimed to analyze the role of PNI in predicting intensive care unit (ICU) referral and mortality in patients with Crimean Congo hemorrhagic fever (CCHF).Our target population was adult (age18) patients who presented between March 2015 and October 2021 within 5 days of symptom emergence and were diagnosed with CCHF. The predictive value of PNI was analyzed by the receiver operating curve analysis. The patients were categorized based on the severity grading scores (SGS) as mild, moderate, and severe. The relationship between PNI and ICU referral and mortality was analyzed by logistic regression analysis.Overall, 115 patients with the diagnosis of CCHF were included. 13.9% (n = 16) of the patients were referred to ICU while 11.3% (n = 13) died. A comparison of the patients with different SGS grades revealed that they were significantly different regarding PNI (p 0.001). There was a significant negative correlation between PNI and SGS (r = -0.662; p 0.001). PNI had a PV regarding ICU referral and mortality ([area under the curve [AUC] = 0.723, 95% confidence interval [CI]: 0.609-0.836, p = 0.004 [AUC = 0.738, 95% CI: 0.613-0.863, p = 0.005]). The PNI threshold was 36.1 for ICU referral and mortality. The rates of female patients, hospitalization periods longer than 1 week, platelet apheresis replacement, diabetes mellitus, bleeding history, ICU admission, and mortality were significantly higher in patients with a PNI of lower than 36.1 (p 0.05).PNI can predict ICU referral and mortality in patients admitted due to CCHF.

Crimean-Congo Hemorrhagic Fever (CCHF) is endemic in Uganda, yet its epidemiology remains largely uncharacterized. To better understand its occurrence within Uganda, case reports of patients hospitalized with CCHF between 2013 and 2019 were reviewed. Further, genome sequences of CCHF-positive RNA obtained during this period were determined for phylogenetic comparisons. We found that a total of 32 cases (75% males; CFR, 31.2%), aged between 9 to 68 years, were reported during the study period. Most cases were detected during July to December of each outbreak year (81.2%; P < 0.01) and were located along the “cattle corridor” (68.7%, P = 0.03). The most common presenting symptoms were fever (93.8%), hemorrhage (81.3%), headache (78.1%), fatigue (68.8%), vomiting (68.8%), and myalgia (65.6%). In five patients for whom hematological data were available, varied abnormalities were observed including thrombocytopenia, leukopenia, anemia, lymphopenia, lymphocytosis, polycythemia, and microcytosis. About 56.3% (P = 0.47) of patients reported tick bites or exposure to livestock as their potential source of infection. Person-to-person transmission was suspected for two cases. Using unbiased metagenomics, we found that the viral S- and L- segments have remained conserved in Africa 2 clade since the 1950s. In contrast, the M segment split into two geographically interspersed clades; one that belongs to Africa 2 and another that is ancestral to Africa 1 and 2. Overall, this data summarizes information on the history and clinical presentation of human CCHF in Uganda. Importantly, it identifies vulnerable populations as well as temporal and geographic regions in Uganda where surveillance and control interventions could be focused.

Purpose The present study was undertaken with the objective to study the common etiology of Viral Haemorrhagic Fever (VHF) among patients attending tertiary health care centre in NE India and also to study the clinico-demographic profile of such patients. The agents of VHF included in the study were dengue, chikungunya and Crimean Congo haemorrhagic fever (CCHF) virus. The inclusion of CCHF was based on evidence of seroprevalence in livestock (bovine, sheep and goat) in various North Eastern states. Materials and methods Serum samples were collected from 51 suspected VHF patients. MAC-ELISA was done to detect dengue and chikungunya specific IgM antibody. The samples were also tested by real-time RT-PCR for detection of dengue, chikungunya and CCHF specific nucleic acid. The laboratory and clinico-demographic profile of these patients were noted in detail. Results Serum samples of 16 of 51 suspected cases were confirmed to be suffering from VHF. Among these confirmed cases, 12 were diagnosed with dengue haemorrhagic fever, one was diagnosed with chikungunya and three were diagnosed with dengue-chikungunya co-infection. Based on severity, DHF was further classified into- DHF I- (4,26.6%), DHF II (6,40%), DHF III (3,20%) and DHF IV (2,13.3%). There was no CCHFV infection detected in our study. Retro-orbital pain (P ​= ​0.02) and haematocrit level (P ​= ​0.03) were found to be statistically significant. Conclusions This study reiterates the fact that CCHF virus infection is still probably absent in human population of NE India and haemorrhagic symptoms, though rare maybe one of the atypical manifestations of chikungunya infection.

Background Crimean-Congo hemorrhagic fever (CCHF) is an acute, feverous disease that is caused by tick bites or humans’ direct contact with the blood and tissues of infected livestock and humans. The transmission of the disease is also possible via human-to-human contacts and nosocomial transmission is well described. The majority of patients suffering from this disease are slaughterhouse workers (including butchers), farmers, veterinarians and hospital staff. Thus, this study aimed to investigate the health behaviors of butchers regarding CCHF and study factors affecting such behaviors based on the health belief model. Methods This is a descriptive cross-sectional study conducted on 500 butchers in Ardabil Province in 2020 by a multistage sampling method. The participants of the study completed the researcher-made questionnaire of health belief model and health behaviors model relevant to CCHF. The collected data were then analyzed by descriptive statistical tests and linear regression analysis. Results The mean (SD) age of the participants was 44.4 (10.5) years, and 96% were males. Only 11.1% of the participants displayed acceptable disease-preventive behaviors. The validity and reliability of the developed questionnaire were confirmed. The results of the exploratory factor analysis showed that the constructs of the model explained 84% of the total variance. The results of the study revealed that among the variables of the health belief model, perceived susceptibility (p-value = 0.006, β = 0.152) and perceived barriers (p-value = 0.023, β = 0.14) were the strongest factors predicting disease-preventive behaviors regarding CCHF. Conclusion The results of the study showed that the health belief model can predict preventive behaviors for CCHF. Therefore, designing and executing interventions based on the results of this study may encourage such preventive behaviors in butchers.

Crimean–Congo haemorrhagic fever (CCHF) is an emerging tick‐borne disease causing severe and fatal haemorrhagic syndrome in humans. Hyalomma spp. ticks are the primary vectors and sheep are important CCHF virus (CCHFV)‐amplifying hosts. In this study, blood samples and ticks collected in October 2019 from 270 sheep from 15 farms across Tunisia constituted the main research material. Moreover, the sera of the same animals taken at different periods between 2018 and 2019 were also used to obtain comparative results. To investigate the presence of anti‐CCHFV antibodies in sheep, all sera were tested using ELISA. Reactive sera were further characterised by a virus neutralisation test (VNT). Overall, one out of the 270 tested sheep was both ELISA‐ and strongly VNT‐positive to CCHFV. Another two sheep were borderline ELISA‐positive but did not exhibit neutralising antibodies. Ninety‐one ticks were collected from all sampled sheep, of which 34 (37.4%) belonged to Hyalomma spp. This is the first report of anti‐CCHFV antibodies in sheep from Tunisia. Both the results of this study and the recent CCHFV detection in ticks collected from camels in southern Tunisia indicate that further studies are needed to determine the competent tick vector in the country and to characterise the epidemiological cycle of CCHFV., This is the first report of Crimean Congo haemorrhagic fever virus seroprevalence in sheep in Tunisia. Despite the low seroprevalence, there is evidence of CCHFV introduction in Tunisia, may be through migratory birds carrying infected ticks from Europe. Further study on CCHFV epidemiology among ticks, hosts and humans should be urgently conducted.

Crimean-Congo hemorrhagic fever virus (CCHFV) is a highly pathogenic tick-borne RNA virus prevalent in Asia, Europe, and Africa, and can cause a hemorrhagic disease (CCHF) in humans with mortality rates as high as 60%. A general lack of both effective medical countermeasures and a comprehensive understanding of disease pathogenesis is partly driven by an historical lack of viable CCHF animal models. Recently, a cynomolgous macaque model of CCHF disease was developed. Here, we document the targeted transcriptomic response of non-human primates (NHP) to two different CCHFV strains; Afghan09-2990 and Kosova Hoti that both yielded a mild CCHF disease state. We utilized a targeted gene panel to elucidate the transcriptomic changes occurring in NHP whole blood during CCHFV infection; a first for any primate species. We show numerous upregulated genes starting at 1 day post-challenge through 14 days post-challenge. Early gene changes fell predominantly in the interferon stimulated gene family with later gene changes coinciding with an adaptive immune response to the virus. There are subtle differences between viral strains, namely duration of the differentially expressed gene response and biological pathways enriched. After recovery, NHPs showed no lasting transcriptomic changes at the end of sample collection.

Crimean Congo Hemorrhagic Fever virus (CCHFV) is a deadly human pathogen that causes an emerging zoonotic disease with a broad geographic spread, especially in Africa, Asia, and Europe, and the second most common viral hemorrhagic fever and widely transmitted tick-borne viral disease. Following infection, the patients are presented with a variety of clinical manifestations and a fatality rate of 40%. Despite the high fatality rate, there are unmet clinical interventions, as no antiviral drugs or vaccines for CCHF have been approved. Immunoinformatics pipeline and reverse vaccinology were used in this study to design a multi-epitope vaccine that may elicit a protective humoral and cellular immune response against Crimean-Congo hemorrhagic fever virus infection. Three essential virulent and antigenic proteins (S, M, and L) were used to predict seven CTL and 18 HTL epitopes that were non-allergenic, antigenic, IFN-γ inducing, and non-toxic. The epitopes were connected using linkers and 50S ribosomal protein L7/L12 was used as an adjuvant and raised a multi-epitope vaccine (MEV) that is 567 amino acids long. Molecular docking and simulation of the predicted 3D structure of the MEV with the toll-like (TLR2, TLR3, and TLR4) receptors and major histocompatibility complex (MCH-I and MCH-II) indicate high interactions and stability of the complexes, MM-GBSA free binding energy calculation revealed a favourable protein–protein complex. Maximum MEV expression was achieved with a CAI value of 0.98 through in silico cloning in theDrosophila melanogasterhost. According to the immune simulation, IgG1, T-helper cells, T-cytotoxic cells, INF-γ, and IL-2 were predicted to be significantly elevated. These robust computational analyses demonstrated that the proposed MEV is effective in preventing CCHFV infections. However, it is still necessary to conduct both in vitro and in vivo experiments to validate the potential of the vaccine.

Crimean-Congo hemorrhagic fever (CCHF) is a viral zoonotic infectious disease transmitted by ticks, accompanied by fever, bleeding, myalgia, weakness and similar non-specific symptoms, and can have an acute and serious course. In this article, two CCHF cases seen during the Coronavirus disease-2019 (COVID-19) pandemic in a non-endemic province are described. The common feature of both cases; contact with animals in the endemic region during the feast of sacrifice, non-specific symptoms, liver function test, lactate dehydrogenase and creatine phosphokinase elevation, leukopenia and thrombocytopenia. Especially during the COVID-19 pandemic, tick and livestock contact of patients with non-specific symptoms should be questioned.Kırım-Kongo kanamalı ateşi (KKKA); kenelerle bulaşan ve ateş, kanama, myalji, halsizlik ve benzeri non-spesifik semptomlarla seyreden, akut ve ciddi seyirli olabilen viral zoonotik bir enfeksiyon hastalığıdır. Burada, endemik olmayan bir ilde Koronavirüs hastalığı-2019 (COVID-19) pandemisi devam ederken görülen iki adet KKKA olgusu tartışılmıştır. Olguların ortak özelliği, Kurban Bayramı sırasında endemik bölgedeki hayvanlarla temas etmiş olmaları, non-spesifik semptomları olması; karaciğer fonksiyon testleri, laktat dehidrogenaz ve kreatin fosfokinaz yüksekliği, lökopeni ve trombositopeni şeklinde karşımıza çıkmıştır. COVID-19 pandemisi sırasında non-spesifik semptomları olan hastaların kene ve hayvancılık teması özellikle sorgulanmalıdır.

This review was conducted by the ad hoc subgroup from the working expert group on the risks related to Hyalomma ticks at the French Agency for Food, Environmental and Occupational Health & Safety (ANSES) commissioned by the French authorities.; International audience; At a time of major global, societal, and environmental changes, the shifting distribution of pathogen vectors represents a real danger in certain regions of the world as generating opportunities for emergency. For example, the recent arrival of the Hyalomma marginatum ticks in southern France and the concurrent appearance of cases of Crimean–Congo hemorrhagic fever (CCHF)—a disease vectored by this tick species—in neighboring Spain raises many concerns about the associated risks for the European continent. This context has created an urgent need for effective methods for control, surveillance, and risk assessment for ticks and tick-borne diseases with a particular concern regarding Hyalomma sp. Here, we then review the current body of knowledge on different methods of tick control—including chemical, biological, genetical, immunological, and ecological methods—and the latest developments in the field, with a focus on those that have been tested against ticks from the genus Hyalomma. In the absence of a fully and unique efficient approach, we demonstrated that integrated pest management combining several approaches adapted to the local context and species is currently the best strategy for tick control together with a rational use of acaricide. Continued efforts are needed to develop and implement new and innovative methods of tick control.

Crimean-Congo hemorrhagic fever (CCHF) is a medically relevant tick-borne viral disease caused by the Bunyavirus, Crimean-Congo hemorrhagic fever virus (CCHFV). CCHFV is endemic to Asia, the Middle East, South-eastern Europe, and Africa and is transmitted in enzootic cycles among ticks, mammals, and birds. Human infections are mostly subclinical or limited to mild febrile illness. Severe disease may develop, resulting in multi-organ failure, hemorrhagic manifestations, and case-fatality rates up to 30%. Despite the widespread distribution and life-threatening potential, no treatments have been approved for CCHF. Antiviral inhibitory peptides, which antagonize viral entry, are licensed for clinical use in certain viral infections and have been experimentally designed against human pathogenic bunyaviruses, with in vitro and in vivo efficacies. We designed inhibitory peptides against CCHFV with and without conjugation to various polyethylene glycol and sterol groups. These additions have been shown to enhance both cellular uptake and antiviral activity. Peptides were evaluated against pseudotyped and wild-type CCHFV via neutralization tests, Nairovirus fusion assays, and cytotoxicity profiling. Four peptides neutralized CCHFV with two of these peptides shown to inhibit viral fusion. This work represents the development of experimental countermeasures for CCHF, describes a nairovirus immunofluorescence fusion assay, and illustrates the utility of pseudotyped CCHFV for the screening of entry antagonists at low containment settings for CCHF.

The production, use, and sharing of information in health-related fields are increasing at an exponential rate in this age. Because they are so common today, social media platforms have a big impact on people's opinions, habits, and decisions. With this study, we aimed at testing the content, reliability, and quality of the videos about CCHF disease published on YouTube™ for patients and healthcare professionals, which people use for obtaining information.The data of this study were obtained by searching on YouTube™ on January 1, 2022, using the keywords "Crimean-Congo hemorrhagic fever". Google Trends was used to identify the most common search terms for Crimean-Congo hemorrhagic fever. Video reliability was evaluated by using the DISCERN tool and Global Quality Scale (GQS) was performed to evaluate video quality.After the exclusion criteria, 75 videos were reviewed. Videos for healthcare professionals were more sufficient than videos for patients (p=0.004). DISCERN and GQS scores were higher in sufficient videos than in partially sufficient/insufficient videos (p=0.000 and p=0.000, respectively).As YouTube is an important source of health information about CCHF, there is a need to increase the number of high-quality and reliable content for patients on YouTube™.

Crimean-Congo hemorrhagic fever (CCHF) was detected in 2 refugees living in a refugee settlement in Kikuube district, Uganda. Investigations revealed a CCHF IgG seroprevalence of 71.3% (37/52) in goats within the refugee settlement. This finding highlights the need for a multisectoral approach to controlling CCHF in humans and animals in Uganda.

The first etiologically confirmed cases of Crimean-Congo hemorrhagic fever (CCHF) in humans were detected in Turkey in 2002. Since then, thousands of cases have been reported from different parts of the country. Hyalomma (Hy.) marginatum is considered the main vector tick of CCHFe in Turkey, and the primary infection route for humans is known to be the tick bite. This study was carried out between January 2013 and December 2014 in Thrace, Turkey, to determine monthly prevalence and intensity of tick infestation in cattle and, ultimately, to predict the related risk of human exposure to ticks and tick-borne diseases. During the study, 1,701 cattle in 24 villages were screened for ticks; 24,012 adult ticks, 1,887 nymphs, and 766 larvae were encountered on 1,228 of these cattle. On the 1,318 cattle that routinely grazed in the daytime, Hy. marginatum was the most predominant species, with an infestation prevalence of 73.6% and an average tick intensity of 16.1 on the infested cattle. In order of prevalence (%) in the grazing cattle, Hy. marginatum was followed by Rhipicephalus (R.) bursa (32.7%), R. turanicus (%29.5), Ixodes (I.) ricinus (15.1%), Haemaphysalis (Ha.) parva (10.4%), Ha. inermis (10%), Ha. punctata (6.5%), and Dermacentor (D.) marginatus (2.3%). The obtained data were discussed in terms of the infestation characteristics of the observed tick species, the drivers that may affect these characteristics, and the features of possible relationship between Hy. marginatum infestation in the cattle and CCHF cases among humans in the area.

We conducted a serosurvey for Crimean-Congo hemorrhagic fever virus antibodies in various wildlife species in Catalonia, northeastern Spain. We detected high seroprevalence in southern Catalonia, close to the Ebro Delta wetland, a key stopover for birds migrating from Africa. Our findings could indicate that competent virus vectors are present in the region. info:eu-repo/semantics/publishedVersion

Ixodid ticks represent vectors and reservoirs for a broad range of zoonotic pathogens. Collected ticks from field studies are therefore usually stored in ethanol, which in higher concentrations effectively inactivates most of the known tick-borne pathogens. Although commonly practiced as gold standard for inactivation, hardly any scientific data demonstrate that ethanol sufficiently penetrates the comparatively thick cuticula of ticks. Therefore, Amblyomma hebraeum tick pools were stored for 21 days in ethanol (96%). Afterwards, the ethanol was removed and the ticks were homogenized. Quantitative 1H-NMR spectroscopic analysis was applied to determine the residual concentration of ethanol inside the ticks. 1H-NMR spectroscopic analysis revealed that ethanol constituted 28.3–42.6 mg of the total weight of three ticks in the pools (89.9–121.5 mg). In addition, the low-pathogenic Hazara orthonairovirus (HAZV) was used as a cell culture model for this study. The virus was exposed to ethanol concentrations between 0 and 60% and incubated under various temperature conditions for four time periods. Afterwards, the residual virus infectivity was determined by titration. Following ethanol exposure, HAZV did not grow in cells after 9 h of exposure to an ethanol concentration of 25%. These results demonstrate an extremely low ethanol resistance of the virus, which was generally in line with previously reported ethanol inactivation data for Crimean-Congo hemorrhagic fever orthonairovirus (CCHFV). After prolonged storage and impregnation, comparable ethanol concentrations are achieved in the ticks, indicating the suitability of this inactivation method also for Bunyaviruses in ticks. At the very least, a massive virus inactivation can be assumed. Definitive proof of virus inactivation would require a bioassay of ethanol-treated infected ticks under appropriate biosafety conditions.

Objective To determine the seroprevalence of selected zoonotic viral hemorrhagic fevers (VHFs) and their associated risk factors in Tanzania. Methods Blood samples were collected from consenting outpatients and community members in eight districts selected from five ecological zones of Tanzania. Serum was harvested and tested for the presence of immunoglobulin G (IgG) and M (IgM) antibodies against Crimean-Congo hemorrhagic fever (CCHF), Ebola virus disease (EVD), Marburg virus disease (MVD), Rift Valley fever (RVF), and yellow fever (YF). Results The presence of IgM and IgG antibodies against CCHF, EVD, MVD, RVF, and YF was detected in 64 of 500 samples (12.8%). The prevalences of IgM and IgG antibodies to CCHF, EVD, MVD, RFV, and YF were 2.0%, 3.4%, 1.2%, 4.8%, and 1.4%, respectively. Contact with wild animals (OR = 1.2, CI = 1.3–1.6) and keeping goats (OR = 1.3, CI = 1.5–1.9) were significantly associated with RVF, while contact with bats (OR = 1.2, CI = 1.1–1.5) was associated with MVD. Conclusion The findings of this study provide evidence of exposure to CCHF, EVD, MVD, RVF, and YF in Tanzania. Since most of these VHFs occurred without apparent clinical forms of the disease, these findings call for the need to strengthen the surveillance system and management of febrile illnesses in Tanzania.

Bleeding is considered to be an indicator of poor prognosis in Crimean-Congo hemorrhagic fever (CCHF) disease. In the prehemorrhagic period, clinical signs are usually non-specific. The hemorrhagic period usually begins 3 to 5 days after the onset of the disease. The aim of this study was to build a risk score to predict bleeding status in CCHF patients with clinical and laboratory findings. This methodological study was carried out in one of the largest centers which is located in the east part of Turkey and CCHF-endemic region between April 2014-October 2019 with 450 CCHF patients' data. Risk score was created with univariate and multivariate logistic regression analyzes with the data of 80% of the patients, and the diagnostic power of the created score was determined by ROC analysis. The data of the remaining 20% were used as the verification data set and the created score was tested by ROC analysis. The patients had a mean age of 47.83 ± 17.46 years (median 48; min-max: 16-90 years) and 209 (59.7%) were male. Hemorrhage was detected in 93 patients (26.6%). Of the hemorrhagic patients, 83 (23.7%) had multiple hemorrhage sites. In univariate analyzes, time between the onset of symptom and admission to the hospital (≥4 days), aspartate aminotransferase (≥228 U/L), alanine aminotransferase (≥143.5 U/L), lactate dehydrogenase (≥641 U/L), creatine kinase (≥227 U/L), white blood cell count (≤1810 × 106/L), platelet count (≤38385 × 106/L), activated partial thromboplastin time (≥38.5 s) and fibrinogen value (≤227 mg/dl) were found to be an independent risk factor for bleeding. As a result of multivariate analysis, the time between the onset of symptoms and admission to the hospital, white blood cell count, platelet count, aspartate aminotransferase, creatine kinase and fibrinogen values were included in the risk scoring. The area under the curve of the generated score is 0.875; sensitivity was 80.6% and specificity was 80.5%. Platelet count responsible for hemostasis, affected in terms of number and function in CCHF disease, LDH, AST and aPTT values used as indicators of liver functions that are the target of the virus can be used with high diagnostic prediction for bleeding. However, the predictive power of the generated score on bleeding is higher than the effect of each variable alone. In addition, it can be easily calculated during patient follow-up and can guide the treatment process.

Background: \ud Crimean-Congo Haemorrhagic Fever (CCHF) is an emerging human-health threat causing sporadic outbreaks in livestock farming communities. However, the full extent and the risks associated with exposure of such communities has not previously been well-described.\ud \ud Methods: \ud We collected blood samples from 800 humans, 666 cattle, 549 goats and 32 dogs in districts within and outside Ugandan cattle corridor in a cross-sectional survey, and tested for CCHFV-specific IgG antibodies using Enzyme-Linked Immunosorbent Assays. Sociodemographic and epidemiological data were recorded using structured questionnaire. Ticks were collected to identify circulating nairoviruses by metagenomic sequencing.\ud \ud Results: \ud CCHFV seropositivity was in 221/800 (27·6%) in humans, 612/666 (91·8%) in cattle, 413/549 (75·2%) in goats and 18/32 (56·2%) in dogs. Human seropositivity was associated with livestock farming (AOR=5·68, p50 ticks: AOR=3·52, p=0·004). CCHFV was identified in multiple tick pools of Rhipicephalus appendiculatus.\ud \ud Interpretation: \ud The very high CCHF seropositivity especially among livestock farmers and multiple regional risk factors associated exposures, including collecting/eating engorged ticks previously unrecognised, highlights need for further surveillance and sensitisation and control policies against the disease.

Tick-borne zoonotic diseases pose a threat to public health; hence, identifying the pathogenic agents associated with them is critical. The prevalence of Bartonella and Rickettsia in Iran is unknown. This study aimed to detect Rickettsia spp. and Bartonella species in ticks in northeast Iran and conduct phylogenetic analysis on these bacteria. Ticks from the sample bank in the Research Center for Emerging and Re-emerging Diseases were included in this study. The ticks were collected in 2017 and 2018 from domestic animals (sheep, goats, cows, camels, horses, dogs, and donkeys) and rodents in Golestan, Mazandaran, and Guilan provinces. Molecular methods were used to examine the DNA extracted from these samples to detect Rickettsia spp. and Bartonella species. The study examined a total of 3999 ticks. Ixodes ricinus (46.4%), Rhipicephalus turanicus (26.3%), and Rhipicephalus sanguineus (17.1%) were the most prevalent species. Among 638 DNA pools, real-time-PCR detected Rickettsia spp. in 161 (25.2%), mostly belonging to Rh. sanguineus (48.9%) and Rh. turanicus (41.9%). Golestan Province had the highest number of positive pools (29.7%). No positive samples for Bartonella were detected in a 638 pooled samples. Eight distinct Rickettsia species were detected in 65 sequenced samples, the majority of which were R. massiliae (n = 32, 49.2%) and R. sibirica (n = 20, 30.8%). Other species included R. rhipicephali (n = 3), R. aeschlimannii (n = 5), R. helvetica (n = 5), R. asiatica (n = 4), R. monacensis (n = 6), and R. raoultii (n = 1). The research findings may provide helpful information about tick-borne Rickettsiae in Iran and help to clarify the role of these arthropods in maintaining these agents. Rickettsia species were found to be circulating in three Northern provinces; thus, it is recommended that this disease be considered in the differential diagnosis of febrile diseases caused by tick bites and febrile diseases with skin rashes such as Crimean–Congo hemorrhagic fever (CCHF).

International audience; Dugbe orthonairovirus (DUGV) is a tick-borne arbovirus within the order Bunyavirales. Although displaying mild pathogenic potential, DUGV is genetically related to the Crimean–Congo hemorrhagic fever virus (CCHFV), another orthonairovirus that causes severe liver dysfunction and hemorrhagic fever with a high mortality rate in humans. As we previously observed that CCHFV infection could massively recruit and lipidate MAP1LC3 (LC3), a core factor involved in the autophagic degradation of cytosolic components, we asked whether DUGV infection also substantially impacts the autophagy machinery in epithelial cells. We observed that DUGV infection does impose LC3 lipidation in cultured hepatocytes. DUGV infection also caused an upregulation of the MAP1LC3 and SQSTM1/p62 transcript levels, which were, however, more moderate than those seen during CCHFV infection. In contrast, unlike during CCHFV infection, the modulation of core autophagy factors could influence both LC3 lipidation and viral particle production: the silencing of ATG5 and/or ATG7 diminished the induction of LC3 lipidation and slightly upregulated the level of infectious DUGV particle production. Overall, the results are compatible with the notion that in epithelial cells infected with DUGV in vitro, the autophagy machinery may be recruited to exert a certain level of restriction on viral replication. Thus, the relationship between DUGV infection and autophagy in epithelial cells appears to present both similarities and distinctions with that seen during CCHFV infection.

Crimean-Congo hemorrhagic fever virus (CCHFV) is a widespread zoonotic pathogen that can cause mild to severe hemorrhagic disease in humans. CCHFV may be transmitted through direct contact with tissue or blood of viremic animals; however, the primary transmission route is through infected tick bites. CCHFV RNA has been detected in ticks feeding on domestic and wild animals in western Spain, suggesting an established circulation of CCHFV in Western Europe. Ruminants have been recognized as important CCHFV reservoirs and have been linked to human cases in endemic regions. Given the emergence of CCHF in neighboring Spain, and a report of two CCHFV seropositive humans in southern Portugal in 1985, we investigated the potential circulation of this virus in the country by performing a nationwide anti-CCHFV IgG serosurvey in sentinel sheep of Portugal. Sera (n = 459) randomly selected from widely distributed farms (n = 20) of Portugal were tested using a commercial double-antigen enzyme-linked immunosorbent assay, yielding an overall seroprevalence of 0.4% (95% confidence interval [CI] 0.04-1.56%). Positive sheep were from the southern region of Portugal (Alentejo region), which raise the seroprevalence of this region to 0.74% (95% CI 0.09-2.66%). This is the first study reporting the presence of CCHFV antibodies in sheep of Portugal, thus suggesting a geographical expansion of CCHFV to this country. It seems likely that CCHFV may exist focally in southern Portugal. info:eu-repo/semantics/publishedVersion

Crimean-Congo hemorrhagic fever virus (CCHFV) is a tick-borne orthonairovirus that causes a severe, often fatal, hemorrhagic disease throughout Africa, Asia, and Southeast Europe. A wide variety of strains are circulating in the field which broadly correlate to their geographic distribution. The viral determinants of pathogenicity remain unclear, as does the contribution of strain-specific differences to pathology. Aigai virus (AIGV) is a closely related virus (formally designated CCHFV genotype VI, Europe II, or AP92-like virus), which has been proposed to be less virulent than CCHFV. However, the molecular details leading to potential differences in virulence are unknown. To explore if differences exist, life cycle modeling systems, including both a minigenome and a transcriptionally competent virus-like particle assay, were developed for AIGV to allow the comparison with the CCHFV reference IbAr10200 strain. Using this approach, we could demonstrate that AIGV exhibits lower viral gene expression than the reference strain of CCHFV. Subsequent systematic exchange of viral components revealed that the L protein is responsible for the observed differences in gene expression and that the interferon (IFN) antagonistic activity of the ovarian tumor-type protease domain is not responsible for this effect.

Crimean-Congo haemorrhagic fever (CCHF) is a widespread tick-borne viral infection, present across Africa and Eurasia, which might pose a cryptic public health problem in Uganda. We aimed to understand the magnitude and distribution of CCHF risk in humans, livestock and ticks across Uganda by synthesising epidemiological (cross-sectional) and ecological (modelling) studies.We conducted a cross-sectional study at three urban abattoirs receiving cattle from across Uganda. We sampled humans (n = 478), livestock (n = 419) and ticks (n = 1065) and used commercially-available kits to detect human and livestock CCHF virus (CCHFV) antibodies and antigen in tick pools. We developed boosted regression tree models to evaluate the correlates and geographical distribution of expected tick and wildlife hosts, and of human CCHF exposures, drawing on continent-wide data.The cross-sectional study found CCHFV IgG/IgM seroprevalence in humans of 10·3% (7·8-13·3), with antibody detection positively associated with reported history of tick bite (age-adjusted odds ratio = 2·09 (1·09-3·98)). Cattle had a seroprevalence of 69·7% (65·1-73·4). Only one Hyalomma tick (CCHFV-negative) was found. However, CCHFV antigen was detected in Rhipicephalus (5·9% of 304 pools) and Amblyomma (2·9% of 34 pools) species. Modelling predicted high human CCHF risk across much of Uganda, low environmental suitability for Hyalomma, and high suitability for Rhipicephalus and Amblyomma.Our epidemiological and ecological studies provide complementary evidence that CCHF exposure risk is widespread across Uganda. We challenge the idea that Hyalomma ticks are consistently the principal reservoir and vector for CCHFV, and postulate that Rhipicephalus might be important for CCHFV transmission in Uganda, due to high frequency of infected ticks and predicted environmental suitability.UCL Global Challenges Research Fund (GCRF) and Pan-African Network on Emerging and Re-Emerging Infections (PANDORA-ID-NET) funded by the European and Developing Countries Clinical Trials Partnership (EDCTP) under the EU Horizon 2020 Framework Programme for Research and Innovation.

Crimean-Congo hemorrhagic fever virus (CCHFV) is endemic in Asia, infecting many animal hosts, but CCHFV has not been reported in Myanmar. We conducted a seroepidemiologic survey of logging communities in Myanmar and found CCHFV exposure was common (9.8%) and exposure to wild animal blood and body fluids was associated with seropositivity.

Background Crimean-Congo hemorrhagic fever virus (CCHFV) belongs to the genus Orthonairovirus (Nairovididae) and is a (re)emerging tick-borne pathogen. It is endemic in most parts of Africa, Asia and southern Europe, and can cause severe hemorrhagic symptoms in humans, with high fatality rates (5–30%). Methods Hyalomma ticks were collected from four different livestock herds (cattle and camels) in Mauritania in 2018. The tick species were determined morphologically and confirmed molecularly by using the cytochrome oxidase 1 gene marker. For the detection of CCHFV, ticks were tested individually by one-step multiplex real-time reverse-transcriptase quantitative polymerase chain reaction. The small segment of all positive samples was sequenced to determine the CCHFV genotype. Results In total, 39 of the 1523 ticks (2.56%) collected from 63 cattles and 28 camels tested positive for CCHFV. Three Hyalomma species were identified. Hyalomma rufipes had the largest proportion of positivity (5.67%; 16/282), followed by Hyalomma dromedarii (1.89%; 23/1214). No Hyalomma impeltatum tested positive (0%; 0/21). Positive ticks were found in only six out of 91 host animals. Viral sequence analysis revealed the presence of two different CCHFV lineages (Africa I and Africa III). Conclusions In this study, 2.56% of Hyalomma ticks collected from camels and cattle in Mauritania tested positive for CCHFV. However, the true prevalence of CCHFV in unfed ticks may be lower, as a considerable number of ticks may have been passively infected during blood-feeding by co-feeding ticks or due to viremia of the host. The results indicate the need to track the actual area of circulation of this virus. Graphical Abstract

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.