Search

Genome-wide association studies (GWAS) have identified many genes that are associated with the development of certain autoimmune disorders, but the MHC haplotypes still represent the most prevalent genetic risk factor for many autoimmune diseases. The mechanisms by which MHC-associated genetic susceptibility translates into B cell autoimmunity and the development of autoimmune diseases are complex. There is increasing evidence that the MHC haplotype modulates autoreactive B cell responses in multiple ways. Instead of merely inhibiting the production of IgG autoantibodies and mediating complete immunological tolerance, the non-permitting MHC haplotypes seem to facilitate the production of IgG autoantibodies exhibiting Fc glycosylation patterns that are associated with reduced pathogenicity and a protective cytokine profile of T follicular helper (Tfh) cells. Here, we discuss mechanisms linking MHC haplotypes to the production of pathogenic IgG autoantibodies, which could be relevant for the development of improved diagnosis, particularly in the context of individual medicine., (© 2021 The Authors. European Journal of Immunology published by Wiley-VCH GmbH.)

Tumor cells of classic Hodgkin lymphoma (cHL) are derived from antigen presenting B cells that are infected by Epstein Barr virus (EBV) in ~30% of patients. Polymorphic Killer cell immunoglobulin-like receptors (KIRs) expressed on NK cells interact with human leukocyte antigen (HLA) class I and play a key role in immune surveillance against virally infected cells and tumor cells. We investigated the effect of KIR types on cHL susceptibility overall (n=211) and in EBV-stratified subgroups using the Dutch GoNL cohort as controls (n=498). The frequency of the KIR haplotype B subgroup was significantly different between EBV+ and EBV- cHL patients (62% vs. 77%, p=0.04) and this difference was more pronounced in nodular sclerosis (NS) cHL (49% vs. 79%, p=0.0003). The frequency of KIR haplotype B subgroup was significantly lower in EBV+ NS cHL compared to controls (49% vs. 67%, p=0.01). Analyses of known KIR - HLA interaction pairs revealed lower carrier frequencies of KIR2DS2 - HLA-C1 (29% vs. 46%, p=0.03) and KIR2DL2 - HLA-C1 (29% vs. 45%, p=0.04) in EBV+ NS cHL patients compared to controls. Carriers of the KIR haplotype B subgroup are less likely to develop EBV+ NS cHL, probably because of a more efficient control over EBV-infected B cells., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Jiang, Nolte, Hepkema, Stulp, van den Berg and Diepstra.)

Marek's disease virus (MDV), the etiologic agent for Marek's disease (MD), causes a deadly lymphoproliferative disease in chickens. Causes of the well-documented association between genetically defined lines of chicken and resistance to MD remain unknown. Here, the frequencies of IFN-gamma producing pp38 and MEQ -specific T cell responses were determined in line N (B21 haplotype; MD-resistant) and line P2a (B19 haplotype, MD-susceptible) chickens after infection with vaccine and/or virulent (RB1B) strains of MDV using both standard ex vivo and cultured chIFN-gamma ELISPOT assays. Notably, MDV infection of naïve and vaccinated MD-resistant chickens induced higher frequencies of IFN-gamma producing MDV-specific T cell responses using the cultured and ex vivo ELISPOT assay, respectively. Remarkably, vaccination did not induce or boost MEQ -specific effector T cells in the susceptible chickens, while it boosted both pp38 -and MEQ -specific response in resistant line. Taken together, our results revealed that there is a direct association between the magnitude of T cell responses to pp38 and MEQ of MDV antigens and resistance to the disease., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Boodhoo and Behboudi.)

Background: One of the most relevant genetic components in systemic lupus erythematosus (SLE) is human leukocyte antigen (HLA) gene complex which plays a central role in autoimmune responses. This study aimed to explore the associations of HLA-DRB1/-DQB1 alleles and haplotypes with SLE risk and the appearance of autoantibodies in SLE disease., Methods: A total of 127 SLE patients and 153 ethnically matched healthy controls were enrolled. HLA-DRB1 and HLA-DQB1 alleles were determined by PCR-SSP method and then HLA alleles and haplotypes frequencies were compared between two groups and among the patients in terms of autoantibodies spectrum., Results: We found that HLA-DRB1*03 and HLA-DRB1*16 alleles were significantly associated with increased risk (P = 0.008, P C =0.05 and P = 0.002, P C =0.02 respectively) and DRB1*01 conferred a potential protective role for disease (P = 0.03, P C =0.13). Similar associations were observed at haplotype level; DRB1*03~DQB1*02 (OR1.91,P = 0.01, P C =0.08), DRB1*16~DQB1*05 (OR3.65,P = 0.004,P C =0.06) and DRB1*01~DQB1*05 (OR0.36,P = 0.04, P C =0.22). Remarkably, we observed significantly associations of DRB1*03 with the appearance of anti-SSA/Ro (P C =0.02), anti-SSB/La (P C =0.002) and anti-coagulant (P = 0.007), DRB1*15 with anti-SSA/Ro (P C =0.04), DRB1*16 with anti-Sm (P C =0.02), DRB1*04 with anti-β2gpI (P C =3 * 10 -5 ), anti-cardiolipin (P = 0.002) and rheumatoid factor (P = 0.004) and DRB1*13 with anti-Sm (P C =0.02) and anti-β2gpI (P C =0.01) antibodies. Also, negative associations of DRB1*04 with anti-Sm, anti-SSA/Ro, DQB1*03 with anti-Sm and DRB1*11 with anti-Sm and anti-β2gpI were observed., Conclusions: We identified DRB1*03 and DRB1*16 as risk alleles and DRB1*01 as a potential protective allele for SLE disease. More importantly, we found a close link between genetic susceptibility for SLE and autoantibodies status that was more evident for DRB1*03 allele., (Copyright © 2021 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.)

Background: The human leukocyte antigen (HLA) haplotype of the recipient in hematopoietic stem cell transplantation (HSCT) is a key factor in its success or failure. We analyzed the relationship between HLA haplotype frequency and associated clinical factors in HSCT patients., Methods: Patients who underwent allogeneic HSCT between 2000 and 2019 at our institution were enrolled in this study. The HSCT composition was 77 bone marrow transplantations (BMT), 38 peripheral blood stem cell transplantations (PBSCT), and 36 cord blood transplantations (CBT). Patients were classified into three groups according to their donor HLA haplotype frequency in the Japan Population: group A, top 1-10 haplotypes; group B, top 11-100 haplotypes; and group C, haplotype 101-. We then compared various items including clinical biomarkers with the HLA haplotype frequency., Results: A significant negative correlation was identified between older persons and length of survival. There are also significant correlations between survival and levels of immunoglobulin G, D-dimer, and C-reactive protein, as well as the platelet-large cell ratio before transplantation. A total of 96, 30, and 25 patients were classified into groups A, B, and C, respectively. The HSCT match rate was significantly higher in group A patients than in those of groups B and C. In contrast, the death rate, D-dimer level, and length of time for engraftment were significantly higher in group B and C patients than in those of group A., Conclusion: An assessment of transplant-related complications is important in improving the performance of HSCT. The present data suggest that a special therapeutic strategy is necessary for HSCT using low-frequency HLA haplotypes., (Copyright © 2021 Elsevier B.V. All rights reserved.)

Genetic polymorphisms of human leucocyte antigen (HLA)-DRB1, -DQA1 and -DQB1 among four main ethnic groups including Han (n = 70), Uyghur (n = 71), Kazakh (n = 52) and Hui (n = 40) subjects from Xinjiang Uyghur Autonomous Region were investigated using a polymerase chain reaction-sequence-based typing (PCR-SBT). In total, 32 HLA-DRB1 alleles, eight HLA-DQA1 alleles and 14 HLA-DQB1 alleles were identified. The most predominant HLA-DRB1, -DQA1 and -DQB1 alleles were DRB1*15:01 (12.50%), DQA1*01:02 (21.43%) and DQB1*03:01 (19.29%) in Han; DRB1*07:01 (18.48%), DQA1*05:01/03/05 (24.65%) and DQB1*02:01/02 (31.69%) in Uyghur; and DRB1*13:01 (13.64%), DQA1*05:01/03/05 (28.85%) and DQB1*02:01/02 (27.88%) in Kazakh, respectively. In Hui, DRB1*07:01, DRB1*11:01 and DRB1*14:01 were the most dominant alleles with the same frequency of 11.8%, while the predominant DQA1 and DQB1 alleles were DQA1*03:01/02/03 (23.75%) and DQB1*02:01/02 (16.25%), respectively. In addition, the most common two-locus haplotypes were DQA1*05:01/03/5-DQB1*03:01 (10.0%) in Han; DQA1*02:01-DQB1*02:01/02 (18.31%) in Uyghur; DQA1*05:01/03/05-DQB1*02:01/02 (15.38%) in Kazakh; and DQA1*03:01/02/03-DQB1*03:03 (11.25%) in Hui. The phylogenetic dendrograms constructed based on the allele frequencies of HLA-DRB1, -DQA1 and -DQB1 in 13 populations (e.g. Asian, Central Asian and European) revealed that the Han and Hui populations were clustered together and closest to Han population from China, while the Kazakh and Uyghur populations were closest to each other and two ethnic groups were clustered together with Central Asian and European populations., (© 2021 John Wiley & Sons Ltd.)

Polymorphic variation of immune system proteins can drive variability of individual immune responses. Endoplasmic reticulum aminopeptidase 1 (ERAP1) generates antigenic peptides for presentation by major histocompatibility complex class I molecules. Coding SNPs in ERAP1 have been associated with predisposition to inflammatory rheumatic disease and shown to affect functional properties of the enzyme, but the interplay between combinations of these SNPs as they exist in allotypes has not been thoroughly explored. We used phased genotype data to estimate ERAP1 allotype frequency in 2504 individuals across five major human populations, generated highly pure recombinant enzymes corresponding to the ten most common ERAP1 allotypes, and systematically characterized their in vitro enzymatic properties. We find that ERAP1 allotypes possess a wide range of enzymatic activities, up to 60-fold, whose ranking is substrate dependent. Strikingly, allotype 10, previously associated with Behçet's disease, is consistently a low-activity outlier, suggesting that a significant percentage of individuals carry a subactive ERAP1 gene. Enzymatic analysis revealed that ERAP1 allotypes can differ in both catalytic efficiency and substrate affinity, differences that can change intermediate accumulation in multistep trimming reactions. Alterations in efficacy of an allosteric inhibitor that targets the regulatory site suggest that allotypic variation influences the communication between the regulatory and the active site. Our work defines the wide landscape of ERAP1 activity in human populations and demonstrates how common allotypes can induce substrate-dependent variability in antigen processing, thus contributing, in synergy with major histocompatibility complex haplotypes, to immune response variability and predisposition to chronic inflammatory conditions., Competing Interests: Conflict of interest The authors declare that they have no conflicts of interest with the contents of this article., (Copyright © 2021 The Authors. Published by Elsevier Inc. All rights reserved.)

SolariX is a compendium of DNA sequence tags from the nucleotide binding site (NBS) domain of disease resistance genes of the common potato, Solanum tuberosum Group Tuberosum. The sequences, which we call NBS tags, for nearly all NBS domains from 91 genomes-representing a wide range of historical and contemporary potato cultivars, 24 breeding programs and 200 years-were generated using just 16 amplification primers and high-throughput sequencing. The NBS tags were mapped to 587 NBS domains on the draft potato genome DM, where we detected an average, over all the samples, of 26 nucleotide polymorphisms on each locus. The total number of NBS domains observed, differed between potato cultivars. However, both modern and old cultivars possessed comparable levels of variability, and neither the individual breeder or country nor the generation or time appeared to correlate with the NBS domain frequencies. Our attempts to detect haplotypes (i.e., sets of linked nucleotide polymorphisms) frequently yielded more than the possible 4 alleles per domain indicating potential locus intermixing during the mapping of NBS tags to the DM reference genome. Mapping inaccuracies were likely a consequence of the differences of each cultivar to the reference genome used, coupled with high levels of NBS domain sequence similarity. We illustrate that the SolariX database is useful to search for polymorphism linked with NBS-LRR R gene alleles conferring specific disease resistance and to develop molecular markers for selection.

We used three approaches to map the yellow rust resistance gene Yr7 and identify associated SNPs in wheat. First, we used a traditional QTL mapping approach using a double haploid (DH) population and mapped Yr7 to a low-recombination region of chromosome 2B. To fine map the QTL, we then used an association mapping panel. Both populations were SNP array genotyped allowing alignment of QTL and genome-wide association scans based on common segregating SNPs. Analysis of the association panel spanning the QTL interval, narrowed the interval down to a single haplotype block. Finally, we used mapping-by-sequencing of resistant and susceptible DH bulks to identify a candidate gene in the interval showing high homology to a previously suggested Yr7 candidate and to populate the Yr7 interval with a higher density of polymorphisms. We highlight the power of combining mapping-by-sequencing, delivering a complete list of gene-based segregating polymorphisms in the interval with the high recombination, low LD precision of the association mapping panel. Our mapping-by-sequencing methodology is applicable to any trait and our results validate the approach in wheat, where with a near complete reference genome sequence, we are able to define a small interval containing the causative gene., Competing Interests: The current affiliation of LJG with IBM and PBB with Bayer does not alter our adherence to PLOS ONE policies on sharing data and materials.

Genome-wide association studies have associated thousands of genetic variants with complex traits and diseases, but pinpointing the causal variant(s) among those in tight linkage disequilibrium with each associated variant remains a major challenge. Here, we use seven experimental assays to characterize all common variants at the multiple disease-associated TNFAIP3 locus in five disease-relevant immune cell lines, based on a set of features related to regulatory potential. Trait/disease-associated variants are enriched among SNPs prioritized based on either: (1) residing within CRISPRi-sensitive regulatory regions, or (2) localizing in a chromatin accessible region while displaying allele-specific reporter activity. Of the 15 trait/disease-associated haplotypes at TNFAIP3, 9 have at least one variant meeting one or both of these criteria, 5 of which are further supported by genetic fine-mapping. Our work provides a comprehensive strategy to characterize genetic variation at important disease-associated loci, and aids in the effort to identify trait causal genetic variants.

Since the beginning of life, every multicellular organism appeared to have a complex innate immune system although the adaptive immune system, centred on lymphocytes bearing antigen receptors generated by somatic recombination, arose in jawed fish approximately 500 million years ago. The major histocompatibility complex MHC, named the Human leucocyte antigen (HLA) system in humans, represents a vital function structure in the organism by presenting pathogen-derived peptides to T cells as the main initial step of the adaptive immune response. The huge level of polymorphism observed in HLA genes definitely reflects selection, favouring heterozygosity at the individual or population level, in a pathogen-rich environment, although many are located in introns or in exons that do not code for the antigen-biding site of the HLA. Over the past three decades, the extent of allelic diversity at HLA loci has been well characterized using high-resolution HLA-DNA typing and the number of new HLA alleles, produced through next-generation sequencing methods, is even more rapidly increasing. The level of the HLA system polymorphism represents an obstacle to the search of potential compatible donors for patients affected by haematological disease proposed for a hematopoietic stem cell transplant (HSCT). Data reported in literature clearly show that antigenic and/or allelic mismatches between related or unrelated donors and patients influences the successful HSCT outcome. However, the recent development of the new transplant strategy based on the choice of haploidentical donors for HSCT is questioning the role of HLA compatibility, since the great HLA disparities present do not worsen the overall clinical outcome. Nowadays, NGS has contributed to define at allelic levels the HLA polymorphism and solve potential ambiguities. However, HLA functions and tissue typing probably need to be further investigated in the next future, to understand the reasons why in haploidentical transplants the presence of a whole mismatch haplotype between donors and recipients, both the survival rate and the incidence of acute GvHD or graft rejection are similar to those reported for unrelated HSCTs., (© 2019 John Wiley & Sons Ltd.)

Autism spectrum disorders (ASD) comprises heterogeneous neurodevelopmental conditions with symptom onset usually during infancy. However, about 10%-30% of affected cases experience a loss of language and social skills around 18-30 months, so-called regressive autism. In this subset with regression, immune dysfunctions including inflammation and autoimmunity have been proposed to be at risk factors. Given the implication of the human histocompatibility antigens (HLA) system in various aspects of immune responses, including autoimmunity, and in ASD, we investigate here the distribution of the HLA Class I and Class II haplotypes in 131 children with ASD meeting DSM-IV TR criteria, with and without regression. We found that 62 of the 98 non-regressive ASD patients carry the HLA-DPA1*01-DPB1*04 sub-haplotype as compared to 14 of the 33 patients with regression (63% vs. 43% respectively, Pc = 0.02), suggesting that this HLA haplotype may exert a protective effect against regression. Similarly, the HLA-DPA1*01-DPB1*04 has also been found to be more represented in healthy controls as compared to patients affected with common nonpsychiatric autoimmune disorders. Overall our findings suggest a possible involvement of HLA polymorphism in the context of regressive ASD. Autism Res 2020, 13: 182-186. © 2019 The Authors. Autism Research published by International Society for Autism Research published by Wiley Periodicals, Inc. LAY SUMMARY: Immune dysfunctions including inflammatory and autoimmune processes have been reported in autism, particularly in regressive forms. In this study, we analyzed the distribution of HLA haplotypes among children with autism spectrum disorder (ASD), with and without regression from Sweden and observed that HLA-DPA1*01-DPB1*04 sub-haplotype was less represented in patients with regressive autism as compared with those without regression. Such possible protective effect, also observed in other common autoimmune disorders, may constitute a link between HLA-mediated immune processes and regressive ASD., (© 2019 International Society for Autism Research, Wiley Periodicals, Inc.)

Background: Psoriasis is a systemic inflammatory disease which mostly affects skin. Evidences support the role of autoimmune responses in this disorder. The long non-coding RNA (lncRNA) antisense non coding RNA in the INK4 locus (ANRIL) has been shown to participate in modulation of immune response and in the pathogenesis of immune-related disorders., Methods: We genotyped four single nucleotide polymorphisms (SNPs) with this lncRNA (rs1333045, rs1333048, rs4977574 and rs10757278) in 286 patients with psoriasis and 300 age-/sex-matched controls to identify the role of ANRIL as a risk locus for psoriasis., Results: The C allele of rs1333048 SNP was significantly more prevalent among cases compared with controls (OR (95% CI) = 1.56 (1.23-1.97), adjusted P value = 8.31E-4). The A allele of the rs4977574 had a protective effect against psoriasis (OR (95% CI) = 0.63 (0.49-0.81), adjusted P value = 0.001). The G allele of the rs10757278 conferred risk of psoriasis in the assessed population (OR (95% CI) = 1.9 (1.51-2.4), adjusted P value = 2.18 E-7). The C A G A haplotype (rs1333045, rs1333048, rs4977574 and rs10757278, respectively) was reported to be a protective haplotype against psoriasis (OR (95% CI) = 0.5 (0.35-0.71), adjusted P value = 0.001). The C A G G and T C G G haplotypes conferred risk of psoriasis in the assessed population (OR (95% CI) = 2.37 (1.59-3.54), adjusted P value = 2.4E-4; OR (95% CI) = 5.42 (2.88-10.22), adjusted P value = 1.1E-7, respectively)., Conclusion: Consequently, ANRIL can be regarded as a risk locus of psoriasis in the assessed population. Future studies are needed to verify whether this contribution is exerted through modulation of immune responses., (Copyright © 2019 Elsevier B.V. All rights reserved.)

Women with persistent human papillomavirus (HPV) infections have a high risk of developing cervical cancer (CaCx). HPV-16 alone accounts for more than 60% of CaCx worldwide. Most of the HPV infections are transient and only a subset of women develop persistent HPV-16 infection. Many studies have shown associations of different human leukocyte antigen (HLA) alleles with HPV-mediated CaCx, but there are only a few studies globally that relate to persistent HPV-16 infection. Furthermore, such studies from India are sparse. Hence, we investigated the association of HLA-A, B, DRB, and DQB alleles with persistent HPV-16 infection and HPV-16-positive CaCx in south India (Tamil Nadu). HPV-16 persistent infection was observed in 7% of normal women. A total of 50 women with HPV-16-positive CaCx, 21 women with HPV-16 persistent infection, and 74 HPV-16-negative normal women were recruited for this study. Low-resolution typing of HLA-A, B, DRB, and DQB alleles was performed. HLA-B*44 and DRB1*07 showed a significant association with persistent HPV-16 infection (odds ratio, p -value = 26.3, 0.03 and 4.7, 0.01, respectively). HLA-B*27 and DRB1*12 were significantly associated with both HPV-16 + CaCx and persistent HPV-16 infection (23.8, 0.03; 52.9, 0.01; 9.8, 0.0009; and 13.8, 0.009; respectively). HLA-B*15 showed a negative association with HPV-16-positive CaCx (0.1, 0.01), whereas DRB1*04 exhibited protection to both HPV-16-positive CaCx and persistent HPV-16 infection (0.3, 0.0001 and 0.1, 0.0002, respectively). Thus, we show HLA allelic association with HPV-16 infection in Tamil Nadu. Larger studies on high-resolution HLA typing coupled with HPV-16 genome diversity will offer further insights into host/pathogen genome coevolution.

As an isoform of Rho family GTPases, RhoB plays a pivotal role in cytoskeletal organization, cell proliferation, apoptosis and immune response. However, the regulatory mechanisms of RhoB expression in aquatic animals are still unknown. In the present study, we first construct Vibrio anguillarum infection model in S. maximus, including susceptible and resistant individuals. Then the temporal expression of RhoB was detected after V. anguillarum challenge using qRT-PCR and found that RhoB transcripts were significantly induced in the liver, gill and blood despite of differential expression levels and responsive time points. In addition, the mRNA levels of RhoB in resistant individuals were significantly higher than in susceptible ones. The length of 2083 bp sequences of RhoB promoter was cloned and characterized. Moreover, DNA methylation of the RhoB promoter was measured by bisulfite sequencing (BSP) and hypo-methylated was detected in the CpG islands. Three SNPs (-1590, -1575 and -1449) and two haplotypes in the promoter region of RhoB were identified to be associated with V. anguillarum resistance in turbot by association analysis in group 17-R and 17-S. Deletion analysis indicated that these SNPs could negatively mediate the activity of RhoB promoter. Site-directed mutagenesis and qRT-PCR of individuals with different genotypes demonstrated that -1575 T/A polymorphism affected promoter activity. Further study showed that this mutation altered the binding site of the transcription factor CREB. Co-transfection of SmCREB and RhoB promoter was performed in HEK293T cells which confirmed the -1575 allelic differences on transcriptional activity, with the susceptibility allele showing reduced activity. Taken together, our findings implicate that losing of binding of CREB to SmRhoB promoter due to -1575T/A polymorphisms enhances SmRhoB expression in resistant turbot, which provide insights into the effect of SmRhoB expression in response to V. anguillarum infection., (Copyright © 2019 Elsevier Ltd. All rights reserved.)

The leukocyte receptor complex (LRC) encodes a large number of immunoglobulin (Ig)-like receptors involved in the immune response, particularly in modulating natural killer (NK) cell function. The killer cell Ig-like receptors ( KIR ), the leukocyte Ig-like receptors ( LILR ), and a recently described novel Ig-like receptor family are highly variable between species, which is consistent with rapid evolution driven by selection pressure from pathogens. Among the species studied to date, only simians (such as humans) and bovids (such as cattle and goats) have an expanded complement of KIR genes and represent an interesting model to study KIR evolution. Using recently improved genome assemblies and an assembly of bacterial artificial chromosomes, we describe the structure of the LRC, and the KIR region in particular, in goats and compare this to sheep as the assemblies allow. These species diverged from a common ancestor ~10 million years ago and from cattle ~25 million years ago. We identified conserved KIR genes common to both goats and sheep and confirm a partial sheep haplotype shared between the Rambouillet and Texel breeds. Goats and sheep have independently expanded two novel KIR subgroups, and unlike cattle or any other mammal, they do not appear to possess a functional 3DL-lineage KIR gene. Investigation of LRC gene expression using available transcriptomic data for various sheep and goat tissues largely confirmed putative gene annotation and revealed that a relatively conserved caprinae -specific KIR subgroup is expressed in macrophages. The LILR and novel Ig-like receptors were also highly expressed across a diverse range of tissues. This further step toward our understanding of the LRC receptor repertoire will help inform future studies investigating immune response variation in these species., (Copyright © 2019 Schwartz, Sanderson, Bickhart, Smith and Hammond.)

Recently developed molecular methods allow large-scale profiling of T-cell receptor (TCR) sequences that encode for antigen specificity and immunological memory of these cells. However, it is well-known that the even unperturbed TCR repertoire structure is extremely complex due to the high diversity of TCR rearrangements and multiple biases imprinted by VDJ rearrangement process. The latter gives rise to the phenomenon of "public" TCR clonotypes that can be shared across multiple individuals and non-trivial structure of the TCR similarity network. Here, we outline a framework for TCR sequencing data analysis that can control for these biases in order to infer TCRs that are involved in response to antigens of interest. We apply two previously published methods, ALICE and TCRNET, to detect groups of homologous TCRs that are enriched in samples of interest. Using an example dataset of donors with known HLA haplotype and CMV status, we demonstrate that by applying HLA restriction rules and matching against a database of TCRs with known antigen specificity, it is possible to robustly detect motifs of epitope-specific responses in individual repertoires. We also highlight potential shortcomings of TCR clustering methods and demonstrate that highly expanded TCRs should be individually assessed to get the full picture of antigen-specific response., (Copyright © 2019 Pogorelyy and Shugay.)

Crayfish plague, caused by the pathogen Aphanomyces astaci, is one of the main factors responsible for the decimation of the native European crayfish species Austropotamobius pallipes. In Spain, two North American freshwater crayfish species, Procambarus clarkii and Pacifastacus leniusculus, were intentionally introduced during the 1970s for aquaculture and fishery purposes. Since then, incidences of crayfish plague have been continually reported. In this work, we evaluated more than 50 diagnosed cases of crayfish plague that have occurred in the Iberian Peninsula since 2004 by performing a microscopic examination of infected specimens and by molecularly identifying and haplotyping the pathogen. Our results showed that (i) the pathogen A. astaci has been active 45 years since the first introductions of the invasive North American crayfish species in the Iberian Peninsula, and (ii) P. clarkii and P. leniusculus are chronic reservoirs of the crayfish plague pathogen. Moreover, our data confirmed a correspondence between pathogen origin and spread and the specific haplotypes carried by the North American invasive crayfish located in the vicinity of each outbreak. We generated a crayfish plague incidence map of the Iberian Peninsula that shows (i) a northern area, mainly inhabited by alien P. leniusculus, where crayfish plague cases are associated with the b-haplotype specific to P. leniusculus, and (ii) southern, central and eastern areas that are basically inhabited by alien P. clarkii, where crayfish plague cases are associated with the d1- and d2-haplotypes specific to P. clarkii. The results presented here are evidence of the long standing and negative impact of the two invasive crayfish species on the native species, indicating the need for more extensive control measures., Competing Interests: The authors have declared that no competing interests exist.

Many typescripts in this issue describe increasing use of HLA-haplotype-matched transplants in persons with leukaemia and report outcomes. Consequently, my goal is not to repeat these data but to focus on controversies and challenges relevant to this topic including: (1) what is the best technique for performing these transplants; (2) who is the best donor; (3) who should receive this type of transplant; (4) how do results compare with transplants from other donors; and (5) how can results be improved.

The major histocompatibility complex (MHC) is a central component of the vertebrate immune system and hence evolves in the regime of a host-pathogen evolutionary race. The MHC is associated with quantitative traits which directly affect fitness and are subject to selection pressure. The evolution of haplotypes at the MHC HLA (HLA) locus is generally thought to be governed by selection for increased diversity that is manifested in overdominance and/or negative frequency-dependent selection (FDS). However, recently, a model combining purifying selection on haplotypes and balancing selection on alleles has been proposed. We compare the predictions of several population dynamics models of haplotype frequency evolution to the distributions derived from 6.59-million-donor HLA typings from the National Marrow Donor Program registry. We show that models that combine a multiplicative fitness function, extremely high haplotype discovery rates, and exponential fitness decay over time produce the best fit to the data for most of the analyzed populations. In contrast, overdominance is not supported, and population substructure does not explain the observed haplotype frequencies. Furthermore, there is no evidence of negative FDS. Thus, multiplicative fitness, rapid haplotype discovery, and rapid fitness decay appear to be the major factors shaping the HLA haplotype frequency distribution in the human population., Competing Interests: The authors declare no conflict of interest.

HLA matching is a prerequisite for successful allogeneic hematopoietic stem cell transplantation (HSCT) because it lowers the occurrence and severity of graft-versus-host disease (GVHD). However, matching a few alleles of the classic HLA genes only may not ensure matching of the entire MHC region. HLA haplotype matching has been reported to be beneficial in HSCT because of the variation relevant to GVHD risk in the non-HLA region. Because polymorphism in the MHC is highly population specific, we hypothesized that donors from the Finnish registry are more likely to be matched at a higher level for the Finnish patients than donors from other registries. In the present study we determined 25 single nucleotide polymorphisms (SNPs) of the complement component 4 (C4) gene in the γ-block segment of MHC from 115 Finnish HSCT patients and their Finnish (n = 201) and non-Finnish (n = 280) donor candidates. Full matching of HLA alleles and C4 SNPs, independently or additively, occurred more likely in the Finnish-Finnish group as compared with the Finnish-non-Finnish group (P < .003). This was most striking in cases with HLA haplotypes typical of the Finnish population. Patients with ancestral HLA haplotypes (AH) were more likely to find a full HLA and C4 matched donor, regardless of donor origin, as compared with patients without AH (P < .0001). Despite the clear differences at the population level, we could not find a statistical association between C4 matching and clinical outcome. The results suggest that screening C4 SNPs can be advantageous when an extended MHC matching or HLA haplotype matching in HSCT is required. This study also supports the need for small population-specific stem cell registries., (Copyright © 2018 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.)

Background: Pemphigus is a group of rare life-threatening mucocutaneous autoimmune diseases, presenting mainly as two subtypes: pemphigus vulgaris (PV) and pemphigus foliaceus (PF). Inherited predispositions to pemphigus have long been speculated but they remain poorly understood., Objectives: To identify common and specific nongenetic and genetic factors associated with pemphigus and its subtypes in the Chinese population., Methods: A genome-wide association study (GWAS) was performed in 496 unrelated patients with pemphigus (including 365 with PV and 104 with PF) and 1105 controls without pemphigus., Results: A sex preference was observed only in PV (57·5% female) and not in PF (47·1% female). For male patients only, the mean age at diagnosis was significantly lower for PV than for PF (P < 0·001). The strongest associated single-nucleotide polymorphisms are in the human leucocyte antigen (HLA) region: rs70993900 (PV; P = 1·5 × 10 -45 ) and rs9469220 (PF; P = 1·1 × 10 -8 ). HLA-DQB1*05:03 ranks at the top (P = 4·7 × 10 -40 ; odds ratio 12·4) in both subtypes, with significantly different risk allele frequency (RAF PV = 34·2% vs. RAF PF = 18·8% vs. RAF control = 4·4%), whereas HLA-DRB1*14:01 and HLA-DRB1*04:06 are PV specific. HLA-DQB1*03:03 and HLA-DQB1*03:02 show significant subtype specificity in opposite directions. All of these associations were validated in the replication series with 147 cases of pemphigus and 604 controls. Multiple novel non-HLA susceptibility loci were also identified in the GWAS., Conclusions: This study represents the largest GWAS on pemphigus in the Chinese population published to date, and has allowed us to identify HLA haplotypes significantly shared between or specific to the two main subtypes of pemphigus., (© 2018 British Association of Dermatologists.)

A human leukocyte antigen (HLA)-matched unrelated donor is the primary alternative donor for allogeneic hematopoietic cell transplantation in Japan. In considering an optimal donor registry size, the availability of HLA-matched donors is important. In this study, the probability of finding an HLA-A, -B, -C, and -DRB1 allele-matched donor was estimated using two different methods based on the haplotype frequencies in the Japanese population: an actual measurement method (AMM) and a formula method (FM). According to AMM, the probabilities of finding an HLA-matched donor were 40.5% in 100,000 donors, 54.4% in 300,000, 60.0% in 500,000, and 63.4% in 700,000. On the other hand, according to FM, the probabilities were 47.8% in 100,000 donors, 59.9% in 300,000, 65.3% in 500,000, and 68.8% in 700,000. The probabilities increased by 8.6 or 7.7%, 3.2 or 3.1%, 2.1 or 1.9%, and 1.6 or 1.3% in AMM or FM, respectively, as the registry size increased by 100,000. The rate of increase in the probability of finding an HLA-matched donor will become smaller as the registry size increases due to the diversity of haplotypes. Therefore, it is important to set a target donor registry size for efficient donor recruitment by considering the haplotype frequencies in the population.

Vitiligo is an autoimmune disease in which melanocyte destruction causes skin depigmentation, with 49 loci known from previous GWAS. Aiming to define vitiligo subtypes, we discovered that age-of-onset is bimodal; one-third of cases have early onset (mean 10.3 years) and two-thirds later onset (mean 34.0 years). In the early-onset subgroup we found novel association with MHC class II region indel rs145954018, and independent association with the principal MHC class II locus from previous GWAS, represented by rs9271597; greatest association was with rs145954018del-rs9271597A haplotype (P = 2.40 × 10 -86 , OR = 8.10). Both rs145954018 and rs9271597 are located within lymphoid-specific enhancers, and the rs145954018del-rs9271597A haplotype is specifically associated with increased expression of HLA-DQB1 mRNA and HLA-DQ protein by monocytes and dendritic cells. Thus, for vitiligo, MHC regulatory variation confers extreme risk, more important than HLA coding variation. MHC regulatory variation may represent a significant component of genetic risk for other autoimmune diseases.

Phagocytic activity of leukocytes in whole blood was assessed as a potential immune competence trait in chickens. A flow cytometry based whole blood phagocytosis (WBP) assay was set up and evaluated using blood from chickens homozygous for four different MHC haplotypes, B12, B15, B19 and B21. Fluorescent latex beads and two serotypes of fluorescently labelled heat-killed bacteria (Salmonella Infantis and Salmonella. Typhimurium) were evaluated as phagocytic targets. In addition, the opsonophagocytic potential (OPp) of individual sera from the birds was included in a phagocytosis assay using the HD11 chicken macrophage cell line. Results showed that both serotypes of bacteria but not the latex beads were effectively phagocytosed by leukocytes in the whole blood cultures. Differences were observed in the phagocytic capacity of monocytes and thrombocyte/lymphocytes, respectively between the different MHC lines. No significant differences on the OPp of serum was identified between MHC lines. In addition, for both phagocytic activity of leukocytes and OPp of serum large variations between individuals were observed within MHC haplotypes. No significant relationships were observed between the phagocytic activity of leukocytes and serum OPp or Salmonella-specific IgY levels. In conclusion, our results suggest that the WBP assay, using a no-lyse no-wash single staining method, is a rapid and convenient method to assess phagocytic functions of different leukocyte populations., (Copyright © 2018 Elsevier B.V. All rights reserved.)

Killer cell immunoglobulin-like receptors (KIR), considered the most polymorphic natural killer (NK) cell regulators, bind HLA class-I molecules or still unknown ligands. Interest in KIR genotyping is increasing because of the importance of these receptors for identifying the best possible donor in hematopoietic stem cell transplantation to obtain a graft-versus-leukemia effect. Currently, routine protocols to determine the gene content of the KIR cluster are exclusively performed by PCR-SSO and PCR-SSP. To improve the study of these genes, we developed a multiplex, long-range PCR strategy suitable for simultaneous, high-resolution HLA class I and KIR genotyping by next generation sequencing (NGS). This protocol allows amplification of the 14 KIR genes, 2 KIR pseudogenes, and HLA class I genes, with subsequent sequencing on an Illumina platform. The bioinformatics analysis for KIR genotyping was performed by virtual hybridization of gene-specific probes, and HLA genotyping was done by GenDx NGSengine software. To validate the method reliability, 192 genomic DNA samples previously characterized by PCR-SSO were used. When a specific KIR gene was present, a large number of gene-specific virtual probes were detected, whereas when it was absent, very few or none were found, enabling cutoff establishment. Concordance for both the KIR and HLA assignments as compared with the previous characterization was 100%. In conclusion, the multiplex PCR NGS-based strategy presented could provide an efficient, less costly method for KIR-ligand genotyping by gene presence/absence. Furthermore, allele resolution will be possible when KIR-specific software becomes available.

Rheumatic fever (RF) and its subsequent progression to rheumatic heart disease (RHD) are chronic inflammatory disorders prevalent in children and adolescents in underdeveloped countries, and a contributing factor for high morbidity and mortality rates worldwide. Their primary cause is oropharynx infection by Streptococcus pyogenes , whose acetylated residues are recognized by ficolin-1. This is the only membrane-bound, as well as soluble activator molecule of the complement lectin pathway (LP). Although LP genetic polymorphisms are associated with RF, FCN1 gene's role remains unknown. To understand this role, we haplotyped five FCN1 promoter polymorphisms by sequence-specific amplification in 193 patients (138 with RHD and 55, RF only) and 193 controls, measuring ficolin-1 serum concentrations in 78 patients and 86 controls, using enzyme-linked immunosorbent assay (ELISA). Patients presented lower ficolin-1 serum levels ( p < 0.0001), but did not differ according to cardiac commitment. Control's genotype distribution was in the Hardy-Weinberg equilibrium. Four alleles (rs2989727: c .- 1981A , rs10120023: c .- 542A , rs10117466: c .- 144A , and rs10858293: c.33T ), all associated with increased FCN1 gene expression in whole blood or adipose subcutaneous tissue ( p = 0.000001), were also associated with increased protection against the disease. They occur within the * 3C2 haplotype, associated with an increased protection against RF ( OR = 0.41, p < 0.0001) and with higher ficolin-1 levels in patient serum ( p = 0.03). In addition, major alleles of these same polymorphisms comprehend the most primitive * 1 haplotype, associated with increased susceptibility to RF ( OR = 1.76, p < 0.0001). Nevertheless, instead of having a clear-cut protective role, the minor c .- 1981A and c .- 144A alleles were also associated with additive susceptibility to valvar stenosis and mitral insufficiency ( OR = 3.75, p = 0.009 and OR = 3.37, p = 0.027, respectively). All associations were independent of age, sex or ethnicity. Thus, minor FCN1 promoter variants may play a protective role against RF, by encouraging bacteria elimination as well as increasing gene expression and protein levels. On the other hand, they may also predispose the patients to RHD symptoms, by probably contributing to chronic inflammation and tissue injury, thus emphasizing the dual importance of ficolin-1 in both conditions.

Significant progress has been made over the last decade in defining major histocompatibility complex (MHC) diversity at the nucleotide, allele, haplotype, diplotype, and population levels in many non-human species. Much of this progress has been driven by the increased availability and reduced costs associated with nucleotide sequencing technologies. This report provides an update on the activities of the comparative MHC nomenclature committee which is a standing committee of both the International Society for Animal Genetics (ISAG) and the International Union of Immunological Societies (IUIS) where it operates under the umbrella of the Veterinary Immunology Committee (VIC). A previous report from this committee in 2006 defined the role of the committee in providing guidance in the development of a standardized nomenclature for genes and alleles at MHC loci in non-human species. It described the establishment of the Immuno Polymorphism Database, IPD-MHC, which continues to provide public access to high quality MHC sequence data across a range of species. In this report, guidelines for the continued development of a universal MHC nomenclature framework are described, summarizing the continued development of each species section within the IPD-MHC project.

Human APOBEC3H (A3H) is a single-stranded DNA cytosine deaminase that inhibits HIV-1. Seven haplotypes (I-VII) and four splice variants (SV154/182/183/200) with differing antiviral activities and geographic distributions have been described, but the genetic and mechanistic basis for variant expression and function remains unclear. Using a combined bioinformatic/experimental analysis, we find that SV200 expression is specific to haplotype II, which is primarily found in sub-Saharan Africa. The underlying genetic mechanism for differential mRNA splicing is an ancient intronic deletion [del(ctc)] within A3H haplotype II sequence. We show that SV200 is at least fourfold more HIV-1 restrictive than other A3H splice variants. To counteract this elevated antiviral activity, HIV-1 protease cleaves SV200 into a shorter, less restrictive isoform. Our analyses indicate that, in addition to Vif-mediated degradation, HIV-1 may use protease as a  counter-defense mechanism against A3H in >80% of sub-Saharan African populations.

The Registries of Bone Marrow Donors around the world include more than 30 million volunteer donors from 57 different countries, and were responsible for over 17,000 hematopoietic stem cell transplants in 2016. The Brazilian Bone Marrow Volunteer Donor Registry (REDOME) was established in 1993 and is the third largest registry in the world with more than 4.3 million donors. We characterized HLA allele and haplotypes frequencies from REDOME comparing them with the donor self-reported race group classification. Five-locus haplotype frequencies (A~C~B~DRB1~DQB1) were estimated for each of the six race groups, resolving phase and allelic ambiguity using the expectation-maximization (EM) algorithm. The top 100 haplotypes in the race groups were separated into eight clusters of haplotypes, based on haplotype similarity, using CLUTO. We present HLA allele and haplotype frequency data from six race groups from 2,938,259 individuals from REDOME. The most frequent haplotype was the same for all groups: A*01:01g~C*07:01g~B*08:01g~DRB1*03:01g~DQB1*02:01g. Some frequent haplotypes such as A*02:01g~C*16:01g~B*44:03~DRB1*07:01g~DQB1*02:01g was not found in people with Preta (Sub-Saharan African descent). A cluster including Branca (European) and Parda or non-informed (admixed) could be distinguished from both Preta (SubSaharan) and Indígena (Amerindian) groups, and from the Amarela (Asian) ones, which clustered with their original population. These results have implications on cross-population matching and can help in donor searches and population-based recruitment strategies.

Pig-tailed macaques (Macaca nemestrina, Mane) are important models for human immunodeficiency virus (HIV) studies. Their infectability with minimally modified HIV makes them a uniquely valuable animal model to mimic human infection with HIV and progression to acquired immunodeficiency syndrome (AIDS). However, variation in the pig-tailed macaque major histocompatibility complex (MHC) and the impact of individual transcripts on the pathogenesis of HIV and other infectious diseases is understudied compared to that of rhesus and cynomolgus macaques. In this study, we used Pacific Biosciences single-molecule real-time circular consensus sequencing to describe full-length MHC class I (MHC-I) transcripts for 194 pig-tailed macaques from three breeding centers. We then used the full-length sequences to infer Mane-A and Mane-B haplotypes containing groups of MHC-I transcripts that co-segregate due to physical linkage. In total, we characterized full-length open reading frames (ORFs) for 313 Mane-A, Mane-B, and Mane-I sequences that defined 86 Mane-A and 106 Mane-B MHC-I haplotypes. Pacific Biosciences technology allows us to resolve these Mane-A and Mane-B haplotypes to the level of synonymous allelic variants. The newly defined haplotypes and transcript sequences containing full-length ORFs provide an important resource for infectious disease researchers as certain MHC haplotypes have been shown to provide exceptional control of simian immunodeficiency virus (SIV) replication and prevention of AIDS-like disease in nonhuman primates. The increased allelic resolution provided by Pacific Biosciences sequencing also benefits transplant research by allowing researchers to more specifically match haplotypes between donors and recipients to the level of nonsynonymous allelic variation, thus reducing the risk of graft-versus-host disease.

Celiac disease (CD) is an autoimmune/inflammatory condition triggered by dietary gluten intake in genetically predisposed individuals. Though associations with MHC class II HLA-DQ2 or -DQ8 are the primary and necessary genetic predisposition for CD, >97% of genetically predisposed individuals never develop CD. Cytokines were measured in the serum of CD patients and controls. Possible associations with IL10 promoter variants were investigated. Cytokine expression from PBMCs was monitored in response to gluten exposure, or CD3/TCR complex stimulation in the absence or presence of recombinant IL-10. Serum cytokines varied between patients with CD at the time of diagnosis, after dietary elimination of gluten, and healthy controls. Serum IL-17A reflected disease activity. Reduced IL-10 serum levels and altered IL-10 expression by PBMCs coincided with IL10 promoter haplotypes that encode for "low" IL-10 expression (ATA). Increased prevalence of ATA IL10 promoter haplotypes and subsequently reduced IL-10 expression may be an immunological cofactor in individuals genetically predisposed for the development of CD. Resulting cytokine imbalances may be utilized as disease biomarkers in CD., (Copyright © 2018 Elsevier Inc. All rights reserved.)

Natural killer (NK) cells are lymphocytes of innate immunity that respond to virus infected and tumor cells. After allogeneic transplantation, NK cells are the first reconstituting lymphocytes, but are dysfunctional. Manipulating this first wave of lymphocytes could be instrumental in reducing the 40% relapse rate following transplantation with reduced-intensity conditioning. NK cells express numerous activating and inhibitory receptors. Some recognize classical or nonclassical HLA class I ligands, others recognize class I-like ligands or unrelated ligands. Dominant in the NK-cell transplant literature are killer cell immunoglobulin-like receptors (KIRs), encoded on chromosome 19q. Inhibitory KIR recognition of the cognate HLA class I ligand is responsible for NK-cell education, which makes them tolerant of healthy cells, but responsive to unhealthy cells having reduced expression of HLA class I. KIR A and KIR B are functionally distinctive KIR haplotype groups that differ in KIR gene content. Allogeneic transplant donors having a KIR B haplotype and lacking a recipient HLA-C epitope provide protection against relapse from acute myeloid leukemia. Cytomegalovirus infection stimulates and expands a distinctive NK-cell population that expresses the NKG2C receptor and exhibits enhanced effector functions. These adaptive NK cells display immune memory and methylation signatures like CD8 T cells. As potential therapy, NK cells, including adaptive NK cells, can be adoptively transferred with, or without, agents such as interleukin-15 that promote NK-cell survival. Strategies combining NK-cell infusions with CD16-binding antibodies or immune engagers could make NK cells antigen specific. Together with checkpoint inhibitors, these approaches have considerable potential as anticancer therapies., (© 2018 by The American Society of Hematology.)

HIV-1-specific cytotoxic T cells (CTLs) play an important role in the control of HIV-1 subtype B or C infection. However, the role of CTLs in HIV-1 subtype A/E infection still remains unclear. Here we investigated the association of HLA class I alleles with clinical outcomes in treatment-naive Vietnamese infected with subtype A/E virus. We found that HLA-C*12:02 was significantly associated with lower plasma viral loads (pVL) and higher CD4 counts and that the HLA-A*29:01-B*07:05-C*15:05 haplotype was significantly associated with higher pVL and lower CD4 counts than those for individuals without these respective genotypes. Nine Pol and three Nef mutations were associated with at least one HLA allele in the HLA-A*29:01-B*07:05-C*15:05 haplotype, with a strong negative correlation between the number of HLA-associated Pol mutations and CD4 count as well as a positive correlation with pVL for individuals with these HLA alleles. The results suggest that the accumulation of mutations selected by CTLs restricted by these HLA alleles affects HIV control. IMPORTANCE Most previous studies on HLA association with disease progression after HIV-1 infection have been performed on cohorts infected with HIV-1 subtypes B and C, whereas few such population-based studies have been reported for cohorts infected with the Asian subtype A/E virus. In this study, we analyzed the association of HLA class I alleles with clinical outcomes for 536 HIV-1 subtype A/E-infected Vietnamese individuals. We found that HLA-C*12:02 is protective, while the HLA haplotype HLA-A*29:01-B*07:05-C*15:05 is deleterious. The individuals with HIV-1 mutations associated with at least one of the HLA alleles in the deleterious HLA haplotype had higher plasma viral loads and lower CD4 counts than those of individuals without the mutations, suggesting that viral adaptation and escape from HLA-mediated immune control occurred. The present study identifies a protective allele and a deleterious haplotype for HIV-1 subtype A/E infection which are different from those identified for cohorts infected with HIV-1 subtypes B and C., (Copyright © 2018 American Society for Microbiology.)

We recently advocated in favour of naming a novel H2-haplotype consisting of K d , D/L dm7 , I-A k and I-E k in the atopic dermatitis (AD) mouse model NC/Nga as "H-2 nc ." The role of the H2-haplotype in AD development was investigated in H2 b -congenic NC/Nga mice (NC.h2 b/b and NC.h2 b/nc ) established by backcrossing. A severe 2,4-dinitrofluorobenzene (DNFB)-induced dermatitis in NC/Nga was alleviated partially in NC.h2 b/nc and significantly in NC.h2 b/b . The AD phenotype was correlated with thymic stromal lymphopoietin (TSLP)-epidermal expression levels and serum levels of total IgE and IL-18/IL-33. Histologically, allergic contact dermatitis (ACD) was accompanied by lymphocytes and plasma cells-infiltrating perivasculitis in NC.h2 b/nc and NC.h2 b/b and clearly differed from AD accompanied by neutrophils, eosinophils and macrophages-infiltrating diffuse suppurative dermatitis in NC/Nga. Interestingly, IFN-γ/IL-17 production from autoreactive CD4 + T-cells remarkably increased in DNFB-sensitised NC.h2 b/b but not in NC/Nga. Our findings suggest that AD or ACD may depend on haplotype H-2 nc or H-2 b , respectively, in addition to the NC/Nga genetic background.

HLA-B*52:01-C*12:02, which is found in approximately 20% of all Japanese persons, is well known to be associated with ulcerative colitis and Takayasu arteritis. This haplotype is also known to be protective in individuals infected with human immunodeficiency virus (HIV) type 1. Recent studies showed that HLA-B*52:01-restricted HIV-1-specific T cells suppress HIV-1 and that HLA-C*12:02 together with KIR2DL2 play an important role in natural killer cell-mediated control of HIV-1. However, the role of HLA-C*12:02-restricted cytotoxic T lymphocytes (CTLs) in suppressing HIV-1 replication remains unknown. In the present study, we demonstrated that HLA-C*12:02-restricted CTLs specific for 2 immunodominant epitopes, Pol IY11 and Nef MY9, contributed to the suppression of HIV-1 replication in HIV-1-infected individuals. Further analysis demonstrated that these 2 HLA-C*12:02-restricted CTLs together with 4 HLA-B*52:01-restricted ones effectively suppressed HIV-1 in individuals with the HLA-B*52:01-C*12:02 haplotype. Thus, both HLA-C*12:02 and HLA-B*52:01 alleles contribute to HIV-1 suppression via both HIV-1-specific CTLs and natural killer cells in individuals with this haplotype., (© The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.)

A new MICA allelic variant, MICA*012:05, has been identified in a Chinese Mongolian population. Following polymerase chain reaction-sequence-based typing (PCR-SBT), this new allele was further confirmed by cloning and sequencing. MICA*012:05 was linked to an HLA-A*24-C*01-B*55:02-DRB1*09 haplotype. MICA*012:05 differs from MICA*012:01 by a single synonymous C to T substitution at nucleotide position 269 in exon 3., (© 2016 John Wiley & Sons Ltd.)

Rheumatoid arthritis (RA) is a chronic autoimmune inflammatory disease that leads to destructive arthritis. Although the HLA class II locus is the strongest genetic risk factor for rheumatoid arthritis, the relationship between HLA class II alleles and lymphocyte activation remains unclear. We performed immunophenotyping of peripheral blood mononuclear cells on 91 HLA-DRB1-genotyped RA patients and 110 healthy donors. The frequency of memory CXCR4(+)CD4(+) T cells, and not Th1 and Th17 cells, was significantly associated with disease severity by multiple linear regression analysis. RA patients with one or more susceptible HLA-DR haplotypes (shared epitope: SE) displayed a significantly higher frequency of memory CXCR4(+)CD4(+) T cells. Moreover, the frequency of memory CXCR4(+)CD4(+) T cells significantly correlated with the expression level of HLA-DR on B cells, which was elevated in RA patients with SE. In vitro analysis and transcriptomic pathway analysis suggested that the interaction between HLA-DR and T cell receptors is an important regulator of memory CXCR4(+)CD4(+) T cells. Clinically, a higher frequency of memory CXCR4(+)CD4(+) T cells predicted a better response to CTLA4-Ig. Memory CXCR4(+)CD4(+) T cells may serve as a powerful biomarker for unraveling the linkage between HLA-DRB1 genotype and disease activity in RA.

Study Objectives: Narcolepsy with cataplexy is tightly associated with the HLA class II allele DQB1*06:02. Evidence indicates a complex contribution of HLA class II genes to narcolepsy susceptibility with a recent independent association with HLA-DPB1. The cause of narcolepsy is supposed be an autoimmune attack against hypocretin-producing neurons. Despite the strong association with HLA class II, there is no evidence for CD4+ T-cell-mediated mechanism in narcolepsy. Since neurons express class I and not class II molecules, the final effector immune cells involved might include class I-restricted CD8+ T-cells., Methods: HLA class I (A, B, and C) and II (DQB1) genotypes were analyzed in 944 European narcolepsy with cataplexy patients and in 4,043 control subjects matched by country of origin. All patients and controls were DQB1*06:02 positive and class I associations were conditioned on DQB1 alleles., Results: HLA-A*11:01 (OR = 1.49 [1.18-1.87] P = 7.0*10(-4)), C*04:01 (OR = 1.34 [1.10-1.63] P = 3.23*10(-3)), and B*35:01 (OR = 1.46 [1.13-1.89] P = 3.64*10(-3)) were associated with susceptibility to narcolepsy. Analysis of polymorphic class I amino-acids revealed even stronger associations with key antigen-binding residues HLA-A-Tyr(9) (OR = 1.32 [1.15-1.52] P = 6.95*10(-5)) and HLA-C-Ser(11) (OR = 1.34 [1.15-1.57] P = 2.43*10(-4))., Conclusions: Our findings provide a genetic basis for increased susceptibility to infectious factors or an immune cytotoxic mechanism in narcolepsy, potentially targeting hypocretin neurons., (© 2016 Associated Professional Sleep Societies, LLC.)

Three novel HLA-Class II alleles, DRB1*03:112, DQB1*03:02:16 and DQB1*03:139, are described with predicted bearing haplotypes of A*02:01, B*40:01, C*03:04, DRB1*03:112, DQB1*02:01; A*23:01, B*15:01, C*03:03, DRB1*04:01, DQB1*03:02:16 and A*01:01, B*44:02, C*05:01/03, DRB1*04:01, DQB1*03:139. Serological tests showed that the DRB1*03:112 and DQB1*03:139 specificities failed to react as expected with some well-documented monoclonal antibodies. Subsequent examination of published HLA-Class II epitopes and inspection of amino acid motifs suggested that epitopes exist that include the positions of their single substitutions (F31C between DRB1*03:01:01:01 and DRB1*03:112, and R48P between DQB1*03:01:01:01 and DQB1*03:139 specificities). This suggests that the reactivity of the monoclonal antibodies used was dependent on these epitopes and that their loss from these rare allele products resulted in their aberrant serology. The new alleles were found after the sequence-based typing of 32 530 random UK European routine blood donors suggesting that each has a maximum carriage frequency of 0.0031% in the blood donor population resident in Wales., (© 2015 John Wiley & Sons Ltd.)

We have now found a total of 15 individual MICB promoter sequences, varying by combination of 18 polymorphic positions within the MICB minimal promoter sequence. Sequence-based typing and cloning characterized the three new 5' promoter sequences as MICB-P13, MICB-P14 and MICB-P15., (© 2015 John Wiley & Sons Ltd.)

Many patients with hematologic malignancies cannot tolerate hematopoietic cell transplantation (HCT), whereas others may not have a compatible human leukocyte antigen-matched donor. To overcome these limitations, we optimized a conditioning regimen employing anti-CD45 radioimmunotherapy (RIT) replacing total body irradiation (TBI) before haploidentical HCT in a murine model. Mice received 200 to 400 μCi (90)Y-anti-CD45 antibody (30F11), with or without fludarabine (5 days starting day -8), with cyclophosphamide (CY; days -2 and +2) for graft-versus-host disease prophylaxis, and 1.5 × 10(7) haploidentical donor bone marrow cells (day 0). Haploidentical bone marrow transplantation (BMT) with 300 μCi (90)Y-anti-CD45 RIT and CY, without TBI or fludarabine, led to mixed chimeras with 81.3 ± 10.6% mean donor origin CD8(+) cells detected 1 month after BMT, and remained stable (85.5 ± 11% mean donor origin CD8(+) cells) 6 months after haploidentical BMT. High chimerism levels were induced across multiple hematopoietic lineages 28 days after haploidentical BMT with 69.3 ± 14.1%, 75.6 ± 20.2%, and 88.5 ± 11.8% CD3(+) T cells, B220(+) B cells, and CD11b(+) myeloid cells, respectively. Fifty percent of SJL leukemia-bearing mice treated with 400 μCi (90)Y-DOTA-30F11, CY, and haploidentical BMT were cured and lived >200 days. Mice treated with 200 μCi (90)Y-DOTA-30F11 had a median overall survival of 73 days, while untreated leukemic mice had a median overall survival of 34 days (P < .001, Mantel-Cox test). RIT-mediated haploidentical BMT without TBI may increase treatment options for aggressive hematologic malignancies., (© 2016 by The American Society of Hematology.)

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

In haploidentical (haplo)-cord blood (CB) transplantations, early haplo donor engraftment serves as a myeloid bridge to sustainable CB engraftment and is associated with early neutrophil recovery. The conditioning regimens as published for haplo-cord protocols usually contain serotherapy, such as rabbit antithymocyte globulin (ATG) (Thymoglobulin, Genzyme, Cambridge, MA). However, reducing or omitting serotherapy is an important strategy to improve early immune reconstitution after transplantation. The need for serotherapy in successful haplo-cord transplantation, defined as having a haplo-derived myeloid bridge to CB engraftment, has not been investigated before. Two consecutive cohorts of patients underwent transplantation with haplo-CB. The first group underwent transplantation with haplo-CB for active infection and/or an underlying condition with expected difficult engraftment without a conventional donor available. They received a single unit (s) CB and haplo donor cells (CD34(+) selected, 5 × 10(6) CD34(+)/kg). The second cohort included patients with poor-risk malignancies, not eligible for other treatment protocols. They received a sCB and haplo donor cells (CD19/αβTCR-depleted; 5 × 10(6) CD34(+)/kg). Retrospectively in both cohorts, active ATG (Thymoglobulin) levels were measured and post-hematopoietic cell transplantation area under the curve (AUC) was calculated. The influence of ATG exposure for having a successful haplo-myeloid bridge (early haplo donor engraftment before CB engraftment and no secondary neutropenia) and transplantation-related mortality (TRM) were analyzed as primary endpoints. Twenty patients were included (16 in the first cohort and 4 in the second cohort). In 58% of evaluable patients, there was no successful haplo-derived myeloid bridge to CB engraftment, for which a low post-transplantation ATG exposure appeared to be a predictor (P <.001). TRM in the unsuccessful haplo-bridge group was 70% ± 16% versus 12% ± 12% in the successful haplo-bridge group (P = .012). In conclusion, sufficient in vivo T depletion with ATG is required for a successful haplo-myeloid bridge to CB engraftment., (Copyright © 2015 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.)

African American hemophilia A (HA) patients experience a higher incidence of neutralizing anti-factor VIII (FVIII) antibodies ("inhibitors") vis-à-vis white patients. Nonsynonymous single-nucleotide polymorphisms (ns-SNPs) in the F8 gene encoding FVIII-H484, FVIII-E1241, and FVIII-V2238 are more prevalent in African Americans. This study tested the hypothesis that immune responses to these sites provoke inhibitors. Blood samples were obtained from 174 African American and 198 white HA subjects and their F8 gene sequences determined. Major histocompatibility complex class II binding and T-cell recognition of polymorphic sequences were evaluated using quantitative binding assays and HLA-DRB1 tetramers. Peptides corresponding to 4 common ns-SNPs showed limited binding to 11 HLA-DRB1 proteins. CD4 T cells from 22 subjects treated with FVIII products having sequences at residues FVIII-484, 1241, and 2238 differing from those of putative proteins encoded by their F8 genes did not show high-avidity tetramer binding, whereas positive-control staining of tetanus-specific CD4 T cells was routinely successful. African Americans with an intron-22 inversion mutation showed a 2-3 times-higher inhibitor incidence than whites with the same mutation (odds ratio = 2.3 [1.1-5.0, P = .04]), but this did not correlate with any of the ns-SNPs. We conclude that immune responses to "sequence-mismatched" FVIII products are unlikely to contribute appreciably to the inhibitor incidence in African Americans.

Therapeutic vaccination of cancer patients with dendritic cells aims at inducing a strong tumor-specific T-cell response. Testing new target antigens for their immunogenicity is crucial to evaluate their suitability for this approach. Here we demonstrate a comfortable and reliable method to detect antigen-specific CD8(+) T-cell responses without the knowledge of the precise T-cell epitope and without the usage of additional target cells. We used the CD8(+) T cells themselves and electroporated them with RNA encoding the respective tumor antigen. The cells expressed, processed and presented the antigen and were capable of stimulating each other in functional readouts. For the model antigen MelanA, the number of interferon-γ-secreting cells obtained with this method highly correlated with the numbers obtained by exogenous peptide loading (R(2)=0.8). The method was also applicable for the tumor-associated antigen Wilms' tumor protein 1. This system is quick and easy to perform, independent of the donors human leukocyte antigen type and circumvents the need for additional cells as targets. It can be used in preclinical research to test new antigens for their immunogenic potential and for immunomonitoring in cancer patients.

Rheumatoid arthritis (RA) is associated with amino acid variants in multiple MHC molecules. The association to MHC class II (MHC-II) has been studied in several animal models of RA. In most cases these models depend on T cells restricted to a single immunodominant peptide of the immunizing Ag, which does not resemble the autoreactive T cells in RA. An exception is pristane-induced arthritis (PIA) in the rat where polyclonal T cells induce chronic arthritis after being primed against endogenous Ags. In this study, we used a mixed genetic and functional approach to show that RT1-Ba and RT1-Bb (RT1-B locus), the rat orthologs of HLA-DQA and HLA-DQB, determine the onset and severity of PIA. We isolated a 0.2-Mb interval within the MHC-II locus of three MHC-congenic strains, of which two were protected from severe PIA. Comparison of sequence and expression variation, as well as in vivo blocking of RT1-B and RT1-D (HLA-DR), showed that arthritis in these strains is regulated by coding polymorphisms in the RT1-B genes. Motif prediction based on MHC-II eluted peptides and structural homology modeling suggested that variants in the RT1-B P1 pocket, which likely affect the editing capacity by RT1-DM, are important for the development of PIA., (Copyright © 2015 by The American Association of Immunologists, Inc.)

We investigated the clinical characteristics of acute lymphoblastic leukemia (ALL) patients undergoing allogeneic hematopoietic stem cell transplantation (allo-HSCT) using haploidentical donors carrying HLA-B*58:01/TNFα − 308A (B*58:01-TNF2) haplotype. A total of 136 B-ALL and 29T/NK-ALL cases were recruited. DNA samples from the patients and their family members were assayed for HLA typing and genotyping of TNFα -308 (rs1800629). The B*58:01-TNF2 haplotype in related donors was determined by their family relationships. Outcomes within 2 years, disease course, and complications within 100 days were compared among patients using haploidentical donors carrying B*58:01-TNF2 haplotype (21 cases), those using haploidentical donors without B*58:01-TNF2 haplotype (100 cases), and those using HLA-identical sibling donors with or without B*58:01-TNF2 haplotype (44 cases). Compared with the other two groups, patients using haploidentical donors carrying B*58:01-TNF2 haplotype had higher overall mortality (adjusted P = 0.039) and non-relapse mortality (adjusted P = 0.001) within 2 years, delayed platelet engraftment (adjusted P < 0.0001), higher incidences of severe acute graft-versus-host disease (aGVHD) (P = 0.007), severe late-onset hemorrhagic cystitis (P = 0.002), blood stream infection (P = 0.017), and invasive fungal disease (P = 0.004) within 100 days. Therefore, donors carrying the B*58:01-TNF2 haplotype may cause more serious complications and poorer outcomes to ALL recipients., (Copyright © 2014 Elsevier B.V. All rights reserved.)