Search

A gene delivery system utilizing lentiviral vectors (LVs) requires high transduction efficiency for successful application in human gene therapy. Pseudotyping allows viral tropism to be expanded, widening the usage of LVs. While vesicular stomatitis virus G (VSV-G) single-pseudotyped LVs are commonly used, dual-pseudotyping is less frequently employed because of its increased complexity. In this study, we examined the potential of phenotypically mixed heterologous dual-pseudotyped LVs with VSV-G and Sendai virus hemagglutinin-neuraminidase (SeV-HN) glycoproteins, termed V/HN-LV. Our findings demonstrated the significantly improved transduction efficiency of V/HN-LV in various cell lines of mice, cynomolgus monkeys, and humans compared with LV pseudotyped with VSV-G alone. Notably, V/HN-LV showed higher transduction efficiency in human cells, including hematopoietic stem cells. The efficient incorporation of wild-type SeV-HN into V/HN-LV depended on VSV-G. SeV-HN removed sialic acid from VSV-G, and the desialylation of VSV-G increased V/HN-LV infectivity. Furthermore, V/HN-LV acquired the ability to recognize sialic acid, particularly N-acetylneuraminic acid on the host cell, enhancing LV infectivity. Overall, VSV-G and SeV-HN synergistically improve LV transduction efficiency and broaden its tropism, indicating their potential use in gene delivery. [ABSTRACT FROM AUTHOR]

The hemagglutinin-neuraminidase (HN) protein is the surface glycoprotein of Newcastle disease virus (NDV) which is involved in the process of virus entry into host cells. HN exhibits the capability to induce agglutination of chicken red blood cells, thereby contributing to the viral infection of the host. As a consequence, HN is a potential antigen for the production of subunit vaccines for protecting poultry from NDV infections. In this study, the hn gene coding for the HN antigen of NDV genotype VIII was artificially synthesized, ligated into donor vector pFastBacHT A and integrated into the baculovirus genome for the purpose of HN expression in Spodoptera frugiperda 9 (Sf9) cells. The recombinant HN protein was successfully expressed in Sf9 cells in the SF900 III medium. The expressed recombinant HN protein, with a size of approximately 63 kDa, exhibited hemagglutinin activity (HA) of 4log2 when interacting with chicken erythrocyte fluid. The findings of this study lay the foundation for subsequent research endeavors aimed at the development of Newcastle disease virus (NDV) vaccines tailored for poultry in Vietnam. [ABSTRACT FROM AUTHOR]

Human parainfluenza viruses (HPIVs) are responsible for a wide range of respiratory infections in humans, particularly in children, the elderly, and immunocompromised individuals. This paper presents a study regarding the antiviral activity of a series of 3-phenyl-5-sulfamoyl-N-(7/8/9-(non)substituted-3-oxo-1-thia-4- azaspiro[4.4]non/[4.5]dec-4-yl)-1H-indole-2-carboxamide derivatives against HPIV-2. Our findings suggest the compounds displayed low potency against HPIV-2. Compounds 4 and 8 exhibited the most potent antiviral effects with inhibition of 95.46 and 90.90 % at 10 mg/mL, respectively. Molecular modeling studies were conducted on hemagglutinin-neuraminidase, a crucial druggable target for HPIV, to predict the binding modes of the compounds. [ABSTRACT FROM AUTHOR]

Abstract Background Newcastle disease (ND) is a major threat to the poultry industry, leading to significant economic losses. The current ND vaccines, usually based on active or attenuated strains, are only partially effective and can cause adverse effects post-vaccination. Therefore, the development of safer and more efficient vaccines is necessary. Epitopes represent the antigenic portion of the pathogen and their identification and use for immunization could lead to safer and more effective vaccines. However, the prediction of protective epitopes for a pathogen is a major challenge, especially taking into account the immune system of the target species. Results In this study, we utilized an artificial intelligence algorithm to predict ND virus (NDV) peptides that exhibit high affinity to the chicken MHC-I complex. We selected the peptides that are conserved across different NDV genotypes and absent in the chicken proteome. From the filtered peptides, we synthesized the five peptides with the highest affinities for the L, HN, and F proteins of NDV. We evaluated these peptides in-vitro for their ability to elicit cell-mediated immunity, which was measured by the lymphocyte proliferation in spleen cells of chickens previously immunized with NDV. Conclusions Our study identified five peptides with high affinity to MHC-I that have the potential to serve as protective epitopes and could be utilized for the development of multi-epitope NDV vaccines. This approach can provide a safer and more efficient method for NDV immunization.

A gene delivery system utilizing lentiviral vectors (LVs) requires high transduction efficiency for successful application in human gene therapy. Pseudotyping allows viral tropism to be expanded, widening the usage of LVs. While vesicular stomatitis virus G (VSV-G) single-pseudotyped LVs are commonly used, dual-pseudotyping is less frequently employed because of its increased complexity. In this study, we examined the potential of phenotypically mixed heterologous dual-pseudotyped LVs with VSV-G and Sendai virus hemagglutinin-neuraminidase (SeV-HN) glycoproteins, termed V/HN-LV. Our findings demonstrated the significantly improved transduction efficiency of V/HN-LV in various cell lines of mice, cynomolgus monkeys, and humans compared with LV pseudotyped with VSV-G alone. Notably, V/HN-LV showed higher transduction efficiency in human cells, including hematopoietic stem cells. The efficient incorporation of wild-type SeV-HN into V/HN-LV depended on VSV-G. SeV-HN removed sialic acid from VSV-G, and the desialylation of VSV-G increased V/HN-LV infectivity. Furthermore, V/HN-LV acquired the ability to recognize sialic acid, particularly N-acetylneuraminic acid on the host cell, enhancing LV infectivity. Overall, VSV-G and SeV-HN synergistically improve LV transduction efficiency and broaden its tropism, indicating their potential use in gene delivery.

Background: Newcastle disease (ND) is a major threat to the poultry industry, leading to significant economic losses. The current ND vaccines, usually based on active or attenuated strains, are only partially effective and can cause adverse effects post-vaccination. Therefore, the development of safer and more efficient vaccines is necessary. Epitopes represent the antigenic portion of the pathogen and their identification and use for immunization could lead to safer and more effective vaccines. However, the prediction of protective epitopes for a pathogen is a major challenge, especially taking into account the immune system of the target species. Results: In this study, we utilized an artificial intelligence algorithm to predict ND virus (NDV) peptides that exhibit high affinity to the chicken MHC-I complex. We selected the peptides that are conserved across different NDV genotypes and absent in the chicken proteome. From the filtered peptides, we synthesized the five peptides with the highest affinities for the L, HN, and F proteins of NDV. We evaluated these peptides in-vitro for their ability to elicit cell-mediated immunity, which was measured by the lymphocyte proliferation in spleen cells of chickens previously immunized with NDV. Conclusions: Our study identified five peptides with high affinity to MHC-I that have the potential to serve as protective epitopes and could be utilized for the development of multi-epitope NDV vaccines. This approach can provide a safer and more efficient method for NDV immunization. [ABSTRACT FROM AUTHOR]

Recombinant Newcastle disease (ND) subunit vaccines are safe, efficacious and compatible with DIVA strategies. Hence, are promising alternatives to conventional live and inactivated vaccines for ND control and prevention. While production of hemagglutinin-neuraminidase (HN)-based ND subunit vaccines have been extensively evaluated at lab-scale, significant barriers impeding successful translation from high-cost, small bench scale production to low-cost mass production remain. This review details current state and challenges in efficacious HN subunit design, advantages and disadvantages of available production routes using different expression hosts together with gaps and solutions regarding quantitative analytical methods used for formulation in dose-efficiency studies. Critical factors influencing HN subunit vaccine immunogenicity such as protein structure, glycosylation and amino acid variations are discussed. Construct design and available expression hosts are then analyzed from viewpoint of yield and quality measured in terms of efficacy. The current deficiency in available quantitative methods for effective dose-efficacy studies is given emphasis, underscoring the importance of robust analytical methods for determination of optimal vaccine dose. The review outlines current state and way forward for the development of HN ND subunit vaccines and other recombinant subunit vaccines for veterinary applications. [Display omitted] • Current knowledge of structure-immunogen relationships critical to rHN subunitvaccine design. • Overview of biomolecular and bioprocess considerations for rHN production. • Summary of immunological outcomes attained from subunit vaccine rHN. • Current rHN quantitation methods for subunit vaccine formulation. • Future direction for rHN subunit vaccine manufacture delineated. [ABSTRACT FROM AUTHOR]

Newcastle disease virus (NDV) is considered one of the most devastating avian viral pathogens affecting the avian population, and it causes a significant economic burden on the poultry industry worldwide. The study aimed to gain deeper understanding of the molecular and phylogenetic analyses of the complete hemagglutinin-neuraminidase (HN) coding region among NDV isolates. The samples were obtained from different parts of Iran from July 2017 to February 2020, were used for phylogenic analysis in this study. The results confirmed the predominance ofsub-genotypeVII.1.1,previouslyknownassub-genotypeVIIL, whichiscirculatingincommercial broiler farms of Iran. Identification of (a) an additional N-glycosylation site (NIS) at position 144; (b) mutations S315P and I369V which are related to increasing the viral thermostability; (C) cysteine residues at positions 123; (d) amino acid substitutions in the HN antigenic sites, especially the mutations I514V and E347Q, as well as the other mutant within HN binding sites of the VII.1.1 sub-genotype, suggests the idea that this new sub-genotype of NDV may possess a high level of pathogenicity and virulence compared to other NDV sub-genotypes. In conclusion, the results indicate the presence of an additional NIS at position 144, which may alter the virulence of the isolates. Furthermore, the presence of the thermostable mutations (S315P and I369V) and the other amino acid substitutions among the VII.1.1 sub-genotype isolates may have an impact on the vaccine immunity against this new NDV sub-genotype. [ABSTRACT FROM AUTHOR]

PIV 5 (Mammalian orthorubulavirus 5 - ICTV, 2021, previously known as Parainfluenza virus 5) is one of the main causes of ITB (infectious tracheobronchitis) affecting dogs, with a global distribution and potential to generate outbreaks from time to time. The currently available vaccines against the disease do not prevent the symptoms, require a high number of doses, and use adjuvants that, in addition to the cost of production, are responsible for adverse reactions, sometimes severe. Such drawbacks have raised the interest for new vaccine's development against ITB. In this context, we designed a recombinant immunogen based on the modified Vaccinia virus Ankara (MVA) expressing the hemagglutinin-neuraminidase (HN) envelope protein of PIV 5, and evaluated the immunogenic potential of this vaccine in C57BL/6 female mice. For the immunogenicity analyzes, epitopes of CD8+ T cell for the MHC-I murine alleles were predicted in silico, evaluated in vitro through flow cytometry and ELISA assays, and were used to evaluate the CD8+ T cell responses. The efficient expression of the envelope protein by the recombinant vector, allied to the immunogenic responses in vivo, highlights the potential of our recombinant MVA as a vaccine against PIV 5.

Background and Aim: Newcastle disease (ND) is a viral infectious disease that affects commercial and native chickens, resulting in economic losses to the poultry industry. This study aimed to examine the viral strains circulating in commercial and native chickens by genetic characterization and observe the distribution of Newcastle disease virus (NDV) in chicken embryonic tissue. Materials and Methods: ND was detected using a quantitative reverse transcription-polymerase chain reaction. Genetic characterization of the fusion (F) and hemagglutinin-neuraminidase (HN) genes from the eight NDVs was performed using specific primers. The sequence was compared with that of other NDVs from GenBank and analyzed using the MEGA-X software. The distribution of NDV in chicken embryos was analyzed based on lesions and the immunopositivity in immunohistochemistry staining. Results: Based on F gene characterization, velogenic NDV strains circulating in commercial and native chickens that showed varying clinical symptoms belonged to genotype VII.2. Lentogenic strains found in chickens without clinical symptoms were grouped into genotype II (unvaccinated native chickens) and genotype I (vaccinated commercial chickens). Amino acid variations in the HN gene, namely, the neutralization epitope and antigenic sites at positions 263 and 494, respectively, occurred in lentogenic strains. The NDV reaches the digestive and respiratory organs, but in lentogenic NDV does not cause significant damage, and hence embryo death does not occur. Conclusion: This study showed that velogenic and lentogenic NDV strains circulated in both commercial and native chickens with varying genotypes. The virus was distributed in almost all organs, especially digestive and respiratory. Organ damage in lentogenic infection is not as severe as in velogenic NDV. Further research is needed to observe the distribution of NDV with varying pathogenicity in chickens.

Porcine rubulavirus (PRV) is a contagious virus that affects the Mexican swine industry. This work aimed to evaluate the immunogenicity of an recombinant hemagglutinin neuraminidase-Porcine rubulavirus (rHN-PorPV) candidate vaccine on pregnant sows, and the protective efficacy afforded to their 7-day-old suckling piglets against PRV lethal challenge. Three sows were immunized with rHN-PorPV formulated with immune-stimulating complex (ISCOMs) and two sows with rHN-PorPV protein alone as well as a mock-immunized pregnant sow (negative control). Quantitative ELISA detected a high concentration of anti-rHN-PorPV Immunoglobulin G (IgG) antibodies in sow sera after the second dose of vaccine administered on day 14 until farrowing, showing viral-neutralizing and cross-neutralization activity against different variants of PRV. Sera samples from piglets of immunized sows (with or without adjuvant), showed high concentrations of IgG antibodies. As expected, piglets from the negative control sow (n=5), exhibited severe signs of disease and 100% of mortality after PRV challenge study. Conversely, 75% and 87.5% of the piglets born from the rHN-PorPV and the rHN-PorPV-ISCOMs-immunized sows (n=8), survived, respectively, showing milder PRV clinical signs. Our data indicate that rHN-PorPV candidate vaccine produced in Escherichia coli induces efficient humoral response in pregnant sows and that the maternally derived immunity provides high protection to suckling piglets against PRV lethal challenge. [ABSTRACT FROM AUTHOR]

Newcastle disease (ND) is a contagious disease in poultry and numerous birds of various ages. Eagle is considered a potential reservoir for ND transmission as a wild bird. This research was conducted to molecularly characterize Newcastle disease virus (NDV) isolated from ND cases in Brontok Eagle and analyze the pathogenesis in chicken embryos. qRT-PCR was conducted as confirmation of NDV without mixing Avian Influenza (AI). Sequencing the fusion (F) and haemagglutinin-neuraminidase (HN) genes from the three NDVs was performed with a specific primer. Amino acid sequence compared with other NDV from Genbank. Pathogenicity, genetic variation, distance, and phylogenetic studies were analyzed using bioinformatics software (MEGA-X). This study analyzed pathogenesis based on lesions and distribution of viral antigens in chicken embryos infected with NDV. Observations were based on tissue lesions with HE and IHC staining. NDV isolated from three Brontok Eagles is classified as velogenic strain, virulent NDV (KRQKRF), and belonging to Genotype VII subgenotype VII.2. The NDV was detected in various organ lesions, more severe in the pulmo, trachea, proventriculus, and intestine of chicken embryos. That is still similar to the previous case reports in the field. These results show that NDV, which infected Brontok Eagle, has similar molecular characteristics and pathogenesis in chickens. These cases could be a threat to the poultry industry. Further research, surveillance, and monitoring of wild birds are needed to obtain more NDV epidemiological information in wild birds. [ABSTRACT FROM AUTHOR]

Newcastle disease is a highly contagious viral infection affecting many species of birds that can spread fast between poultry houses and cause a heavy economic burden on the poultry industry all around the world. Fusion and hemagglutinin-neuraminidase (HN) protein are important in the pathogenesis of the Newcastle disease virus (NDV). The HN protein is a critical viral protein with multiple functions and plays a key role in the formation of the virulence of NDV. Head of HN protein is responsible for receptor binding, neuraminidase activity. This study aimed to investigate the sequence homology of hemagglutinin-neuraminidase of two NDV isolates sampled from infected farms in Iran. The samples were collected from flocks that had been vaccinated by both types of live and killed vaccines for NDV. After isolation of NDV, the viruses were subjected to the polymerase chain reaction (PCR) amplification using two pairs of specific primers designed for the HN gene to amplify the complete HN gene (1730bp). Afterward, the PCR products were sequenced and analyzed by phylogenetic tree construction software. Based on the analysis, substantial sequence homology among Iranian isolates is within the range of 97.1-100%. Moreover, the sequence homology searching revealed a level of similarity between HN sequences of Iranian isolates and the HN sequences from other countries, particularly Asian ones. For instance, a high homology ratio (95.34%) was found between Iranian isolates and the sequences registered on online molecular databases from China. Based on phylogenetic analysis, the NDV isolates belong to the VIId genotype. Finally, it can be concluded that monitoring the circulation of NDVs among poultry and other birds can help to obtain an insight into the evolution of NDVs and control of panzootic viruses in the future.

Abstract Background The hemagglutinin-neuraminidase (HN) protein of Newcastle disease virus (NDV) is a major antigen that can induce protective antibodies in poultry. However, its antigenic epitopes have not been fully elucidated. Therefore, defining the linear epitopes of HN, especially neutralizing epitopes, will be useful for revealing its antigenic characterization. Methods In this study, we analyzed B-cell immunodominant epitopes (IDEs) of the HN protein from the vaccine strain LaSota using pepscan technology with LaSota-specific chicken hyperimmune antisera. We constructed IDEs-RFP plasmids and prepared anti-IDEs peptide mouse sera to identify IDEs through immunological tests. At last, the different diluted anti-IDE antisera were used in BHK-21 cells to perform the neutralization test. Results Five IDEs of the HN were screened and further verified by indirect immunofluorescence assays, dot blots and Western blots with NDV- and IDEs-specific antisera. All five IDEs showed good immunogenicity. IDE5 (328–342 aa) could recognize only class II NDV but did not react with the class I strain. Most of the IDEs are highly conserved among the different strains. A neutralization test in vitro showed that the peptide-specific mouse antisera of IDE4 (242–256 aa) and HN341-355, a reported neutralizing linear epitope, could partially neutralize avirulent LaSota as well as virulent strains at similar levels, suggesting that IDE4 might be a potential neutralizing linear epitope. Conclusion The HN protein is a major protective antigen of NDV that can induce neutralizing antibodies in animals. We identified five IDEs of the HN using a pepscan approach with NDV-specific chicken hyperimmune antisera. The five IDEs could elicit specific antibodies in mice. IDE4 (242–256 aa) was identified as a novel potential neutralizing linear epitope. These results will help elucidate the antigenic epitopes of the HN and facilitate the development of NDV vaccines.

Recently, genotype VII of Newcastle disease virus (NDV) has become the most prevalent NDV genotype in Asia. Here the hemagglutinin-neuraminidase (HN) gene of genotype VII NDV strains isolated in Japan was analyzed. Notably, point amino acid substitutions in the HN protein at position 347, which is located on the major linear epitope of the HN protein, were found in two strains. However, by a hemagglutination inhibition assay, major antigenic differences did not exist between the studied strains. Additionally, chickens vaccinated with the B1 strain did not exhibit clinical effects after challenge with variants possessing the substitution at position 347 (E to K), whereas all unvaccinated chickens subjected to this challenge died within 5 days. [ABSTRACT FROM AUTHOR]

ABSTRACT: The antiviral mechanism of sulfated polysaccharides is supposed to prevent virus entry, which is mediated by the interactions of anionic charges on sulfated polysaccharides with positively charged domains of viral envelope glycoproteins, leading to shielding of the functional domain involved in virus attachment to cell surface receptors. But, few direct evidences were reported. In the previous study, we found that sulfated Chuanmingshen violaceum polysaccharides (sCVPS) possessed remarkable inhibitory effect against Newcastle disease virus (NDV) through inhibition of NDV attachment to host cells. Whether sCVPS bound to hemagglutinin-neuraminidase (HN) leading to inhibition of NDV attachment needs to be further clarified. The present study conducted site-directed mutagenesis of possible positively charged residues of HN, and found that mutants R197G, H199G, R363G, and R523G could significantly decrease the inhibitory effects of sCVPS on receptor binding ability through hemadsorption assay, especially R363G which suggested that binding to R363 is more effective to shield the sialic acid binding sites. Dual mutants (R363G/R197G, R363G/H199G and R363G/R523G) induced more decreased inhibitory effect of sCVPS than single mutants. The immunofluorescence study using FITC-labeled sCVPS found that the fluorescence intensity of mutants R363G and R363G/H199G were significantly decreased. The binding kinetics of sCVPS to HN measured by surface plasmon resonance indicated that sCVPS had a higher binding affinity for wild-type HN than mutants R363G and R363G/H199G. Plaque reduction study was performed using recombinant NDV with mutant HNR363G and HNR363G/H199G, which showed significantly decreased inhibitory effects of sCVPS against mutant NDV adsorption to BHK-21 cells. These results suggested that the residues R197, H199, R363, and R523 were the binding sites for sCVPS, especially R363 act as the main interaction site. The present study provided direct evidence for the theory that antiviral mechanism of sulfated polysaccharides attributed to anionic groups binding to the positively charged residues of viral proteins which led to the shielding of receptor binding sites.

Background: The hemagglutinin-neuraminidase (HN) protein of Newcastle disease virus (NDV) is a major antigen that can induce protective antibodies in poultry. However, its antigenic epitopes have not been fully elucidated. Therefore, defining the linear epitopes of HN, especially neutralizing epitopes, will be useful for revealing its antigenic characterization. Methods: In this study, we analyzed B-cell immunodominant epitopes (IDEs) of the HN protein from the vaccine strain LaSota using pepscan technology with LaSota-specific chicken hyperimmune antisera. We constructed IDEs-RFP plasmids and prepared anti-IDEs peptide mouse sera to identify IDEs through immunological tests. At last, the different diluted anti-IDE antisera were used in BHK-21 cells to perform the neutralization test. Results: Five IDEs of the HN were screened and further verified by indirect immunofluorescence assays, dot blots and Western blots with NDV- and IDEs-specific antisera. All five IDEs showed good immunogenicity. IDE5 (328–342 aa) could recognize only class II NDV but did not react with the class I strain. Most of the IDEs are highly conserved among the different strains. A neutralization test in vitro showed that the peptide-specific mouse antisera of IDE4 (242–256 aa) and HN341-355, a reported neutralizing linear epitope, could partially neutralize avirulent LaSota as well as virulent strains at similar levels, suggesting that IDE4 might be a potential neutralizing linear epitope. Conclusion: The HN protein is a major protective antigen of NDV that can induce neutralizing antibodies in animals. We identified five IDEs of the HN using a pepscan approach with NDV-specific chicken hyperimmune antisera. The five IDEs could elicit specific antibodies in mice. IDE4 (242–256 aa) was identified as a novel potential neutralizing linear epitope. These results will help elucidate the antigenic epitopes of the HN and facilitate the development of NDV vaccines. [ABSTRACT FROM AUTHOR]

Copyright of Archives of Razi Institute is the property of Institut Razi and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Five decades have passed since the first mumps vaccine was licensed. Over this period, a resurgence of mumps infections has been recorded worldwide. Although global mumps infections have been controlled through vaccination, outbreaks are still on the rise, including in populations with high vaccination coverage. Several epidemiological studies suggest that this infectious virus continues to be a worldwide public health threat. The development and deployment of an improved, prophylactic mumps vaccine that provides long-lasting protection is indeed a priority. The purpose of this review is to provide an immuno-biological perspective on mumps vaccines. Here, we review the virology of mumps, licensed mumps vaccines, and the typical immune responses elicited following mumps vaccination. Furthermore, we discuss the limitations and challenges of the currently licensed mumps vaccines and provide strategies for the development of an improved mumps vaccine.

Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains. Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program. Results: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%. Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Fusion (F) and Hemagglutinin-neuraminidase (HN) glycoproteins of Newcastle disease virus containing important epitopes play crucial role in stimulation of humoral and cell-mediated immunity of the host. In the present study we analyzed and compared genetic diversity of F and HN sequences related to long-term circulating sub-genotype VIIj isolates to genotype VII and II strains. In addition, F and HN epitope prediction was performed using IEDB, NetMHC 4.0 and NetMHC II 3.1 servers. Molecular docking analysis was also conducted for VIIj and LaSota isolates interacting MHC I and II molecules. Results indicated that certain specific mutations were occurred in Fusion and Hemagglutinin-neuraminidase proteins of VIIj sub-genotype. Epitope prediction study revealed that the unique variations were located on the antigenic site regions of F and HN glycoproteins. Furthermore, docking interaction analysis showed surprising results, in which defined antigenic site residues of VIIj isolates interacted to MHC molecules with higher affinity levels rather than LaSota strains used as vaccines. Our in silico results suggest that by applying certain epitope sequences inducing both immune responses, vaccination failures may be reduced and challenged vaccinated host cells may stop viral shedding beside protection from Newcastle disease infection. Thus, we recommend the introduced antigenic sites of VIIj sub-genotype in this paper would act as the great targets for epitope-based vaccine design in the region. [ABSTRACT FROM AUTHOR]

Five decades have passed since the first mumps vaccine was licensed. Over this period, a resurgence of mumps infections has been recorded worldwide. Although global mumps infections have been controlled through vaccination, outbreaks are still on the rise, including in populations with high vaccination coverage. Several epidemiological studies suggest that this infectious virus continues to be a worldwide public health threat. The development and deployment of an improved, prophylactic mumps vaccine that provides long-lasting protection is indeed a priority. The purpose of this review is to provide an immuno-biological perspective on mumps vaccines. Here, we review the virology of mumps, licensed mumps vaccines, and the typical immune responses elicited following mumps vaccination. Furthermore, we discuss the limitations and challenges of the currently licensed mumps vaccines and provide strategies for the development of an improved mumps vaccine. [ABSTRACT FROM AUTHOR]

• Extraction and two-stage purification strategy was developed to obtain rHN (∼95%). • Quantitative ELISA developed using purified rHN reference standards was validated. • Recovery of rHN at different stages of purification was monitored. • Optimal HI antibody titers and reduction in virus shedding were correlated to rHN dose. • Developed ELISA facilitates process monitoring and vaccine potency assessment. Recombinant hemagglutinin-neuraminidase (HN) based subunit vaccine, which is non-infectious and can be produced using insect cell-culture systems, is a potential alternative to conventional live and inactivated Newcastle disease virus (NDV) vaccines. However, process development for manufacture and efficacy assessment of HN subunit vaccines has been hampered by the absence of reference standards, a cornerstone for robust and sensitive quantitative analytical methods. In this work, a downstream purification strategy was developed to obtain NDV HN which was expressed with a hexa-histidine fusion tag (rHN) to facilitate detection using generic antibodies. Highly purified rHN (∼95%) attained after detergent extraction and two-stage ion-exchange-hydroxyapatite column chromatography was subsequently utilized as reference standards for quantitative ELISA development. Recovery of rHN at different stages of purification was monitored. Quantitation of rHN from crude cell lysates was performed for dose-ranging antibody response and protective efficacy studies. A higher dose (1500 ng) of rHN was correlated to a significant reduction in virus shedding and attainment of herd immunity, as indicated by a higher proportion of chickens (92%) with hemagglutination inhibition (HI) antibody titers ≥ log 2 3. The outcome of this study, shows the importance of downstream process development in enabling robust quantitation and efficacy assessment of a recombinant subunit vaccine. [ABSTRACT FROM AUTHOR]

Mumps virus (MuV), an enveloped negative-strand RNA virus belonging to the family Paramyxoviridae, enters the host cell through membrane fusion mediated by two viral envelope proteins, an attachment protein hemagglutinin-neuraminidase (MuVHN) and a fusion (F) protein. However, how the binding of MuV-HN to glycan receptors triggers membrane fusion is not well understood. The crystal structure of the MuV-HN head domain forms a tetramer (dimer of dimers) like other paramyxovirus attachment proteins. In the structure, a sulfate ion (SO4 2-) was found at the interface between two dimers, which may be replaced by a hydrogen phosphate ion (HPO4 2-) under physiological conditions. The anion is captured by the side chain of a positively charged arginine residue at position 139 of one monomer each from both dimers. Substitution of alanine or lysine for arginine at this position compromised the fusion support activity of MuV-HN without affecting its cell surface expression, glycan-receptor binding, and interaction with the F protein. Furthermore, the substitution appeared to affect the tetramer formation of the head domain as revealed by blue native-PAGE analysis. These results, together with our previous similar findings with the measles virus attachment protein head domain, suggest that the dimer-dimer interaction within the tetramer may play an important role in triggering membrane fusion during paramyxovirus entry. [ABSTRACT FROM AUTHOR]

• We generated a new ScFv specific for chicken endocytic receptor DEC 205. • Inoculation of E. coli expressed antigens fused to ScFv against DEC 205 increased the immune response in chickens. • Inoculation of E. coli expressed hemagglutinin-neuraminidase fused to ScFv against DEC 205 produce neutralizing antibodies. Targeting antigens to endocytic receptors on the surface of dendritic cells is a new strategy for increasing the adaptive immune response. The objective of the current study was the construction and bacterial expression of a recombinant antibody single-chain fragment variable (ScFv) directed against chicken DEC 205, an endocytic receptor, for use in the genetic fusion of antigens. In particular, we use as antigen the hemagglutinin-neuraminidase (HN) of Newcastle disease virus. Our results show that inoculation of chickens with HN genetically fused to the ScFv anti-DEC 205 induced an evidently higher immune response against HN, in contrast to inoculation with unconjugated HN. In addition, neutralizing antibodies against Newcastle disease virus were detected only in the serum from chickens immunized with HN fused to ScFv anti-DEC 205. Inoculated fused antigens to ScFv against endocytic receptor DEC 205 resulted in a greater antibody-specific anti-HN production compared with antigens applied alone. The results of this study show that the strategy described here has the potential to be used in the development of more effective vaccines against infectious diseases in chickens. [ABSTRACT FROM AUTHOR]

Previously we reported on the HPIV2 genotype distribution in Croatia 2011-2014. Here we expand this period up to 2017 and confirm that G1a genotype has replaced G3 genotype from the period 2011-2014. Our hypothesis was that the G1a-to-G3 genotype replacement is an antibody-driven event. A cross-neutralisation with anti-HPIV2 sera specific for either G1a or G3 genotype revealed the presence of genotype-specific antigenic determinants. By the profound, in silico analyses three potential B cell epitopic regions were identified in the hemagglutinin neuraminidase (regions 314-361 and 474-490) and fusion protein (region 440-484). The region identified in the fusion protein does not show any unique site between the G1a and G3 isolates, five differentially glycosylated sites in the G1a and G3 genotype isolates were identified in epitopic regions of hemagglutinin neuraminidase. All positively selected codons were found to be located either in the region 314-316 or in the region 474-490 what indicates a strong positive selection in this region and reveals that these regions are susceptible to evolutionary pressure possibly caused by antibodies what gives a strong verification to our hypothesis that neutralising antibodies are a key determinant in the inherently complex adaptive evolution of HPIV2 in the region. [ABSTRACT FROM AUTHOR]

Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains. Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program. Results: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%. Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures. [ABSTRACT FROM AUTHOR]

Background Severe acute respiratory infection (SARI) threatens human health and even survival, causing a huge number of hospitalized patients every year. However, as one of the most common respiratory viruses circulated worldwide, the epidemiological and phylogenetic characteristics of human parainfluenza virus (HPIV) in these cases were not well known. Objectives To reveal the epidemiological features of HPIV infection in SARIs in Beijing area from September 2014 to August 2016. Methods A total of 1229 SARI cases in Beijing area were enrolled, investigated, sampled, and tested by multiplex real-time PCR to identify HPIVs and other common respiratory viruses. Eighteen HPIV-3 viruses isolated from all HPIV-positive samples in these SARI cases were sequenced and analyzed. Results Among all enrolled cases, 0.81%, 0.73%, 4.48%, and 0.57% were positive for HPIV-1 to HPIV-4, respectively. The highest yield rate of HPIV infection occurred in children under 5 years old (9.07%), followed by the patients over 60 years old (6.02%). The phylogenetic information of HPIV-3 showed that all viruses belonged to Cluster C3a. Conclusions Besides the young children, the elders older than 60 years also showed a relatively high infection rate of HPIVs, which should be given comparable attentions. Moreover, the HPIV-3 circulating in China undergoes continued evolution, suggesting the potential risk of evolved HPIV infection should not be overlooked. [ABSTRACT FROM AUTHOR]

Blue eye disease caused by Porcine rubulavirus (PorPV) is an endemic viral infection of swine causing neurological and respiratory disease in piglets, and reproductive failure in sows and boars. The hemagglutinin-neuraminidase (HN) glycoprotein of PorPV is the most abundant component in the viral envelope and the main target of the immune response in infected animals. In this study, we expressed the HN-PorPV-recombinant ( r HN-PorPV) protein in an Escherichia coli system and analyzed the immune responses in mice. The HN gene was cloned from the reference strain PorPV-La Piedad Michoacan Virus (GenBank accession number BK005918 ), into the pDual expression vector. The expressed protein was identified at a molecular weight of 61.7 kDa. Three-dimensional modeling showed that the main conformational and functional domains of the r HN-PorPV protein were preserved. The antigenicity of the expressed protein was confirmed by Western blot with a monoclonal antibody recognizing the HN, and by testing against serum samples from pigs experimentally infected with PorPV. The immunogenicity of the r HN-PorPV protein was tested by inoculation of BALB/c mice with AbISCO-100 ® as adjuvant. Analysis of the humoral immune responses in mice showed an increased level of specific antibodies 14 days after the first immunization, compared to the control group ( P < 0.0005). The results show the ability of the r HN-PorPV protein to induce an antibody response in mice. Due to its immunogenic potential, the r HN-PorPV protein will be further evaluated in pig trials for its suitability for prevention and control of blue eye disease. [ABSTRACT FROM AUTHOR]

El Rubulavirus porcino causa un síndrome neurológico y reproductivo en cerdos, hasta ahora reportado sólo en México. Los virus aislados se agrupan de acuerdo con los síntomas principales observados durante los brotes en: a) neutrópicos en lechones, b) neurotrópicos en lechones/gonadotrópicos en adultos y c) gonadotrópicos en adultos. En este trabajo se estudiaron tres cepas: La Piedad Michoacán (LPM) y Producción Animal "Cerdos" 1 (PAC1) y 3 (PAC3), ubicadas respectivamente en cada grupo. Las propiedades estudiadas se relacionan principalmente con dos proteínas de la envoltura viral, la hemaglutinina-neuraminidasa (HN) y la proteína de fusión (F). Se cuantificaron el efecto citopático y las actividades de hemólisis, hemaglutinación (HA) y neuraminidasa (NA). En cultivo celular la cepa PAC1 presentó una mayor actividad fusogénica, sin embargo PAC3 presentó la mayor actividad citolítica. La cepa PAC3 fue la primera en ser detectada en sobrenadante de células infectadas (HA, NA y genoma), lo que muestra que sus viriones son liberados al medio antes que las otras dos cepas. PAC3 tuvo las actividades más altas de HA y NA, sin embargo, PAC1 presentó una mayor termoestabilidad en estas actividades de HN y un perfil de substrato algo distinto de los observados para LPM y PAC3. Estos datos sugieren que la actividad de NA está relacionada con la virulencia del RVP.Biological characterization of three natural isolates of the porcine rubulavirus (Mexico). Porcine rubulavirus (PoRV) produces a neurological and reproductive syndrome in pigs called the blue-eye disease, known only from Mexico. Several isolates were grouped by the main symptoms presented during outbreaks: a) neurotropic in piglets, b) broadly neurotropic in piglets and gonadotropic in adults, and c) gonadotropic in adults. We studied some biological properties of three strains, which fall in one of each virus group: La Piedad Michoacán (LPM) and Producción Animal Cerdos 1 (PAC1) and 3 (PAC3), respectively. The analyzed viral properties are mainly related with the trans-membrane hemagglutinin-neuraminidase (HN) and fusion (F) proteins, such as cytopathic effect, hemolysis, hemagglutinating (HA) and neuraminidase (NA) activities. In the infection assays PAC1 strain presented the highest fusogenicity level; however, the most cytolytic strain was PAC3. In addition, HA and NA activities and viral genome of PAC3 strain was detected in supernatants during cell infection earlier than in the other two strains, which shows that PAC3 virions release from the host cell earlier than LPM and PAC1. Experimental determination in purified viruses shows that PAC3 presented a higher HA and NA activities; however, PAC1 shows other interesting properties, such as a high thermostability of HN and differences about substrate profile respect to LPM and PAC3. Our data suggest that NA activity is associated with the virulence of RVP. Rev. Biol. Trop. 56 (2): 487-499. Epub 2008 June 30.

Global infections with viruses belonging to the Paramyxoviridae , such as Newcastle disease virus (NDV) or human parainfluenza viruses (hPIVs), pose a serious threat to animal and human health. NDV-HN and hPIVs-HN (HN hemagglutinin-neuraminidase) share a high degree of similarity in catalytic site structures; therefore, the development of an efficient experimental NDV host model (chicken) may be informative for evaluating the efficacy of hPIVs-HN inhibitors. As part of the broad research in pursuit of this goal and as an extension of our published work on antiviral drug development, we report here the biological results obtained with some newly synthesized C4- and C5-substituted 2,3-unsaturated sialic acid derivatives against NDV. All developed compounds showed high neuraminidase inhibitory activity (IC 50 0.03-13 μM). Four molecules ( 9 , 10 , 23 , 24 ) confirmed their high in vitro inhibitory activity, which caused a significant reduction of NDV infection in Vero cells , accompanied by very low toxicity.

Newcastle disease virus (NDV) is an intrinsically tumor-specific virus, many researchers have reported that lentogenic NDV is a safe and effective agent for human cancer therapy. It had been demonstrated that the amino acid sequence of the fusion protein cleavage site is a major factor in the pathogenicity and anti-tumor efficacy of rNDV. However, the role of Hemagglutinin-Neuraminidase (HN) gene that contributes to virulence and anti-tumor efficacy remains undefined. To assess the role of HN gene in virus pathogenicity and anti-tumor efficacy, a reverse genetic system was developed using the lentogenic NDV Clone30 strain to provide backbone for gene exchange. Chimeric virus (rClone30-Anh(HN)) created by exchange of the HN gene of lentogenic strain Clone30 with HN gene of mesogenic strain produce no significant changes in virus pathogenicity as assessed by conducting the mean death time (MDT) and intracerebral pathogenicity index (ICPI) assays. In vitro , infection with chimeras could induce the formation of syncytium relative significantly in HepG2 cells. Furthermore, chimeras was shown to induce the cell apoptosis via MTT and Annexin V-PI assays, reduce mitochondrial membrane potential and increase the mRNA transcription level of caspase 3. In vivo , ICR mice carrying tumor of hepatoma H22 cells were treated via intratumoral injection of chimeric virus. The treatment of chimera shows an obvious suppression in tumor volume. These results suggest that it could be an ideal approach to enhance the antitumor ability of Newcastle disease virus and highlighted the potential therapeutic application of rClone30-Anh(HN) as a viral vector to deliver foreign genes for treatment of cancers. [ABSTRACT FROM AUTHOR]

Blue-eye disease (BED) of swine is a viral disease endemic in Mexico. The etiological agent is a paramyxovirus classified as Porcine rubulavirus (PoRV-LPMV), which exhibits in its envelope the hemagglutinin-neuraminidase (HN) glycoprotein, the most immunogenic and a major target for vaccine development. We report in this study the obtaining of ectodomain of PoRV HN (eHN) through the Pichia pastoris expression system. The expression vector (pPICZαB-HN) was integrated by displacement into the yeast chromosome and resulted in a Mut + phenotype. Expressed eHN in the P. pastoris X33 strain was recovered from cell-free medium, featuring up to 67 nmol/min/mg after 6 days of expression. eHN was recognized by the serum of infected pigs with strains currently circulating in the Mexican Bajio region. eHN induces antibodies in mice after 28 days of immunization with specific recognition in ELISA test. These antibodies were able to inhibit >80% replication by viral neutralization assays in cell culture. These studies show the obtaining of a protein with similar characteristics to the native HN and which may be a candidate to propose a vaccine or to use the antigen in a serologic diagnostic test. [ABSTRACT FROM AUTHOR]

Human parainfluenza virus type 3 (hPIV3) recognizes both α2,3- and α2,6-linked sialic acids, whereas human parainfluenza virus type 1 (hPIV1) recognizes only α2,3-linked sialic acids. To identify amino acid residues that confer α2,6-linked sialic acid recognition of hPIV3, amino acid residues in or neighboring the sialic acid binding pocket of the hPIV3 hemagglutinin–neuraminidase (HN) glycoprotein were substituted for the corresponding residues of hPIV1 HN. Hemadsorption assay with sialyl linkage-modified red blood cells indicated that amino acid residues at positions 275, 277, 372, and 426 contribute to α2,6-linked sialic acid recognition of the HN3 glycoprotein. [ABSTRACT FROM AUTHOR]