Search

Chen-Yu Han, Xiao-Mei Ye, Jia-Ping Lu, Hai-Ying Jin, Ping Wang, Wei-Wei Xu, Min Zhang Department of Endocrinology, Qingpu Branch of Zhongshan Hospital Affiliated to Fudan University, Shanghai, 201700, People’s Republic of ChinaCorrespondence: Min Zhang, Department of Endocrinology, Qingpu Branch of Zhongshan Hospital Affiliated to Fudan University, No. 1158 of Gongyuan Road, Qingpu District, Shanghai, 201700, People’s Republic of China, Tel +86 18116016187, Fax +86 021-69719190, Email zhangmin1497mm@outlook.comObjective: Benaglutide is a glucagon-like peptide-1 receptor agonist (GLP-1RA) that has been approved in the treatment of type 2 diabetes mellitus (T2DM). It is known to lead to significant weight loss, and it is hypothesized that changes in gut microbiota may play a significant role in such weight loss. However, it is unclear how gut microbiota and metabolites change as a result of benaglutide treatment.Methods: Healthy participants and patients with T2DM were included in this study. They received differentiated treatments, and stool specimens were collected separately. These stool specimens were subjected to 16S ribosomal RNA amplicon and metagenomic sequencing to create fecal metabolomic profiles. The diversity of gut microbiota and metabolic products in the stools of each participant was analyzed.Results: The data showed that Faecalibacterium prausnitzii was abundant in the gut microbiota of the control group, which was entirely made up of healthy individuals; however, it showed a statistically significant decrease in patients with T2DM treated with metformin alone, while no significant decrease was observed in patients treated with metformin combined with benaglutide. A metagenomic analysis revealed that benaglutide could improve the fecal microbiota diversity in patients with T2DM. Furthermore, there was a statistically significant correlation between the changes in the metabolites of patients with T2DM and the changes in their gut microbiota (including F. prausnitzii) after treatment with metformin and benaglutide.Conclusion: These findings suggest that the weight-reducing effect of benaglutide is attributed to its ability to normalize the gut microbiota of patients with T2DM, particularly by increasing the abundance of F. prausnitzii.Keywords: benaglutide, gut microbiota, metabolites, type 2 diabetes mellitus, T2DM

Chen-Yu Han, Xiao-Mei Ye, Jia-Ping Lu, Hai-Ying Jin, Wei-Wei Xu, Ping Wang, Min Zhang Department of Endocrinology, Qingpu Branch of Zhongshan Hospital Affiliated to Fudan University, Shanghai, 201700, People’s Republic of ChinaCorrespondence: Min Zhang, Department of Endocrinology, Qingpu Branch of Zhongshan Hospital Affiliated to Fudan University, No. 1158 of Gongyuan Road, Qingpu District, Shanghai, 201700, People’s Republic of China, Tel +86 18116016187, Fax +86 021-69719190, Email zhangmin1497mm@outlook.comBackground: Exogenous insulin antibody syndrome (EIAS) is an immunological disorder caused by circulating insulin antibodies (IAs), featuring hypersensitivity to exogenous insulin and insulin resistance. With the wide use of recombinant human insulin and insulin analogs, there has been a significant proliferation of EIAS.Case Report: We describe two cases of diabetes mellitus (DM) with hyperinsulinemia and high serum levels of IAs. They had never been exposed to methimazole, glutathione, lipoic acid, and other sulfhydryl drugs, but they all received insulin treatment. The patient in case 1 had recurrent hypoglycemia before hospitalization. A prolonged oral glucose tolerance test (OGTT) showed hypoglycemia with inappropriately high insulin levels. The patient in case 2 was hospitalized for diabetic ketosis. An OGTT indicated hyperglycemia with hyperinsulinemia and low levels of C-peptide. IAs induced by exogenous insulin in the two patients with DM were positive at high titers, prompting a diagnosis of another condition—EIAS.Conclusion: We discussed the differences between these two cases of EIAS in clinical manifestations and treatment and summarized all patients of EIAS treated in our department to date.Keywords: diabetes mellitus, exogenous insulin, hyperinsulinemia, insulin antibodies, IAs

Chad Yixian Han,1 Yogesh Sharma,2,3 Alison Yaxley,1 Claire Baldwin,1 Richard Woodman,2 Michelle Miller1 1Caring Futures Institute, College of Nursing and Health Sciences, Flinders University, Adelaide, SA, Australia; 2College of Medicine and Public Health, Flinders University, Adelaide, SA, Australia; 3Department of General Medicine, Flinders Medical Centre, Adelaide, SA, AustraliaCorrespondence: Chad Yixian Han, Caring Futures Institute, College of Nursing and Health Sciences, Flinders University, Sturt Road, Bedford Park, SA5042; GPO Box 2100, Adelaide, SA, 5001, Australia, Tel +61 8201 3911, Email chad.han@flinders.edu.auPurpose: Pre-frailty and frailty in older adults are associated with poor health outcomes and increase health-care costs, and further worsening during hospitalization. This study aimed to examine the effect of an individualized hospital to home, exercise-nutrition self-managed intervention for pre-frail and frail hospitalized older adults.Patients and Methods: Older adults admitted to an acute medical unit of a tertiary hospital in South Australia who were pre-frail or frail were recruited from September 2020 to June 2021, randomized to either control or intervention group and followed up at 3 and 6 months. The outcome variables were program adherence, frailty status by the Edmonton Frail Scale (EFS) score, lower extremity physical function, handgrip strength, nutritional status, cognition, mood, health-related quality of life, risk of functional decline, unplanned readmissions.Results: Participants were 79.2 ± 6.6 years old, 63% female, mostly frail (67%), with EFS of 8.6± 1.9. Adherence to the inpatient and home visits/telehealth intervention were high (91± 13% and 92± 21%, respectively). Intention-to-treat analysis using linear regression models showed that participants in the intervention group had significantly greater reduction in EFS at 3 (− 3.0; 95% CI: − 4.8 to − 3.0) and 6 months (− 2.5; 95% CI: − 3.8 to − 1.0, P< 0.001 for both) compared to the control group; particularly the functional performance component. There were also improvements in overall Short Physical Performance Battery score at 3 (4.0; 95% CI: 1.3 to 6.6) and 6 months (3.9; 95% CI: 1.0 to 6.9, P< 0.05 for both), mini-mental state examination (2.6; 95% 0.3– 4.8, P=0.029) at 3 months and handgrip strength (3.7; 95% CI: 0.2– 7.1, P=0.039) and Geriatric Depression Scale, at 6 months (− 2.2; 95% CI: − 4.1 to − 0.30, P=0.026) in the intervention group as compared to control.Conclusion: This study provided evidence of acceptability to a patient self-managed exercise-nutrition program that may benefit and alleviate pre-frailty and frailty in hospitalised older adults.Keywords: frailty, self-management, exercise, nutrition therapy

Yong-Guang Wei, Cheng-Kun Yang, Zhong-Liu Wei, Xi-Wen Liao, Yong-Fei He, Xin Zhou, Hua-Sheng Huang, Chen-Lu Lan, Chuang-Ye Han, Tao Peng Department of Hepatobiliary Surgery, The First Affiliated Hospital of Guangxi Medical University, Nanning, 530021, Guangxi Zhuang Autonomous Region, People’s Republic of ChinaCorrespondence: Tao PengDepartment of Hepatobiliary Surgery, The First Affiliated Hospital of Guangxi Medical University, Shuang Yong Road 6, Nanning, Guangxi Zhuang Autonomous Region, People’s Republic of ChinaTel +86-771-5356528Fax +86-771-5350031Email pengtaogmu@163.comBackground: The protein high-mobility group AT-hook 1 (HMGA1) has been demonstrated that modulated cellular proliferation, invasion, and apoptosis with a poor prognosis in miscellaneous carcinomas. However, the mechanism of circumstantial carcinogenesis and association with the immune microenvironment of HMGA1 in hepatocellular carcinoma (HCC) had not been extensively explored.Methods: The gene expression, clinicopathological correlation, and prognosis analysis were performed in the data obtained from TCGA. The results were further validated by ICGC and GEO database and external validation cohort from Guangxi. The HMGA1 protein expression was further examined in the HPA database. Biological function analyses were conducted by GSEA, STRING database, and Coexpedia online tool. Using TIMER and CIBERSORT method, the relationship between immune infiltrate and HMGA1 was investigated.Results: In HCC, HMGA1 had much higher transcriptional and proteomic expression than in corresponding paraneoplastic tissue. Patients with high HMGA1 expression had a poor prognosis and unpromising clinicopathological features. High HMGA1 expression was closely related to the cell cycle, tumorigenesis, substance metabolism, and immune processes by regulating complex signaling pathways. Notably, HMGA1 may be associated with TP53 mutational carcinogenesis. Moreover, increased HMGA1 expression may lead to an increase in immune infiltration and a decrease in tumor purity in HCC. CIBERSORT analysis elucidated that the amount of B cell naive, B cell memory, T cells gamma delta, macrophages M2, and mast cell resting decreased when HMGA1 expression was high, whereas T cells follicular helper, macrophages M0, and Dendritic cells resting increased.Conclusion: In conclusions, HMGA1 is a potent prognostic biomarker and a sign of immune infiltration in HCC, which may be a potential immunotherapy target for HCC.Keywords: hepatocellular carcinoma, HMGA1, prognostic signature, bioinformatics, immune filtration

Cui-yan Han,1,2 Li-ling Yue,2 Ling-yu Tai,1 Li Zhou,2 Xue-yan Li,2 Gui-hua Xing,2 Xing-gang Yang,1 Ming-shuang Sun,1 Wei-san Pan1 1School of Pharmacy, Shenyang Pharmaceutical University, Shenyang, People’s Republic of China; 2Qiqihar Medical University, Qiqihar, People’s Republic of China Abstract: The epidermal growth factor receptor (EGFR) serves an important function in the proliferation of tumors in humans and is an effective target for the treatment of cancer. In this paper, we studied the targeting characteristics of small peptides (AEYLR, EYINQ, and PDYQQD) that were derived from three major autophosphorylation sites of the EGFR C-terminus domain in vitro. These small peptides were labeled with fluorescein isothiocyanate (FITC) and used the peptide LARLLT as a positive control, which bound to putative EGFR selected from a virtual peptide library by computer-aided design, and the independent peptide RALEL as a negative control. Analyses with flow cytometry and an internalization assay using NCI-H1299 and K562 with high EGFR and no EGFR expression, respectively, indicated that FITC-AEYLR had high EGFR targeting activity. Biotin-AEYLR that was specifically bound to human EGFR proteins demonstrated a high affinity for human non-small-cell lung tumors. We found that AEYLR peptide-conjugated, nanostructured lipid carriers enhanced specific cellular uptake in vitro during a process that was apparently mediated by tumor cells with high-expression EGFR. Analysis of the MTT assay indicated that the AEYLR peptide did not significantly stimulate or inhibit the growth activity of the cells. These findings suggest that, when mediated by EGFR, AEYLR may be a potentially safe and efficient delivery ligand for targeted chemotherapy, radiotherapy, and gene therapy. Keywords: EGFR, small peptide, tumor targeting, lung cancer, NLC

The problem of determining the inputs to the rotary axes of a 5-axis CNC machine is addressed, such that relative variations of orientation between the tool axis and surface normal are minimized subject to the constraint of maintaining a constant cutting speed with a ball-end tool. In the context of an orientable-spindle machine, the results of a prior study are directly applicable to the solution of this inverse-kinematics problem. However, since they are expressed in terms of the integral of the geodesic curvature, a discrete time-step solution is proposed that yields accurate rotary-axis increments at high sampling frequencies. For an orientable-table machine, a closed-form solution that specifies the rotary-axis positions as functions of the surface normal variation along the toolpath is possible. In this context, however, the feasibility of a solution is dependent upon the surface normal along the toolpath satisfying certain orientational constraints. These inverse-kinematics solutions facilitate accurate and efficient 5-axis machining of free-form surfaces without "unnecessary" actuation of the machine rotary axes. © 2013 Elsevier B.V.

A characterization for spatial Pythagorean-hodograph (PH) curves of degree 7 with rotation-minimizing Euler-Rodrigues frames (ERFs) is determined, in terms of one real and two complex constraints on the curve coefficients. These curves can interpolate initial/final positions pi and pf and orientational frames (ti,ui,vi) and ( tf,uf,vf) so as to define a rational rotation-minimizing rigid body motion. Two residual free parameters, that determine the magnitudes of the end derivatives, are available for optimizing shape properties of the interpolant. This improves upon existing algorithms for quintic PH curves with rational rotation-minimizing frames (RRMF quintics), which offer no residual freedoms. Moreover, the degree 7 PH curves with rotation-minimizing ERFs are capable of interpolating motion data for which the RRMF quintics do not admit real solutions. Although these interpolants are of higher degree than the RRMF quintics, their rotation-minimizing frames are actually of lower degree (6 versus 8), since they coincide with the ERF. This novel construction of rational rotation-minimizing motions may prove useful in applications such as computer animation, geometric sweep operations, and robot trajectory planning. © 2013 Elsevier B.V.

Introduction: The literature highlights the importance of the needs of family members of critical patients in emergency departments. Understanding these needs helps to alleviate psychological distress and contribute to the patients' recoveries. This study aimed to examine the psychological distress and needs of family members of critical patients in emergency departments., Methods: A cross-sectional design was used to collect data using the Depression, Anxiety, and Stress Scale-21, the Critical Care Family Needs Inventory for the Emergency Department, and the Needs Met Inventory questionnaire from a convenience sample of 170 family members of critical patients. Descriptive analysis and importance-performance analysis were applied to analyze the data., Results: The results showed that 52.4% of family members reported mild to extremely severe levels of depression, 60% reported mild to extremely severe levels of anxiety, and 53.5% had mild to extremely severe levels of stress. Anxiety showed a significant negative correlation with comfort needs (r = -0.17) and support needs being met (r = -0.16). The importance-performance analysis showed that the coordinates for support needs were in quadrant IV, signifying a higher level of importance perceived by family members but a lower level of the needs being met., Conclusion: Providing the assessment and necessary support to alleviate psychological distress will help enhance the ability of the emergency department to meet families' needs., (Copyright © 2024 Emergency Nurses Association. Published by Elsevier Inc. All rights reserved.)

Background: Immune cell populations in the intestinal muscularis propria during colitis are poorly resolved. Maintaining homeostasis in this niche is critical, highlighted by the poorer prognosis of inflammatory bowel disease associated with muscularis propria inflammation., Methods: This study utilizes single-cell RNA sequencing to survey the immune cell populations within the muscularis propria of normal colon and dextran sodium sulfate-induced colitis. Findings are validated by immunohistochemistry, flow cytometry and cell-lineage tracing in vivo, and in vitro assays with muscularis macrophages (MMφ)., Results: In naïve conditions, transcriptional duality is observed in MMφs with 2 major subpopulations: conventional resident Cx3cr1+ MMφs and Lyve1+ MMφs. The Lyve1+ population is phagocytic and expresses several known MMφ markers in mouse and human, confirming their identity as a bona fide MMφ subset. Single-cell transcriptomics indicate that resident MMφs are retained during colitis and exhibit plasticity toward an inflammatory profile. Lyve1+ MMφs, which express anti-inflammatory marker CD163, are absent during colitis, as confirmed by flow cytometry. In contrast, lineage tracing finds that resident Cx3cr1+ MMφs remain during colitis and are not completely replaced by the inflammatory infiltrating monocytes. In vitro studies provide biological evidence of the plasticity of resident Cx3cr1+ MMφs in response to lipopolysaccharide (LPS), mirroring transcriptional observations in vivo of their inflammatory plasticity. Potential markers for colitic MMφs, validated in animal models and in individuals with ulcerative colitis, are identified., Conclusions: Our findings contribute to the understanding of the immune system in the muscularis propria niche during colitis by resolving the heterogeneity and origins of colitic MMφs., (© The Author(s) 2024. Published by Oxford University Press on behalf of Crohn’s & Colitis Foundation. All rights reserved. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com.)

Background: This prospective study aimed to explore the effectiveness of an oral care intervention with Tegaderm on the oral mucosal health of intubated patients., Methods: A total of 70 intubated patients were included and randomly assigned to 1 of 3 groups, clean water brushing teeth (n = 23), brushing teeth combined with mouthwash (BTM) (n = 23), and brushing teeth combined with mouthwash and Tegaderm (BTMT) (n = 24). The Oral Mucositis Assessment Scale (OMAS) was applied to evaluate the patient's oral mucosal health before and after oral care intervention., Results: The BTMT group had lower OMAS scores in almost all regions of the oral cavity, compared to the brushing teeth and BTM groups. The general linear model for repeated measurement indicated the BTMT group had the lowest total OMAS scores from Day 2 to Day 4 after the initiation of baseline OMAS evaluation. Of the 3 intervention groups, the BTMT group had the shortest length of endotracheal intubation. The BTMT group had the lowest incidence rate of ventilator-associated pneumonia; however, no significant between-group differences were found., Conclusions: BTMT effectively reduced the decline in oral mucosal health that was caused by endotracheal intubation and shortened the length of endotracheal intubation., (Copyright © 2024 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.)

In the demanding realm of the Emergency Department, addressing every emergency incident efficiently becomes paramount, with time emerging as a critical factor. This paper is dedicated to investigating innovative approaches aimed at diminishing the preparation time required when a patient arrives at the hospital. Our methodology involves the integration of pre-hospital warning data, a valuable resource provided by the National Science and Technology Center for Disaster Reduction (NCDR), with an advanced flashing light alert system. This integration specifically targets a reduction in preparation time for major traumas, Cerebrovascular Accidents (CVAs), Out-Of-Hospital Cardiac Arrests (OHCAs), and Acute Myocardial Infarctions (AMIs) at the South Medical Center in Taiwan. By streamlining these critical processes, our research endeavors to enhance overall efficiency and responsiveness within emergency medical care, achieving an average preparation time of 6.61 minutes.

Taiwan has a well-structured healthcare insurance system that offers accessible medical resources to the public through nominal health insurance fees. Consequently, individuals in need of care willingly pay nominal charges for medical services, including rehabilitation treatment. This study delves into the rehabilitation department of a medical center in southern Taiwan. Despite offering comprehensive traditional rehabilitation services covering neurological, musculoskeletal, pediatric, cardiopulmonary, communication, and swallow disorders, the demand for appointments significantly surpasses the number of available therapists. Therefore, this paper proposes an efficiently method to optimize patient-therapist appointment. With a Complex Conditional Logic that we have designed in this paper, we aim to simplify the scheduling processing for patient seeking appointment either online or via phone calls. More than 50,000 cases have been treated since the system's launch within a year, facilitates hospital resource allocation and enhancing patient medical experiences.

Background: Prior studies have indicated team members' interaction behaviors may predict creativity among nursing students., Methods: This study investigated the correlation between interaction behaviors and creativity, both individual- and team-level, among nursing students. In this cross-sectional quantitative study, data were obtained from self-reported questionnaires. Individual creativity was assessed using the Torrance Tests of Creative Thinking scale; the perceived team interaction behavior and team creativity were assessed using validated instruments. Canonical correlation analysis was conducted to determine the overall correlation between interaction behaviors, and creativity, and the moderating effect of female proportion dominance was also examined., Results: A total of 164 nursing students (84.1% female) arranged into 14 teams were included in this study. Canonical correlation analysis showed a positive correlation between interaction behaviors and creativity (correlation = 0.88). All dimensions of interactive behaviors were positively related to creativity dimensions. A stronger correlation to team creativity (correlation = 1) was found compared to individual creativity (correlation = 0.07). This study demonstrated that individual interactive behaviors including spontaneous communication and helping behavior predicted high team creativity., Conclusions: This insight may be valuable for nursing education programs seeking to foster creativity and effective teamwork. The potential moderating effect of female proportions on team interaction behaviors and creativity should be investigated further., (© 2024. The Author(s).)

Here, we establish that plasticity exists within the postnatal enteric nervous system by demonstrating the reinnervation potential of post-mitotic enteric neurons (ENs). Employing BAF53b-Cre mice for selective neuronal tracing, the reinnervation capabilities of mature postnatal ENs are shown across multiple model systems. Isolated ENs regenerate neurites in vitro, with neurite complexity and direction influenced by contact with enteric glial cells (EGCs). Nerve fibers from transplanted ENs exclusively interface and travel along EGCs within the muscularis propria. Resident EGCs persist after Cre-dependent ablation of ENs and govern the architecture of the myenteric plexus for reinnervating ENs, as shown by nerve fiber projection tracing. Transplantation and optogenetic experiments in vivo highlight the rapid reinnervation potential of post-mitotic neurons, leading to restored gut muscle contractile activity within 2 weeks. These studies illustrate the structural and functional reinnervation capacity of post-mitotic ENs and the critical role of EGCs in guiding and patterning their trajectories., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Purpose: Service referrals are required for cancer survivors to access specialist dietary and exercise support. Many system-level factors influence referral practices within the healthcare system. Hence, the aim of this study was to identify system-level factors and their interconnectedness, as well as strategies for optimising dietary and exercise referral practices in Australia., Methods: A full-day workshop involving national multidisciplinary key stakeholders explored system-level factors impacting dietary and exercise referral practices. Facilitated group discussions using the nominal group technique identified barriers and facilitators to referral practices based on the six World Health Organisation (WHO) building blocks. The systems-thinking approach generated six cognitive maps, each representing a building block. A causal loop diagram was developed to visualise factors that influence referral practices. Additionally, each group identified their top five strategies by leveraging facilitators and addressing barriers relevant to their WHO building block., Results: Twenty-seven stakeholders participated in the workshop, including consumers (n = 2), cancer specialists (n = 4), nursing (n = 6) and allied health professionals (n = 10), and researchers, representatives of peak bodies, not-for-profit organisations, and government agencies (n = 5). Common system-level factors impacting on referral practices included funding, accessibility, knowledge and education, workforce capacity, and infrastructure. Fifteen system-level strategies were identified to improve referral practices., Conclusion: This study identified system-level factors and strategies that can be applied to policy planning and practice in Australia., (© 2024. Crown.)

A gate stack that facilitates a high-quality interface and tight electrostatic control is crucial for realizing high-performance and low-power field-effect transistors (FETs). However, when constructing conventional metal-oxide-semiconductor structures with two-dimensional (2D) transition metal dichalcogenide channels, achieving these requirements becomes challenging due to inherent difficulties in obtaining high-quality gate dielectrics through native oxidation or film deposition. Here, a gate-dielectric-less device architecture of van der Waals Schottky gated metal-semiconductor FETs (vdW-SG MESFETs) using a molybdenum disulfide (MoS 2 ) channel and surface-oxidized metal gates such as nickel and copper is reported. Benefiting from the strong SG coupling, these MESFETs operate at remarkably low gate voltages, <0.5 V. Notably, they also exhibit Boltzmann-limited switching behavior featured by a subthreshold swing of ≈60 mV dec -1 and negligible hysteresis. These ideal FET characteristics are attributed to the formation of a Fermi-level (E F ) pinning-free gate stack at the Schottky-Mott limit. Furthermore, authors experimentally and theoretically confirm that E F depinning can be achieved by suppressing both metal-induced and disorder-induced gap states at the interface between the monolithic-oxide-gapped metal gate and the MoS 2 channel. This work paves a new route for designing high-performance and energy-efficient 2D electronics., (© 2024 The Authors. Advanced Materials published by Wiley‐VCH GmbH.)

Human chorionic gonadotropin (HCG), a vital protein for pregnancy determination and a marker for trophoblastic diseases, finds application in monitoring early pregnancy and ectopic pregnancy. This study presents an innovative approach employing electrochemical immunosensors for enhanced HCG detection, utilizing Anti-HCG antibodies and gold nanoparticles (AuNPs) in the sensor platform. Two sensor configurations were optimized: BSA/Anti-HCG/c-AuNPs/MEL/e-AuNPs/SPCE with [Fe(CN) 6 ] 3-/4- as a redox probe (1) and BSA/Anti-HCG/PPy/e-AuNPs/SPCE using polypyrrole (PPy) as a redox probe (2). The first sensor offers linear correlation in the 0.10-500.00 pg∙mL -1 HCG range, with a limit of detection (LOD) of 0.06 pg∙mL -1 , sensitivity of 32.25 μA∙pg -1 ∙mL∙cm -2 , RSD <2.47 %, and a recovery rate of 101.03-104.81 %. The second sensor widens the HCG detection range (40.00 fg∙mL -1 -5.00 pg∙mL -1 ) with a LOD of 16.53 fg∙mL -1 , ensuring precision (RSD <1.04 %) and a recovery range of 94.61-106.07 % in serum samples. These electrochemical immunosensors have transformative potential in biomarker detection, offering enhanced sensitivity, selectivity, and stability for advanced healthcare diagnostics., Competing Interests: Declaration of competing interest The authors declare no competing interests., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Hepatocellular carcinoma (HCC) seriously threatens the human health. Previous investigations revealed that γ-glutamyltranspeptidase (GGT) was tightly associated with the chronic injury, hepatic fibrosis, and the development of HCC, therefore might act as a potential indicator for monitoring the HCC-related processes. Herein, with the contribution of a structurally optimized probe ETYZE-GGT, the bimodal imaging in both far red fluorescence (FL) and photoacoustic (PA) modes has been achieved in multiple HCC-related models. To our knowledge, this work covered the most comprehensive models including the fibrosis and developed HCC processes as well as the premonitory induction stages (autoimmune hepatitis, drug-induced liver injury, non-alcoholic fatty liver disease). ETYZE-GGT exhibited steady and practical monitoring performances on reporting the HCC stages via visualizing the GGT dynamics. The two modes exhibited working consistency and complementarity with high spatial resolution, precise apparatus and desirable biocompatibility. In cooperation with the existing techniques including testing serum indexes and conducting pathological staining, ETYZE-GGT basically realized the universal application for the accurate pre-clinical diagnosis of as many HCC stages as possible. By deeply exploring the mechanically correlation between GGT and the HCC process, especially during the premonitory induction stages, we may further raise the efficacy for the early diagnosis and treatment of HCC., Competing Interests: Declaration of competing interest The authors declare no competing interests., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

Emerging evidence underscores the importance of CD8 + T cells in the pathogenesis of multiple sclerosis (MS), but the precise mechanisms remain ambiguous. This study intends to elucidate the involvement of a novel subset of follicular CD8 + T cells (CD8 + CXCR5 + T) in MS and an experimental autoimmune encephalomyelitis (EAE) murine model. The expansion of CD8 + CXCR5 + T cells was observed in both MS patients and EAE mice during the acute phase. In relapsing MS patients, higher frequencies of circulating CD8 + CXCR5 + T cells were positively correlated with new gadolinium-enhancement lesions in the central nervous system (CNS). In EAE mice, frequencies of CD8 + CXCR5 + T cells were also positively correlated with clinical scores. These cells were found to infiltrate into ectopic lymphoid-like structures in the spinal cords during the peak of the disease. Furthermore, CD8 + CXCR5 + T cells, exhibiting high expression levels of ICOS, CD40L, IL-21, and IL-6, were shown to facilitate B cell activation and differentiation through a synergistic interaction between CD40L and IL-21. Transferring CD8 + CXCR5 + T cells into naïve mice confirmed their ability to enhance the production of anti-MOG 35-55 antibodies and contribute to the disease progression. Consequently, CD8 + CXCR5 + T cells may play a role in CNS demyelination through heightening humoral immune responses., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier B.V.)

A prospective observational study was conducted in a cohort of older adults ≥65 years ( n = 329), admitted to the acute medical unit (AMU) of a tertiary hospital, to describe and compare characteristics including frailty status and clinical outcomes. Multivariable models compared older adults with and without a history of cancer to determine characteristics associated with frailty and pre-frailty. An adjusted Poisson regression model was used to compare the length of hospital stay (LOS) between the two groups. About one-fifth (22%) of the cohort had a history of cancer. The most common cancer types were prostate ( n = 20), breast ( n = 13), lung ( n = 8) and gastrointestinal ( n = 8). There was no difference in the prevalence of pre-frailty/frailty among patients with or without a history of cancer (58% vs. 57%, p > 0.05). Pre-frailty/frailty was associated with polypharmacy (OR 8.26, 95% CI: 1.74 to 39.2) and malnutrition (OR 8.91, 95% CI: 2.15 to 36.9) in patients with a history of cancer. Adjusted analysis revealed that the risk of having a longer LOS was 24% higher in older adults with a history of cancer than those without (IRR 1.24, 95% CI 1.10 to 1.41, p < 0.001). Clinicians in the AMU should be aware that older adults with a history of cancer have a higher risk of a longer LOS compared to those without.

The prevalence of overweight and obesity has continued to increase globally, and one-size-fits-all dietary recommendations may not be suitable for different individual characteristics. A personalized nutrition intervention may be a potential solution. This review aims to evaluate the effects of the technology-delivered personalized nutrition intervention on energy, fat, vegetable, and fruit intakes among adults with overweight and obesity. A three-step comprehensive search strategy was performed from 10 databases and seven clinical registries in published and unpublished trials. A total of 46 randomized controlled trials (RCTs) involving 19,670 adults with overweight and obesity from 14 countries are included. Subgroup and meta-regression analyses were conducted. Meta-analyses showed a reduction of energy intake (-128.05, 95% CI: -197.08, -59.01) and fat intake (-1.81% energy/days, 95% CI: -3.38, -0.24, and -0.19 scores, 95% CI: -0.40, 0.02) in the intervention compared with the comparator. Significant improvements in vegetable and fruit intakes with 0.12-0.15 servings/day were observed in the intervention. Combined one- and two-way interactions had a greater effect on energy intake reduction compared with their counterparts. Meta-regression analyses revealed that no significant covariates were found. Given that the certainty of the evidence was rated as low or very low, further well-designed RCTs with long-term follow-up are warranted., (© 2024 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of World Obesity Federation.)

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin ( SPAST ) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain ( COL6A3 ) (NM&#95;004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM&#95;014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM&#95;004006; exon11):c.1150-17&#95;1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST : c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND., Competing Interests: The authors declare that they have no competing interests., (Copyright: © 2024 Chen et al.)

Emulsifiers, like egg yolk (EY), are necessary for the formation of mayonnaise, which is an oil-in-water type of colloid. This study aimed to assess the potential of defatted soybean powder treated with supercritical carbon dioxide (DSF) to enhance the quality of plant-based mayonnaise as plant-based alternatives gain popularity. This study involved the production of DSF and the comparison of its quality attributes to those of mayonnaise made with varying amounts of control soy flour (CSF), DSF, and EY. It was found that mayonnaise made with an increased quantity of DSF showed better emulsion stability, viscosity, and a smaller, more uniform particle size when compared with CSF mayonnaise. Additionally, DSF mayonnaise was generally rated higher in sensory evaluation. The addition of approximately 2% DSF positively influenced the emulsion and sensory properties of the vegan mayonnaise, indicating that DSF is a promising plant-based alternative emulsifier for the replacement of animal ingredients.

Purpose: The Normal Risk Ovarian Screening Study (NROSS) tested a two-stage screening strategy in postmenopausal women at conventional hereditary risk where significantly rising cancer antigen (CA)-125 prompted transvaginal sonography (TVS) and abnormal TVS prompted surgery to detect ovarian cancer., Methods: A total of 7,856 healthy postmenopausal women were screened annually for a total of 50,596 woman-years in a single-arm study (ClinicalTrials.gov identifier: NCT00539162). Serum CA125 was analyzed with the Risk of Ovarian Cancer Algorithm (ROCA) each year. If risk was unchanged and <1:2,000, women returned in a year. If risk increased above 1:500, TVS was undertaken immediately, and if risk was intermediate, CA125 was repeated in 3 months with a further increase in risk above 1:500 prompting referral for TVS. An average of 2% of participants were referred to TVS annually., Results: Thirty-four patients were referred for operations detecting 15 ovarian cancers and two borderline tumors with 12 in early stage (I-II). In addition, seven endometrial cancers were detected with six in stage I. As four ovarian cancers and two borderline tumors were diagnosed with a normal ROCA, the sensitivity for detecting ovarian and borderline cancer was 74% (17 of 23), and 70% of ROCA-detected cases (12 of 17) were in stage I-II. NROSS screening reduced late-stage (III-IV) disease by 34% compared with UKCTOCS controls and by 30% compared with US SEER values. The positive predictive value (PPV) was 50% (17 of 34) for detecting ovarian cancer and 74% (25 of 34) for any cancer, far exceeding the minimum acceptable study end point of 10% PPV., Conclusion: While the NROSS trial was not powered to detect reduced mortality, the high specificity, PPV, and marked stage shift support further development of this strategy.

Neurointestinal diseases cause significant morbidity and effective treatments are lacking. This study aimes to test the feasibility of transplanting autologous enteric neural stem cells (ENSCs) to rescue the enteric nervous system (ENS) in a model of colonic aganglionosis. ENSCs are isolated from a segment of small intestine from Wnt1::Cre;R26iDTR mice in which focal colonic aganglionosis is simultaneously created by diphtheria toxin injection. Autologous ENSCs are isolated, expanded, labeled with lentiviral-GFP, and transplanted into the aganglionic segment in vivo. ENSCs differentiate into neurons and glia, cluster to form neo-ganglia, and restore colonic contractile activity as shown by electrical field stimulation and optogenetics. Using a non-lethal model of colonic aganglionosis, our results demonstrate the potential of autologous ENSC therapy to improve functional outcomes in neurointestinal disease, laying the groundwork for clinical application of this regenerative cell-based approach., (© 2024. The Author(s).)

Introduction: Self-managed exercise and nutrition interventions can alleviate pre-frailty and frailty but understanding of adherence to them is lacking. This study aimed to explore the experiences of, and barriers and enablers to, a hospital-to-home self-managed combined exercise and nutrition program for hospitalised older adults living with pre-frailty and frailty., Methods: A hybrid approach to data- and theory-driven descriptive thematic analysis identified experiences, barriers, and enablers to participation in a 3-month, self-managed, exercise-nutrition, hospital-to-home frailty-support program. Pre-frail and frail older adult patients ≥ 65 years admitted to the acute medical unit at a South Australian tertiary hospital were recruited. Individual semi-structured interviews were audio-recorded, transcribed verbatim, and analysed descriptively, using the Theoretical Domains Framework., Results: The nutrition component of the program found 11 common barriers and 18 common enablers. The exercise component included 14 barriers and 24 enablers. Intentions, Social influences, Environmental context/resource and Emotions served as primary barriers towards adherence to both components. Common enablers for both components included Knowledge, Social identity, Environmental context/resource, Social influences, and Emotions., Conclusions: This research revealed important factors affecting adherence to a self-managed exercise-nutrition program in pre-frail and frail older adults within the environment, resources, and emotion domains that should be considered when designing other intervention programs in this population group.

Background: Mobile health applications (mHealth apps) are increasingly being used in weight loss interventions. However, evidence on the effects of such interventions on diet quality and their correlation with weight loss is lacking., Objective: The objective of this study was to examine whether changes in the diet quality of adults with prediabetes followed the use of an mHealth-enabled lifestyle intervention, compared with those who did not, and whether these changes correlated with weight loss., Design: A secondary analysis of a 6-month randomized controlled trial Diabetes Lifestyle Intervention using Technology Empowerment (D'LITE) was conducted, with participants recruited from October 2017 to September 2019., Participants/setting: Community-dwelling adults (n = 148) in Singapore diagnosed with prediabetes and body mass index (BMI) ≥23 were included in this study., Intervention: Participants were randomized to receive either a 6-month mHealth-enabled lifestyle intervention program (diet and physical activity) or standard care dietary advice., Main Outcome Measures: Dietary data were collected in the form of 2-day food records at baseline, 3, and 6 months. Changes in Alternate Healthy Eating Index-2010 (AHEI-2010) scores and food groups (servings/day), calculated from the dietary data, and correlation between changes in AHEI-2010 and weight loss at 3 and 6 months, were examined., Statistical Analyses: Between-group comparisons of continuous variables and within-participants variation were performed using longitudinal mixed-effect models, intention-to-treat principles. The models included treatment groups, time (baseline, 3 months, and 6 months), and covariates (age, sex, and BMI), as well as the group × time interactions, as fixed variables and within-participant variation in outcome values as random variable. The random intercept for participants accounted for the dependence of repeated measures. A likelihood ratio test was also conducted to test random effect variance. Spearman correlation test was used to examine correlation between changes in AHEI-2010 scores and weight loss., Results: There was a significant improvement in overall diet quality as ascertained by the AHEI-2010, by 6.2 points (95% confidence interval [CI], 3.8-8.7; P < 0.001) in the intervention group as compared with the control. The participants in the intervention group had a significantly greater reduction in intake of sugar-sweetened beverages (SSB) by 0.5 servings/day (95% CI, -0.8, -0.2; P < 0.001) and sodium by 726 mg/day (95% CI, -983, -468; P < .001), compared with those receiving standard care. At 3 and 6 months, a significant decrease in SSB (0.8 servings/day; 0.7 servings/day, respectively) and sodium (297 mg/day; 296 mg/day, respectively) intakes were reported compared with baseline intakes. Small positive correlations (r = 0.2; P < 0.05) were observed between changes in AHEI-2010 scores from baseline and percentage weight loss at 3 and 6 months., Conclusion: For adults with prediabetes in Singapore, diet quality can be improved with an mHealth-enabled lifestyle intervention program. A small positive correlation exists between AHEI-2010 scores and weight loss., (Copyright © 2024 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.)

Objectives: Registered nurse prescribing has been put forth, for decades, as an innovative approach to meet growing healthcare needs, particularly in areas of care where medications are essential and highly controlled such as for patients requiring cancer and palliative care. However, the adoption of innovative health delivery models requires acceptance by key stakeholders. This study explores cancer and palliative care nurses' attitudes toward nurse prescribing and their perceptions about educational requirements for a nurse prescriber., Data Sources: A cross-sectional survey was distributed to Australian nurses between March and July 2021. Data were collected using the Advancing Implementation of Nurse Prescribing in Australia online survey. Pearson χ 2 tests were used to examine associations between nurses in cancer care, palliative care, and all other specialties on demographics, attitudes to nurse prescribing, and educational perspectives to become prescribers. Of the 4,424 nurses who participated in the survey, 161 nurses identified they worked in cancer care and 109 in palliative care settings., Conclusion: Although nurses have a common set of core capabilities, their work contexts and their professional experiences shape their attitudes toward practice. Nurses in cancer care were significantly less certain than nurses in palliative care [χ 2 (2) = 6.68, P = .04], and nurses from all other specialties [χ 2 (2) =13.87, P = <.01] of the benefits of nurse prescribing (ie, nurse prescribing would decrease health care system costs, reduce patient risk). Nurses in cancer care were more certain that successfully implementing nurse prescribing requires strong support from their medical and pharmacy colleagues. In addition, nurses working in cancer and palliative care agreed that improving patient care was their primary motivator for becoming a prescriber., Implications for Nursing Practice: Open to expanding their role and responsibilities, nurses in cancer and palliative care settings reported that successfully adopting nurse prescribing must be supported by their other healthcare colleagues within the same environment, which demands strong interprofessional collaborative efforts., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this manuscript., (Copyright © 2024 The Author(s). Published by Elsevier Inc. All rights reserved.)

Adipose tissue lipolysis is mediated by cAMP-protein kinase A (PKA)-dependent intracellular signalling. Here, we show that PKA targets p21-activated kinase 4 (PAK4), leading to its protein degradation. Adipose tissue-specific overexpression of PAK4 in mice attenuates lipolysis and exacerbates diet-induced obesity. Conversely, adipose tissue-specific knockout of Pak4 or the administration of a PAK4 inhibitor in mice ameliorates diet-induced obesity and insulin resistance while enhancing lipolysis. Pak4 knockout also increases energy expenditure and adipose tissue browning activity. Mechanistically, PAK4 directly phosphorylates fatty acid-binding protein 4 (FABP4) at T126 and hormone-sensitive lipase (HSL) at S565, impairing their interaction and thereby inhibiting lipolysis. Levels of PAK4 and the phosphorylation of FABP4-T126 and HSL-S565 are enhanced in the visceral fat of individuals with obesity compared to their lean counterparts. In summary, we have uncovered an important role for FABP4 phosphorylation in regulating adipose tissue lipolysis, and PAK4 inhibition may offer a therapeutic strategy for the treatment of obesity., (© 2024. The Author(s), under exclusive licence to Springer Nature Limited.)

Objective: This prospective study aimed to evaluate the effect of beinaglutide combined with metformin versus aspart 30 with metformin on metabolic profiles and antidrug antibodies (ADAs) in patients with type 2 diabetes (T2D)., Methods: A total of 134 eligible participants were randomly assigned to the test group and the control group. Patients in the test group were treated with beinaglutide and metformin, whereas patients in the control group were randomly treated with aspart 30 and metformin, with a follow-up period of 6 months. The metabolic profiles and ADAs over 6 months were evaluated., Results: After 6 months, 101 (75.37%) patients completed the study. Compared with the control group, the beinaglutide group had significant reductions in 2-h postprandial blood glucose (2hBG) and low blood glucose index (LBGI). Glycated hemoglobin (HbA1c) decreased in both groups relative to baseline. In the test group, one had treatment-emergent beinaglutide ADAs. Significant reductions in triglycerides (TG), non-fasting TG, weight, waist circumference (WC), and body mass index (BMI) were observed. The values of insulin sensitivity index (HOMA-IR) were decreased to a statistically higher degree with beinaglutide treatment., Conclusion: Beinaglutide reduces metabolic dysfunction, LBGI, and weight in patients of T2D with a low risk of ADAs. Beinaglutide may offer the potential for a disease-modifying intervention in cardiovascular disease (CVD)., Clinical Trial Registration: www.chictr.org.cn, identifier ChiCTR2200061003., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer PY declared a shared affiliation with the authors to the handling editor at the time of review., (Copyright © 2023 Han, Lu, Ye, Jin, Xu, Wang and Zhang.)

Salivary gland cancers (SGCs) are rare, aggressive cancers without effective treatments when metastasized. We conducted a phase 2 trial evaluating nivolumab (nivo, anti-PD-1) and ipilimumab (ipi, anti-CTLA-4) in 64 patients with metastatic SGC enrolled in two histology-based cohorts (32 patients each): adenoid cystic carcinoma (ACC; cohort 1) and other SGCs (cohort 2). The primary efficacy endpoint (≥4 objective responses) was met in cohort 2 (5/32, 16%) but not in cohort 1 (2/32, 6%). Treatment safety/tolerability and progression-free survival (PFS) were secondary endpoints. Treatment-related adverse events grade ≥3 occurred in 24 of 64 (38%) patients across both cohorts, and median PFS was 4.4 months (95% confidence interval (CI): 2.4, 8.3) and 2.2 months (95% CI: 1.8, 5.3) for cohorts 1 and 2, respectively. We present whole-exome, RNA and T cell receptor (TCR) sequencing data from pre-treatment and on-treatment tumors and immune cell flow cytometry and TCR sequencing from peripheral blood at serial timepoints. Responding tumors universally demonstrated clonal expansion of pre-existing T cells and mutational contraction. Responding ACCs harbored neoantigens, including fusion-derived neoepitopes, that induced T cell responses ex vivo. This study shows that nivo+ipi has limited efficacy in ACC, albeit with infrequent, exceptional responses, and that it could be promising for non-ACC SGCs, particularly salivary duct carcinomas. ClinicalTrials.gov identifier: NCT03172624 ., (© 2023. The Author(s), under exclusive licence to Springer Nature America, Inc.)

Background/objective: Deductive logic has often been used to develop critical thinking. However, inductive logical thinking, essential to care decision-making, has yet to be emphasized. This study aimed to explore visual thinking learning among undergraduate nursing students by asking them to draw situated patient pictures in order to integrate theoretical knowledge and promote inductive logical thinking., Methods: A mixed-methods research design was used to obtain quantitative and qualitative data from a convenience sample of 100 students. The study was conducted in a Taiwanese university from September 2022 to January 2023. In the quantitative component, learners' views of situated patient pictures were captured based on 15 paired identifiers and two questions: (a) What word should be used in describing the situated patient's picture? (b) How strongly do you feel about the selection? Written feedback was analyzed using qualitative content analysis., Results: Quantitative analysis identified specific, unpretentious, humorous, harmonious, conservative, realistic, rational, entire, image performance, professional performance, understandable, expressive, static performance, rigorous, and profuse with a reasonable degree of choice. Qualitative analysis identified four stages in participants' development of inductive reasoning through situated patient pictures and visual thinking learning. These were: exploration, intuition, theme, and logic and creation., Conclusions: The results suggest that visual thinking learning is a practical pedagogical approach to increasing learners' communication abilities, group cooperation, theoretical knowledge integration, and logical thinking. Neither educators nor learners required any artistic skills. Nonetheless, participants demonstrated creativity and innovation through continuous visual thinking learning., Competing Interests: Declaration of competing interest None., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Background: Dental caries is a chronic oral disease caused by microbial infections, which result in erosion of the dental enamel and cause irreversible damage. Therefore, proper disease management techniques and the creation of an environment that prevents intraoral growth and biofilm formation of Streptococcus mutans in the early stages, are crucial to prevent the potential progression of dental plaque to disease. Here, we aimed to investigate antimicrobial and antibiofilm effects of the Bacillus velezensis ID-A01 supernatant (ID23029) against S. mutans, and its inhibitory effects on acidogenesis., Results: A killing kinetics assay showed a peak lethality percentage of 94.5% after 6 h of exposure to ID23029. In sucrose-exposed conditions, ID23029 inhibited lactic acid formation, preventing the pH from falling below the threshold for enamel demineralization, and inhibited up to 96.6% of biofilm formation. This effect was maintained in the presence of lysozyme. Furthermore, ID23029 retained up to 92% lethality, even at an intraoral concentration at which lysozyme is ineffective against S. mutans., Conclusions: This study demonstrates the potential of the B. velezensis ID-A01 supernatant for the prevention and treatment of dental caries. Its eventual use in dental practice is encouraged, although further studies are required to confirm its beneficial effects., (© 2023. The Author(s).)

Background: Our objective was to optimize a novel damage control resuscitation (DCR) cocktail composed of hydroxyethyl starch, vasopressin, and fibrinogen concentrate for the polytraumatized casualty. We hypothesized that slow intravenous infusion of the DCR cocktail in a pig polytrauma model would decrease internal hemorrhage and improve survival compared with bolus administration., Methods: We induced polytrauma, including traumatic brain injury (TBI), femoral fracture, hemorrhagic shock, and free bleeding from aortic tear injury, in 18 farm pigs. The DCR cocktail consisted of 6% hydroxyethyl starch in Ringer's lactate solution (14mL/kg), vasopressin (0.8U/kg), and fibrinogen concentrate (100mg/kg) in a total fluid volume of 20mL/kg that was either divided in half and given as two boluses separated by 30 minutes as control or given as a continuous slow infusion over 60 minutes. Nine animals were studied per group and monitored for up to 3 hours. Outcomes included internal blood loss, survival, hemodynamics, lactate concentration, and organ blood flow obtained by colored microsphere injection., Results: Mean internal blood loss was significantly decreased by 11.1mL/kg with infusion compared with the bolus group (p = .038). Survival to 3 hours was 80% with infusion and 40% with bolus, which was not statistically different (Kaplan Meier log-rank test, p = .17). Overall blood pressure was increased (p < .001), and blood lactate concentration was decreased (p < .001) with infusion compared with bolus. There were no differences in organ blood flow (p > .09)., Conclusion: Controlled infusion of a novel DCR cocktail decreased hemorrhage and improved resuscitation in this polytrauma model compared with bolus. The rate of infusion of intravenous fluids should be considered as an important aspect of DCR., (2023.)

BACKGROUNDRecurrent and/or metastatic (R/M) head and neck squamous cell carcinoma (HNSCC) is generally an incurable disease, with patients experiencing median survival of under 10 months and significant morbidity. While immune checkpoint blockade (ICB) drugs are effective in approximately 20% of patients, the remaining experience limited clinical benefit and are exposed to potential adverse effects and financial costs. Clinically approved biomarkers, such as tumor mutational burden (TMB), have a modest predictive value in HNSCC.METHODSWe analyzed clinical and genomic features, generated using whole-exome sequencing, in 133 ICB-treated patients with R/M HNSCC, of whom 69 had virus-associated and 64 had non-virus-associated tumors.RESULTSHierarchical clustering of genomic data revealed 6 molecular subtypes characterized by a wide range of objective response rates and survival after ICB therapy. The prognostic importance of these 6 subtypes was validated in an external cohort. A random forest-based predictive model, using several clinical and genomic features, predicted progression-free survival (PFS), overall survival (OS), and response with greater accuracy than did a model based on TMB alone. Recursive partitioning analysis identified 3 features (systemic inflammatory response index, TMB, and smoking signature) that classified patients into risk groups with accurate discrimination of PFS and OS.CONCLUSIONThese findings shed light on the immunogenomic characteristics of HNSCC tumors that drive differential responses to ICB and identify a clinical-genomic classifier that outperformed the current clinically approved biomarker of TMB. This validated predictive tool may help with clinical risk stratification in patients with R/M HNSCC for whom ICB is being considered.FUNDINGFundación Alfonso Martín Escudero, NIH R01 DE027738, US Department of Defense CA210784, The Geoffrey Beene Cancer Research Center, The MSKCC Population Science Research Program, the Jayme Flowers Fund, the Sebastian Nativo Fund, and the NIH/NCI Cancer Center Support Grant P30 CA008748.

Objective: To analyze the prevalence and risk factors of musculoskeletal diseases among interventional surgeons in top three hospitals, and to provide suggestions for prevention of musculoskeletal diseases. Methods: In June 2022, a self-designed questionnaire was used to collect general information of doctors engaged in interventional surgery (121) and non-interventional surgery (124) in some top three hospitals in Tianjin. The standard version of the Nordic Musculoskeletal Questionnaire was used to investigate information related to musculoskeletal diseases. The prevalence and risk factors of musculoskeletal diseases among interventional and non-interventional surgeons were analyzed. Results: The prevalence of musculoskeletal diseases among interventional surgeons and non-interventional surgeons was 59.50% (72/121) and 62.90% (78/124) . Compared with non-interventional surgeons, interventional surgeons had a higher prevalence of musculoskeletal diseases in the shoulders and upper back, and a lower prevalence of musculoskeletal diseases in the waist. The differences were statistically significant ( P <0.05) . Multivariate logistic regression analysis showed that age, weekly time of physical exercise, time of intervention operation, and wearing protective clothing were independent risk factors for musculoskeletal diseases ( P <0.05) . Conclusion: The prevalence rate of musculoskeletal diseases among doctors engaged in interventional surgery is relatively high in some top three hospitals in Tianjin, and proper enhancement of physical exercise and shortening of interventional time are conducive to reducing musculoskeletal diseases.

Background: This prospective study aimed to compare telemedicine-assisted structured self-monitoring of blood glucose(SMBG) with a traditional blood glucose meter (BGM) in adults of type 2 diabetes mellitus (T2DM)., Methods: Adult participants with T2DM were assigned to an intervention group or a control group. The patients in the intervention group received a connected BGM with real-time data submission as well as individual needs-based tele-coaching to address and improve motivation and daily diabetes self-management. The patients in the control group received a traditional BGM. Changes in glycated hemoglobin(HbA1c), low blood glucose index(LBGI), and diabetes self-management behaviors were analyzed., Results: The study demonstrated the superiority of the telemedicine-assisted structured SMBG versus the traditional BGM for improving HbA1c. Additionally, the telemedicine-assisted SMBG reduced the risk of hypoglycemia and enhanced diabetes self-management behaviors, as differences in the LBGI and the Diabetes Self-Management Questionnaire(DSMQ) results between the groups after 6 months were found to be significant., Conclusions: Telemedicine-assisted structured SMBG helps physicians and patients to achieve a specific level of glycemic control and reduce hypoglycemia. The use of coaching applications and telemedicine-assisted SMBG indicated beneficial effects for T2DM self-management, which may help limit disease progression., Trial Registration: Chinese Clinical Trail Registry No: ChiCTR2300072356 on 12/06/2023. Retrospectively registered., (© 2023. BioMed Central Ltd., part of Springer Nature.)

Effect of packaging at different vacuum levels such as 7.2 Pa (99.99% vacuum), 30 kPa (70.39%), 70 kPa (30.91%), and 101.33 kPa (0%, atmospheric condition) using a specially designed airtight container on physicochemical and microbial properties of beef brisket cuts during cold storage was investigated. Dramatic pH increase was found only in air atmospheric packaging. Higher vacuum level yielded higher water holding capacity and lower volatile basic nitrogen (VBN), 2-thiobarbituric acid (TBA), and growth rate of aerobic bacteria and coliforms, whereas the fatty acid composition showed no difference among various vacuum levels. The highest vacuum level (7.2 Pa) yielded no increases in VBN, TBA, and coliform and the least increase in aerobe counts. For bacterial communities, higher vacuum levels yielded higher proportions of Leuconostoc, Carnobacterium, and lactobacilli belonging to the phylum Firmicutes and lower proportions of Pseudomonas belonging to the phylum Proteobacteria. Predictive curves for bacterial communities showed that just a little oxygen significantly affects the bacterial dominance based on different oxygen dependence of individual bacteria and their logarithmic changes by vacuum level., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Ltd. All rights reserved.)