Search

During recent decades, global warming has intensified, altering crop growth, development and survival. To overcome changes in their environment, plants undergo transcriptional reprogramming to activate stress response strategies/pathways. To evaluate the genetic bases of the response to heat stress, Conserved DNA-derived Polymorphism (CDDP) markers were applied across tomato genome of eight cultivars. Despite scattered genotypes, cluster analysis allowed two neighbouring panels to be discriminate. Tomato CDDP-genotypic and visual phenotypic assortment permitted the selection of two contrasting heat-tolerant and heat-sensitive cultivars. Further analysis explored differential expression in transcript levels of genes, encoding heat shock transcription factors (HSFs, HsfA1, HsfA2, HsfB1), members of the heat shock protein (HSP) family (HSP101, HSP17, HSP90) and ascorbate peroxidase (APX) enzymes (APX1, APX2). Based on discriminating CDDP-markers, a protein functional network was built allowing prediction of candidate genes and their regulating miRNA. Expression patterns analysis revealed that miR156d and miR397 were heat-responsive showing a typical inverse relation with the abundance of their target gene transcripts. Heat stress is inducing a set of candidate genes, whose expression seems to be modulated through a complex regulatory network. Integrating genetic resource data is required for identifying valuable tomato genotypes that can be considered in marker-assisted breeding programmes to improve tomato heat tolerance.

Tomato yellow leaf curl disease (TYLCD) and salinity stress adversely affect tomato production worldwide by causing extensive damages. In Tunisia, identifying TYLCD resistant cultivars selected in different environments is useful to devise counter-measures. To this end, 20 tomato commercial cultivars were screened for different Ty gene alleles’ combinations and evaluated either for TYLCD incidence or salinity constraint. We built a biological multi-layer network for integrating, visualizing and modelling generated data. It is a simple representation view linking allelic combinations to tomato cultivars behaviour under viral and salt stresses. In addition, we analyzed differential expression of transcriptions factors (TFs) belonging to WRKY and ERF families in selected resistant (R) and susceptible (S) tomato cultivars. Gene expression was evaluated for short- and long stress exposure to either TYLCSV infection or to both viral and salinity stresses. Evidence is that TFs promote resistance to abiotic and biotic stresses through a complex regulatory network. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (10.1007/s12298-020-00835-w) contains supplementary material, which is available to authorized users.

Guanosine pentaphosphate and tetraphosphate (together referred to as ppGpp) are hyperphosphorylated nucleotides found in bacteria and the chloroplasts of plants and algae. In plants and algae artificial ppGpp accumulation can inhibit chloroplast gene expression, and influence photosynthesis, nutrient remobilization, growth, and immunity. However, it is so far unknown whether ppGpp is required for abiotic stress acclimation in plants. Here, we demonstrate that ppGpp biosynthesis is necessary for acclimation to nitrogen starvation in Arabidopsis. We show that ppGpp is required for remodeling the photosynthetic electron transport chain to downregulate photosynthetic activity and for protection against oxidative stress. Furthermore, we demonstrate that ppGpp is required for coupling chloroplastic and nuclear gene expression during nitrogen starvation. Altogether, our work indicates that ppGpp is a pivotal regulator of chloroplast activity for stress acclimation in plants.

Guanosine pentaphosphate and tetraphosphate (together referred to as ppGpp) are hyperphosphorylated nucleotides found in bacteria and the chloroplasts of plants and algae. In plants and algae artificial ppGpp accumulation can inhibit chloroplast gene expression, and influence photosynthesis, nutrient remobilisation, growth, and immunity. However, it is so far unknown whether ppGpp is required for abiotic stress acclimation in plants. Here, we demonstrate that ppGpp biosynthesis is necessary for acclimation to nitrogen starvation in Arabidopsis. We show that ppGpp is required for remodeling the photosynthetic electron transport chain to downregulate photosynthetic activity and for protection against oxidative stress. Furthermore, we demonstrate that ppGpp is required for coupling chloroplastic and nuclear gene expression during nitrogen starvation. Altogether, our work indicates that ppGpp is a pivotal regulator of chloroplast activity for stress acclimation in plants.

Translation initiation factors 4E (eIF4E) are the main source of resistance to potyvirus. We systematically assessed tomato single and double knock-out (KO) mutants of members of the eIF4E-coding gene family for resistance to Pepper veinal mottle virus (PVMV), a major constraint to tomato production. We show that the KO mutant of eIF4E2 has partial resistance to PVMV isolate IC, with plants harboring weak symptoms and low virus loads at the systemic level. The causal effect of eIF4E2 loss-of-function on resistance was confirmed on a progeny segregating for the KO mutation. The eIF4E2 KO mutant was resistant to six of the eight PVMV isolates tested and no resistance to other potyviruses was observed. This is the first evidence that mutation of eIF4E2 is in itself conferring resistance to a potyvirus and 3D protein modelling suggests that the eIF4E2 gene could be converted into a functional resistance allele.

[EN] Tomato spotted wilt virus (TSWV) causes severe losses of tomato crops worldwide. To cope dynamically with such a threat, plants deploy strategies acting at the molecular and the epigenetic levels. We found that tomato symptoms progress in a specific-genotype-manner upon TSWV infection. Susceptible genotypes showed within the Auxin Response Factor (ARF8) promoter coupled to enhanced expression of miRNA167a, reduced ARF8 gene and decreased levels of the hormone auxin. This constitutes a deliberate attempt of TSWV to disrupt plant growth to promote spread in sensitive cultivars. Epigenetic regulation through the level of cytosine methylation and the miR167a-ARF8 module are part of a complex network modulating auxin-triggered synthesis and shaping tomato responses to TSWV. Furthermore, modulation of miR167a-ARF8 regulatory module could be applied in tomato-resistance breeding programs, This work was financially supported by the Ministry of Higher Education and Scientific Research of Tunisia

Chloroplasts can act as key players in the perception and acclimatization of plants to incoming environmental signals. A growing body of evidence indicates that chloroplasts play a critical role in plant immunity. Chloroplast function can be regulated by the nucleotides guanosine tetraphosphate and pentaphosphate [(p)ppGpp]. In plants, (p)ppGpp levels increase in response to abiotic stress and to plant hormones which are involved in abiotic and biotic stress signalling. In this study, we analysed the transcriptome of Arabidopsis plants that over-accumulate (p)ppGpp, and unexpectedly found a decrease in the levels of a broad range of transcripts for plant defence and immunity. To determine whether (p)ppGpp is involved in the modulation of plant immunity, we analysed the susceptibility of plants with different levels of (p)ppGpp to Turnip mosaic virus (TuMV) carrying a green fluorescent protein (GFP) reporter. We found that (p)ppGpp accumulation was associated with increased susceptibility to TuMV and reduced levels of the defence hormone salicylic acid (SA). In contrast, plants with lower (p)ppGpp levels showed reduced susceptibility to TuMV, and this was associated with the precocious up-regulation of defence-related genes and increased SA content. We have therefore demonstrated a new link between (p)ppGpp metabolism and plant immunity in Arabidopsis.

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

Almond (Prunus dulcis Mill) is an important crop in countries of the Mediterranean area. Until now, among viroids, only Hop stunt viroid (HSVd) is known to infect cultivated almond trees (2). In 2004, a survey of almond trees was carried out in orchards in different regions of Tunisia, a major producing and exporting country of almond. Symptoms such as mosaic and necrotic lesions, potentially caused by the Peach latent mosaic viroid (PLMVd), were observed on leaves of cultivated almond trees. Since PLMVd was recently detected in peach and pear trees in Tunisia (4), the presence of this viroid in almond trees was studied. The detection method on the basis of one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays was previously described and validated for the detection of this viroid in fruit trees (4). Amplification products were obtained by using previously reported primer pairs of PLMVd (1). Positive controls included RNA preparations of twigs of PLMVd-infected GF 305 peach seedlings. These materials, provided by B. Pradier (Station de Quarantaine des Ligneux, Lempdes, France), were positive as revealed by chip budding on peach seedling indicator plants grown under greenhouse conditions. RT-PCR analysis of nucleic acid preparations from leaves of almond showed specific amplification products with the expected size of 337 bp for two almond trees among 17 trees tested. Nucleotide sequence analyses of cloned amplification products obtained with the PLMVd primers confirmed a size of 337 bp and revealed a sequence similar to sequences from other PLMVd isolates previously characterized. The sequences shared 94 to 98% identity with the reference isolates of PLMVd from peach (EMBL Accession No. M83545, AF170511, AF170514, and AY685181). The two infected almond trees are proximal to each other and peach trees infected with PLMVd. This suggests that one tree may have served as a source of inoculum for the other through agronomic practices such as pruning or the aphid Myzus percicae (3). Alternatively, PLMVd may have originated in an unknown host and was then transmitted to almond trees. Our investigation shows that almond is a new host for PLMVd. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañizares et al. Eur. J. Plant Pathol. 105:553, 1999. (3) J. C. Desvignes et al. Phytoma 444:70, 1992. (4) I. Fekih Hassen et al. Plant Dis. 88:1164, 2004.

The potyvirus Lettuce mosaic virus (LMV) is a common pathogen of lettuce crops worldwide, but it also infects other Asteraceae spp. including ornamentals (2,3,4). Cape daisies (Osteospermum sp.) are widely grown perennial ornamentals reported to be natural hosts of LMV (2,4), which causes faint leaf mosaic and sometimes mild flower breaking. A preliminary observation of mosaic symptoms prompted a large-scale survey during the spring of 2005 in Cape daisies grown in the Tunis metropolitan area and the south of Tunisia (Djerba, Medenine). Two hundred seventy-one samples (Tunis: 14 sites, 219 samples; South: 9 sites, 52 samples) were randomly collected from nurseries, roadway plantings, and home gardens and analyzed. Ninety-three samples (Tunis: 40%, South: 12%; overall: 34%) showed distinct mosaic symptoms. LMV infection was verified by immuno-tissue printing on all collected samples (1), providing evidence for even higher infection levels (Tunis: 60%; South: 25%; overall: 56%). This technique, therefore, allowed the detection of symptomless infection in a significant proportion of samples. It should however, be stressed that symptoms can be very difficult to observe in water-stressed plants, a situation frequently observed in Tunisia. Subsequent PCR analysis with LMV-specific primers (1) of a subset of 24 symptomatic and tissue-print-positive samples confirmed LMV infection in all cases. This is to our knowledge, the first report of LMV infection in Cape daisies in Tunisia. The very high rate of infection observed suggests that these popular ornamentals might constitute a reservoir of LMV as previously reported in the United States (4). References: (1) H. Fakhfakh et al. J. Plant Pathol. 83:3, 2001. (2) R. Jordan and M. Guaragna. (Abstr.) Phytopathology 96(suppl.):S56, 2006. (3) O. Le Gall. No. 399 in: Description of Plant Viruses. A. T. Jones et al., eds. CMI/AAB, Kew, Surrey, UK, 2003. (4) D. C. Opgenorth et al. Plant Dis. 75:751, 1991.

Salt stress was applied to tomato commercial genotypes to study adverse effects on their phenotypic traits. Three were saline tolerant (San Miguel, Romelia and Llanero), two were mildly tolerant (Perfect peel HF1 and Heinz 1350) whereas the remaining were sensitive. Genotyping cultivars using 19 polymorphic SSRs out of 25 tested produced a total of 70 alleles with an average of 3.68 alleles per locus and PIC values ranging from 0.22 (SSR 26, 92, 66 and TG35) to 0.82 (SSR 356). Principal component analysis (PCA) showed two contrasting panels discriminating tolerant and sensitive groups and one panel with scattered genotypes. STRUCTURE analysis clustered genotypes within three groups in accordance with their salt stress behavior. The success of tomato salt-tolerance breeding programs can be enhanced through molecular characterization of diversity within commercial cultivars that adapt differently to stress conditions. To this end, we combined phenotypes and SSR marker-genotypes to seek sources of salt tolerance that might be tomato species-specific. We integrated and represented genotype-phenotype associations from multiple loci into a multi-layer network representation. It is a systemic view linking discriminating genotypes to salt stress phenotypes, which may guide strategies for the introgression of valuable traits in target tomato varieties to overcome salinity.

International audience; Combining landscape ecology and genetics provides an excellent framework to appreciate pest population dynamics and dispersal. The genetic architectures of many species are always shaped by environmental constraints. Because little is known about the ecological and genetic traits of Tunisian whitefly populations, the main objective of this work is to highlight patterns of biodiversity, genetic structure and migration routes of this pest. We used nuclear microsatellite loci to analyze B. tabaci populations collected from various agricultural areas across the country and we determine their biotype status. Molecular data were subsequently interpreted in an ecological context supplied from a species distribution model to infer habitat suitability and hereafter the potential connection paths between sampling localities. An analysis of landscape resistance to B. tabaci genetic flow was thus applied to take into account habitat suitability, genetic relatedness and functional connectivity of habitats within a varied landscape matrix. We shed light on the occurrence of three geographically delineated genetic groups with high levels of genetic differentiation within each of them. Potential migration corridors of this pest were then established providing significant advances toward the understanding of genetic features and the dynamic dispersal of this pest. This study supports the hypothesis of a long-distance dispersal of B. tabaci followed by infrequent long-term isolations. The Inference of population sources and colonization routes is critical for the design and implementation of accurate management strategies against this pest.

We tested citrus samples from Tunisia using reverse transcription-polymerase chain reaction (RT-PCR), and for the first time, Citrus viroid V (CVd-V) was reported in North Africa. Fourteen of 38 tested citrus trees were infected by CVd-V including the majority of varieties grown in Tunisia. Some RT-PCR results were also supported by biological indexing. After sequencing the RT-PCR products, three new CVd-V variants were identified, showing 80–91 % nucleotide sequence identity with those reported previously. Based on phylogenetic analysis using all CVd-V sequences in GenBank, two main CVd-V groups were identified. Furthermore, construction of a genetic network of the detected haplotypes using the same sequences shows a clear geographical structuring of Tunisian CVd-V variants.

A one-step RT-PCR was used to identify Tomato chlorosis virus (ToCV) (Crinivirus members) infections on some Tunisian cultures. Results provided evidence that the ToCV is the most prevalent virus on Tunisian tomato crops. Findings were validated with specific primers. Genetic analysis of ToCV isolates was explored based on sequence data of viral segments within the coat protein (CP), the heat shock protein (HSP70h) and the polymerase protein (RdRp). Synonymous (dS) and non-synonymous (dN) substitution rates and their ratio were analyzed. The patterns of mutations were shaped depending on the considered fragment from the three viral regions. Selective neutrality test was significantly negative, suggesting a recent expansion of ToCV isolates. Pairwise mismatch distribution gave a bimodal pattern and pointed to the clustering of ToCV isolates into two distinct geographical clades. Genetic haplotype network provided evidence of the existence of two distinct clusters. The star-like shaped pattern confirmed recent expansion of ToCV isolates.

In Tunisia, potato virus Y (PVY) currently presents a significant threat to potato production, reducing tuber yield and quality. Three hundred and eighty-five potato samples (six different cultivars) collected in autumn 2007 from nine regions in Tunisia were tested for PVY infection by DAS-ELISA. The virus was detected in all regions surveyed, with an average incidence of 80.26%. Subsequently, a panel of 82 Tunisian PVY isolates (PVY-TN) was subjected to systematic biological, serological and molecular typing using immunocapture reverse-transcription polymerase chain reaction and a series of PVY(OC)- and PVY(N)-specific monoclonal antibodies. Combined analyses revealed ~67% of PVY(NTN) variants of which 17 were sequenced in the 5'NTR-P1 region to assess the genetic diversity and phylogenetic relationship of PVY-TN against other worldwide PVY isolates. To investigate whether selective constraints could act on viral genomic RNA, synonymous and non-synonymous substitution rates and their ratio were analyzed. Averages of all pairwise comparisons obtained in the 5'NTR-P1 region allowed more synonymous changes, suggesting selective constraint acting in this region. Selective neutrality test was significantly negative, suggesting a rapid expansion of PVY isolates. Pairwise mismatch distribution gave a bimodal pattern and pointed to an eventually early evolution characterizing these sequences. Genetic haplotype network topology provided evidence of the existence of a distinct geographical structure. This is the first report of such genetic analyses conducted on PVY isolates from Tunisia.

The pathogenic properties of Potato virus Y (PVY; genus Potyvirus, family Potyviridae) isolates collected in naturally infected pepper (Capsicum annuum) fields in Tunisia were evaluated against recessive resistance alleles at the pvr2 locus of pepper. Two pathotypes were observed. Pathotype (0,1,3) isolates were able to infect plants carrying the susceptibility allele pvr2+, together with pvr21/pvr21 and pvr23/pvr23 plants, but not pvr22/pvr22 plants. Pathotype (0) isolates were only able to infect pvr2+/pvr2+ plants. On the other hand, sequence data and phylogenetic analyses revealed three major groups of isolates, each characterized by particular amino acid residues in the central part of the VPg, the pathogenicity factor towards pvr2. Correspondence between pathogenic properties and phylogeny suggested a single evolutionary step for pathogenicity towards the pvr21 and pvr23 resistances, possibly under the selective pressure of pvr21. Indeed, 23% of the pepper plants in this area were shown to carry the pvr21 resistance, while pvr23 was not detected. The data suggested that pathogenicity towards pvr21 and pvr23 were not costly for PVY to infect susceptible pepper genotypes and supported the matching allele model for pepper–PVY interactions.

A survey was conducted during 2009-2010 seasons to identify the distribution of Bemisia tabaci (Gennadius) biotypes in Tunisia. The genetic affiliation of collected populations was determined by polymerase chain reaction (PCR)-restriction fragment-length polymorphism (TaqI) of the mitochondrial cytochrom oxidase I (mtCOI) gene. Results, validated by sequencing and phylogenetic analysis, allowed the clustering of sampled sweetpotato whiteflies into B and Q biotypes. As B. tabaci harbors the obligatory bacterium Portiera aleyrodidarum, and a diverse array of secondary symbionts including Rickettsia, Hamiltonella, Wolbachia, Cardinium, Arsenophonus, and Fritschea, we report here the infectious status of Tunisian populations by secondary symbionts to find out a correlation between bacterial composition to biotype. The genetic variability and structure of B. tabaci populations in Tunisia was driven by analysis of molecular variance (AMOVA) and the hypothesis of isolation by distance was explored. Selective neutrality and genetic haplotype network tests suggested that Tunisian sweetpotato whiteflies have been undergoing a potential expansion followed by gene flow restriction.

‘Candidatus Phytoplasma mali’ was detected, for the first time, in plum (Prunus domestica L.) trees, with symptoms of plum decline in Tunisia. Infected trees showed leaf browning, leaf and fruit wilting followed by tree death in a few weeks. Phytoplasma was detected by polymerase chain reaction (PCR) using universal phytoplasma primer pairs P1/P7. A band with expected size was observed in samples collected from symptomatic, but not symptomless, plum trees. PCR using group-specific primers yielded a band of 1050 bp with 16SrX group specific primers fO1/rO1. Universal PCR products (1.8 kb) were used for restriction fragment length polymorphism analysis (RFLP) after digestion with endonuclease SspI. RFLP patterns obtained were similar to those previously reported for the Apple Proliferation phytoplasma (AP, 16SrX-A), the causal agent of apple proliferation disease. Blast analysis revealed that universal PCR sequences obtained from the infected Tunisian plums were identical and had the highest identi...

Candidatus Phytoplasma prunorum was detected for the first time in almond (Prunus dulcis Mill.) cv. ‘Abiod’ in Tunisia. Infected trees showed emergence of new growth during dormancy and leafed out before flowers opened in addition to early defoliation in summer. Phytoplasma was detected by nested polymerase chain reaction (PCR) using universal phytoplasma primer pairs P1/P7 and F2n/R2. A band with expected size was observed in samples collected from five symptomatic, but not symptomless almond trees. PCR products (1.2 kbp) were used for restriction fragment length polymorphism (RFLP) analysis after digestion with endonucleases RsaI and SspI. RFLP patterns obtained were similar to those reported previously for the European stone fruit yellows (ESFY, 16SrX-B). Identification has been further confirmed by PCR using ESFY specific primer pairs (ECA1/ECA2). This is the first report of Ca. Phytoplasma prunorum infecting almonds in Tunisia.

Surveys during five consecutive years in four main seed potato-growing areas of Tunisia revealed large differences in Potato virus Y (PVY) incidence. Infection rates at harvest ranged from up to 19% in Cap Bon and in Jendouba, to 31% in Kairouan and 48% in Manouba. However, infection rates were very low across the country in 2003 (1–5%), except in Kairouan, and rather low in 2004 (4–10%). Secondary infections in plants growing from imported seed potatoes were assessed to be 1–6% depending on region and year. Serological analysis of a first set of 90 samples collected in 2004–2005 revealed dominance of the PVYN group (90% of the total number of PVY positives). A second set of 44 isolates from samples collected in 2006 was further analyzed with a combination of serotyping, indexing on tobacco, and RT-PCR tests targeting four genomic regions (5′Ntr/P1, HcPro/P3, CI/NIa, CP). Thirty-five of these 44 isolates were typical PVYNTN isolates, with three recombination junctions in HcPro/P3, CI/NIa, and CP regions, respectively, whereas no recombination junction was identified in the genome of five isolates belonging to the PVYN group. One additional recombinant PVYNTN isolate was recovered from a mixed infection with a PVYO isolate. Only three PVYO isolates were recovered from the samples analyzed.

International audience; Surveys were conducted of symptomatic potato plants in late season crops, from the major potato production regions in Northern Tunisia, for infection with six common potato viruses. The presence of Potato leafroll virus (PLRV), Potato virus Y (PVY), Potato virus X (PVX), Potato virus A (PVA), Potato virus S (PVS) and Potato virus M (PVM) was confirmed serologically with virus infection levels up to 5.4, 90.2, 4.3, 3.8, 7.1 and 4.8%, respectively. As PVY was prevalent in all seven surveyed regions, further biological, serological and molecular typing of 32 PVY isolates was undertaken. Only one isolate was shown to induce PVYO-type symptoms following transmission to tobacco and to react only against anti-PVYO-C antibodies. Typical vein necrosis symptoms were obtained from 31 samples, six of which reacted against both anti-PVYN and anti-PVYO-C antibodies showing they contained mixed isolates, while 25 of them reacted only with anti-PVYN antibodies. An immunocapture RT-PCR molecular test using a PVYNTN specific primer pair set in the 5’NTR/P1 genomic region and examination of recombinant points in three genomic regions (HC-Pro/P3, CI/NIa and CP/3’NTR) showed that all 25 serotype-N PVY isolates were PVYNTN variants with similar recombinations to the standard PVYNTN-H isolate. This is the first report of the occurrence of the PVYNTN variant and its high incidence in late season potatoes in Tunisia.

Tomato yellow leaf curl disease causes severe losses in tomato production throughout Mediterranean countries including Tunisia. In order to generate engineered resistance to this disease, an intron-hairpin RNA construct harboring a Tomato yellow leaf curl Sardinia virus (TYLCSV) truncated replication-associated protein (Rep) gene was used to transform genotype of tomato plants. Prepared transgenic plants were agro-inoculated with Tunisian infectious strain of TYLCSV and screened for the resistance to infection. The infected transgenic plants were divided into 3 different groups according to their specific symptoms. Only one of them contained transgenic plants fully resistant to the tomato yellow leaf curl disease.

International audience; A study was conducted to better understand the population structure of Zucchini yellow mosaic virus (ZYMV), a severe virus affecting cucurbit crops worldwide, in Tunisia and to estimate whether the use of resistant cultivars may provide durable control. Analysis of the polymerase and coat protein (NIb-CP) partial sequences of 83 isolates collected in the three main cucurbit-growing areas in Tunisia showed that ZYMV grouped into two distinct clusters within ZYMV molecular group A. An important variability was observed in the MREK motif of the P3 protein, a motif associated with tolerance breaking in ZYMV-tolerant zucchini squash cultivars. Interestingly, significant differences were found in the distribution of the MREK variants in the two clusters defined by the partial NIb-CP sequences, MREK and MKEK sequences being more common in cluster 1 and cluster 2, respectively. When combining NIb-CP and P3 sequence information, ZYMV molecular variability was shown to be significantly higher in the Cap Bon region than in the Bizerte area. An important biological variability was observed in a subset of 23 isolates regarding symptomatology in susceptible or resistant cucurbits. Some isolates overcame ZYMV tolerance or resistance in zucchini squash and melon, but not in cucumber. Three serotypes were differentiated using a set of 13 monoclonal antibodies (MAbs). Seven parameters characterizing the 23 isolates, including molecular, serological and biological properties, were used for a multiple component analysis (MCA). This analysis revealed that symptom intensity of a given isolate was similar in different susceptible cucurbit hosts, suggesting similar degrees of aggressiveness in different hosts.

The presence of Peach latent mosaic viroid (PLMVd) was monitored during 2 years in peach orchards located in the North of Tunisia. PLMVd population was surveyed using a specific RT-PCR test adapted to crude sap extract. During the first year (2004), 228 samples were randomly selected in 22 peach orchards (eight cultivars) and tested for the presence of PLMVd. Results showed that PLMVd is highly and equally present in four regions of the North of Tunisia. Analyses of some key factors in relation to PLMVd incidence revealed that the tree age did not influence the infection rate. The eight studied cultivars were clustered in three groups according to their PLMVd incidence. Furthermore, the early and season cultivars were statistically more infected than the late cultivars. Prospections in May and October 2005 were performed in four selected orchards. Each two orchards contained Early May Crest (early cultivar) and Carnival (late cultivar) cultivars, respectively. The difference in PLMVd incidence observed in 2004 was confirmed. Furthermore, no correlation between the tree physiological state and the viroid detection was observed. Further investigations on the origin of the differences in PLMVd incidence between Early May Crest and Carnival cultivars would be of interest.

Tomato yellow leaf curl virus disease (TYLCVD) has been observed in Tunisia for more than 20 years. Until year 2004, only the Tomato yellow leaf curl Sardinia virus-Sicily (TYLCSV-[Sic]) was detected in tomato, pepper and bean crops. In the Sahel region, some tomato samples showing severe TYLCVD symptoms were collected from greenhouses in 2004 and 2005. Typing of these isolates revealed for the first time the presence of the TYLCV Israel in Tunisia. This result was confirmed by using several sets of specific primers and by sequencing. This species has also been detected on pepper and bean collected from fields in the same region. The sequencing of a tomato and a bean isolate showed that they both share more than 97% of sequence identity with the TYLCV from Dominican Republic (AF024715). The TYLCV has been found in single and mixed infection with the TYLCSV-[Sic].

Nucleotide sequences of a broad range of Peach Latent Mosaic Viroid (PLMVd) variants were determined. The variants were isolated from peach, pear, and almond tree samples collected in Tunisia. Sequence analysis confirmed the high variability of PLMVd, as no less than 119 new variants were identified. Variations included new polymorphic positions, insertions of 11 to 14 nucleotides, and new mutations within the hammerhead self-cleavage motifs. We provide the first covariation-based evidence for certain stems within the proposed secondary structure. Our covariation analysis also strengthens the view that a pseudoknot closes the replication domain. On the basis of phylogenetic tree studies and informative positions, PLMVd variants are proposed to cluster into groups and subgroups likely to have resulted from recombination events. PLMVd thus emerges as a suitable viroid for retracing the evolution of an RNA genome.

Reverse transcription polymerase chain reaction (RT-PCR) was used for the detection of Hop stunt viroid (HSVd) and Citrus exocortis viroid (CEVd) in nucleic acid extracts of infected fig leaf tissues. RT-PCR results were confirmed by cDNA sequencing. This is the first report of CEVd and HSVd infecting fig in Tunisia. Alignments and phylogenetic analysis classify the HSVd Tunisian isolates in the plum-type group. CEVd Tunisian isolates are very closely related to the CEVd tomato hybrid callus isolate and to CEVd Gynura isolate from the USA.

Understanding plant response to salinity, one of the major abiotic stresses, provides insights into the improvement of tomato salt tolerance. This work focuses on the responses of tomato cultivars to salt stress. Genotypes, representative of content and enzyme activities. QPCR analysis of WRKY, ERF, LeNHX and HKT genes was also performed. A high K+, Ca2+ and proline accumulation as well as a decrease in Na+ concentration mediated salt tolerance. Concomitant with a pattern of high antioxidant enzyme activities, tolerant genotypes also displayed differential patterns of gene expression., Salinity is a constraint limiting plant growth and productivity of crops throughout the world. Understanding the mechanism underlying plant response to salinity provides new insights into the improvement of salt tolerance-crops of importance. In the present study, we report on the responses of twenty cultivars of tomato. We have clustered genotypes into scale classes according to their response to increased NaCl levels. Three local tomato genotypes, representative of different saline scale classes, were selected for further investigation. During early (0 h, 6 h and 12 h) and later (7 days) stages of the response to salt treatment, ion concentrations (Na+, K+ and Ca2+), proline content, enzyme activities (catalase, ascorbate peroxidase and guiacol peroxidase) were recorded. qPCR analysis of candidate genes WRKY (8, 31and 39), ERF (9, 16 and 80), LeNHX (1, 3 and 4) and HKT (class I) were performed. A high K+, Ca2 +and proline accumulation as well as a decrease of Na+ concentration-mediated salt tolerance. Concomitant with a pattern of high-antioxidant enzyme activities, tolerant genotypes also displayed differential patterns of gene expression during the response to salt stress.

The full-length genome of a Tunisian isolate of Tomato yellow leaf curl Sardinia virus (TYLCSV) was engineered and submitted to sequence analysis. The Tunisian isolate has 99% sequence identity with TYLCSV-Sicilian (Sic), results thus providing further evidence for the inclusion of this isolate in the TYLCSV-Sic group. A 1.7-mer construct of the virus was obtained and efficiently agroinfiltrated into tomato and tobacco plants to induce symptoms indistinguishable from those of natural infection.

A reverse transcription polymerase chain reaction was developed to investigate the occurrence ofpeach latent mosaic viroid� (PLMVd), � pear blister canker viroid� (PBCVd), � hop stunt viroid� (HSVd) andapple scar skin viroid� (ASSVd) on fruit trees (peach, pear, almond and apple) in Tunisia. The test was initially performed with total RNA preparations from selected isolates and then applied to total RNA preparations from leaf or bark tissues of fruit trees collected in the north of Tunisia and the Sahel. PLMVd was found to occur in peach and pear trees, HSVd in pear, peach and almond trees, and PBCVd in pear trees. Mixed PBCVd-HSVd and PLMVd-HSVd infections occurred naturally in pear trees. ASSVd was not detected in any samples from apple trees. The identity of the detected viroids was confirmed by comparing their sequences with those of other previously characterized isolates. The test was then simplified by direct use of diluted crude plant extracts. The results obtained from crude sap extracts of leaves or bark tissues and from total RNA preparations were identical. This improved test is thus quick and useful for large-scale routine analy- sis. It can be used in a certification programme to con- tribute to prevention of the occurrence and spread of PLMVd, HSVd, PBCVd and ASSVd in Tunisia.

Surveys were undertaken for tomato yellow leaf curl viruses in the main Tunisian tomato-growing areas in fields and plastic houses. Symptoms included yellowing, leaf curling and stunting. Collected samples were submitted to molecular analysis using two approaches: (1) hybridization tests with two DNA probes corresponding to an intergenic region derived from a cloned dimer of an Egyptian full-length TYLCV and to the coat region of a Tunisian TYLCV isolate; (2) PCR amplification coupled to RFLP allowing both identification and clustering of Tunisian isolates. Only Tomato yellow leaf curl Sardinia virus was detected in Tunisia.

Reverse transcription polymerase chain reaction (RT-PCR) was used for the detection of Citrus exocortis viroid (CEVd) in total nucleic acids from infected citrus indicator hosts or directly from field trees. Grapevine yellow speckle viroid-1 (GYSVd-1) and Australian grapevine viroid (AGVd) were also detected by this technique in total nucleic acids from infected grapevine plants. Three protocols for nucleic acid extraction were tested: a phenol-based method, a protocol using a commercial reagent (Trizol) and a method in which extraction with a high-salt buffer was combined with partial purification using non-ionic cellulose. The third protocol, coupled to RT-PCR, seems to be the most suitable, allowing detection of the three viroids in Tunisian citrus and grapevine samples. This method should be used in a testing programme to produce certified viroid-free planting material.

We report the nucleotide sequences of Australian Grapevine Viroid and Grapevine Yellow Speckle Viroid (type 1) isolated from grapevine trees in a Tunisian vineyard. Our data confirm the worldwide spread of these viroids and record their occurrence in Africa. This is the first description of Australian Grapevine Viroid sequences isolated from its natural host. Moreover, the sequences of these new natural variants suggests that the previous use of an indicator plant to amplify a viroid does not alter its nucleotide composition. In addition, we also present several new features of these two distinct quasi-species.

International audience; Biological and molecular characterization supported by transmission efficiency, symptom expression and Open Reading Frame 0 (ORF0) nucleotide sequence analysis were carried out to assess nine isolates of Potato leafroll virus (PLRV) collected from three Tunisian geographic and bioclimatic zones. Plant-to-plant transmission by Tunisian Myzus persicae aphid clones showed high transmission efficiency for all isolates tested. Symptom expression analysis on a Physalis floridana plant test distinguished viral isolates as very severe, severe and mild. The ORF0 sequences of the Tunisian PLRVisolates showed an assignment to two aggregates when compared with GenBank PLRV sequences. A significant correlation between symptom severity and ORF0 nucleotide sequence or between symptom severity and geographic origins of the PLRV isolates was established. However, the transmission efficiency and the ORF0 sequence were not affected by the bioclimatic origin. No significant correlation between transmission and symptom or between transmission and the ORF0 sequence was detected.

The structural pattern of infectivity matrices, which contains infection data resulting from inoculations of a set of hosts by a set of parasites, is a key parameter for our understanding of biological interactions and their evolution. This pattern determines the evolution of parasite pathogenicity and host resistance, the spatiotemporal distribution of host and parasite genotypes, and the efficiency of disease control strategies. Two major patterns have been proposed for plant-virus genotype infectivity matrices. In the gene-for-gene model, infectivity matrices show a nested pattern, where the host ranges of specialist virus genotypes are subsets of the host ranges of less specialized viruses. In contrast, in the matching-allele (MA) model, each virus genotype is specialized to infect one (or a small set of) host genotype(s). The corresponding infectivity matrix shows a modular pattern where infection is frequent for plants and viruses belonging to the same module but rare for those belonging to different modules. We analyzed the structure of infectivity matrices between Potato virus Y (PVY) and plant genotypes in the family Solanaceae carrying different eukaryotic initiation factor 4E (eIF4E)-coding alleles conferring recessive resistance. Whereas this system corresponds mechanistically to an MA model, the expected modular pattern was rejected based on our experimental data. This was mostly because PVY mutations involved in adaptation to a particular plant genotype displayed frequent pleiotropic effects, conferring simultaneously an adaptation to additional plant genotypes with different eIF4E alleles. Such effects should be taken into account for the design of strategies of sustainable control of PVY through plant varietal mixtures or rotations. IMPORTANCE The interaction pattern between host and virus genotypes has important consequences on their respective evolution and on issues regarding the application of disease control strategies. We found that the structure of the interaction between Potato virus Y (PVY) variants and host plants in the family Solanaceae departs significantly from the current model of interaction considered for these organisms because of frequent pleiotropic effects of virus mutations. These mutational effects allow the virus to expand rapidly its range of host plant genotypes, make it very difficult to predict the effects of mutations in PVY infectivity factors, and raise concerns about strategies of sustainable management of plant genetic resistance to viruses.

Three Tunisian PVMV isolates identified in pepper and tomato fields and one isolate from Ivory Coast were submitted to biological and molecular analysis. Phenotypically, Tunisian isolates induced mild symptoms while the Ivory Coast one is more aggressive on tobacco. As no PVMV sequence data are available, detailed sequence comparisons of coat protein gene (CP) were made. No nucleotide or amino acid changes in this region could be related to the pathogenicity of the isolates analysed. With the aim to increase our molecular understanding of the biological properties, we have sequenced the 3'-non translated region (3'NTR). Results suggest that this region of the RNA genome may be involved in the modulation of disease symptoms.

The potyviruses, PVY (potato virus Y) and PVMV (pepper veinal mottle virus) were identified by serological and symptom diagnosis in pepper (Capsicum annuum L.) in Tunisia during 1995–1997. Both were known to be major constraints to pepper production in North Africa. Pepper veinal mottle virus (PVMV) has not been reported previously in North Africa, but PVMV was found to be widely spread in peppers throughout Tunisia. By using reverse transcription followed by polymerase chain reaction (RT-PCR), we have now amplified the PVMV coat protein gene of two Tunisian isolates. DNA polymorphism, determined by restriction fragment length polymorphism (RFLP) of the coat protein gene, revealed two patterns distinguishing PVMV from PVY. Within PVMV isolates, molecular and biological properties showed no polymorphism suggesting that all isolates are representative of one PVMV strain occurring in Tunisia.