Search

Recently, attentions have come to the alleviatory effect of protein inhibitor of activated STAT1 (PIAS1) in hepatic ischemia-reperfusion injury (HIRI), but the underlying molecular mechanistic actions remain largely unknown, which were illustrated in the present study. Microarray-based analysis predicted a possible regulatory mechanism involving the PIAS1/NFATc1/HDAC1/IRF-1/p38 MAPK signaling axis in HIRI. Then, growth dynamics of hypoxia/reoxygenation- (H/R-) exposed hepatocytes and liver injury of HIRI-like mice were delineated after the alteration of the PIAS1 expression. We validated that PIAS1 downregulation occurred in H/R-exposed hepatocytes and HIRI-like mice, while the expression of NFATc1, HDAC1, and IRF-1 and phosphorylation levels of p38 were increased. PIAS1 inactivated p38 MAPK signaling by inhibiting HDAC1-mediated IRF-1 through NFATc1 SUMOylation, thereby repressing the inflammatory response and apoptosis of hepatocytes in vitro, and alleviated liver injury in vivo. Collectively, the NFATc1/HDAC1/IRF-1/p38 MAPK signaling axis is highlighted as a promising therapeutic target for potentiating hepatoprotective effects of PIAS1 against HIRI.

Objectives In the present study, we investigated donor-derived cell-free DNA dynamics and assessed the diagnostic efficacy of 2 tests: the sequencing of cytomegalovirus-derived cell-free DNA and the quantitative nucleic acid amplification test in cytomegalovirus infection following liver transplant. Materials and methods We first examined 6 patients who were identified with active cytomegalovirus DNAemia by both quantitative nucleic acid amp-lification test and next-generation sequencing of cytomegalovirus-derived cell-free DNA and then performed a receiver operating characteristic analysis to evaluate the efficacy of cell-free DNA sequencing and establish a cutoff for this assay. Further validation of the next-generation sequencing method was also performed in 84 liver transplant recipients. The study protocol conformed to the ethical guidelines of the Declaration of Helsinki and the Declaration of Istanbul. Results In the first 6 patients, there was no significant correlation between the cytomegalovirus infection and donor-derived cell-free DNA. We determined that the levels of cytomegalovirus-derived cell-free DNA sequencing directly correlate with the results of the quantitative nucleic acid amplification test (area under the curve 0.982) and obtained a value of 0.015% as a cutoff for the cell-free DNA sequencing assay. In the validation cohort composed of 84 liver transplant recipients, next-generation sequencing of cell-free DNA revealed the occurrence of cytomegalovirus infection that remains otherwise undetected by the quantitative nucleic acid amplification test. Conclusions Cytomegalovirus infections that do not cause direct graft injury (cytomegalovirus-related hepatitis) did not result in elevations of donor-derived cell-free DNA. Next-generation sequencing of cytomegalovirus-derived cell-free DNA provides a potential tool for detection of cytomegalovirus infection that remains undetected by the quantitative nucleic acid amplification test.

Wernicke encephalopathy (WE) is an acute neurological disorder resulting from vitamin B1 deficiency, which is common in chronic alcoholism and is rare in acute liver failure. So far, there are 2 cases of WE reported after liver transplantation. Here, we report a case of a 45-year-old nonalcoholic male patient who developed psychiatric and neurological disturbance 15 d after receiving orthotopic liver transplantation because of hepatitis B-related cirrhosis and portal hypertension. Brain magnetic resonance imaging (MRI) showed symmetric high-signal intensities in the periaqueductal area. The patient was diagnosed with WE and given intravenous high-dose vitamin B1 immediately. His neurological disturbance resolved in 7 d after receiving the vitamin B1. Brain MRI after 5 mo showed nearly complete recovery. Most WE cases may be misdiagnosed in patients after liver transplantation, and we should pay more attention to its onset.

// Kuijie Liu 1 , Hongliang Yao 1 , Sanlin Lei 1 , Li Xiong 1 , Haizhi Qi 1 , Ke Qian 1 , Jiqiang Liu 1 , Peng Wang 1 , Hua Zhao 1 1 Department of General Surgery, The Second Xiangya Hospital, Central South University, Changsha 410011, China Correspondence to: Hua Zhao, email: drzhaohua2012@163.com Keywords: miR-124, p63, feedback loop, cell growth, colorectal cancer Received: May 26, 2016 Accepted: February 20, 2017 Published: March 16, 2017 ABSTRACT Among the diverse co-regulatory relationships between transcription factors (TFs) and microRNAs (miRNAs), feedback loops have received the most extensive research attention. The co-regulation of TFs and miRNAs plays an important role in colorectal cancer (CRC) growth. Here, we show that miR-124 can regulate two isoforms of p63, TAp63 and ΔNp63, via iASPP, while p63 modulates signal transducers and activators of transcription 1 (STAT1) expression by targeting miR-155. Moreover, STAT1 acts as a regulator of CRC growth by targeting miR-124. Taken together, these results reveal a feedback loop between miRNAs and TFs. This feedback loop comprises miR-124, iASPP, STAT1, miR-155, TAp63 and ΔNp63, which are essential for CRC growth. Moreover, this feedback loop is perturbed in human colon carcinomas, which suggests that the manipulation of this microRNA-TF feedback loop has therapeutic potential for CRC.

Hypernatremic donors was regarded as the expanded criteria donors in liver transplantation. The study was to investigate the effects of donor hypernatremia on the outcomes of liver transplantation and identify the prognostic factors possibly contributing to the poor outcomes.Donor serum sodium levels before procurement were categorized as normal sodium (155 mmol/L), moderate high sodium (155-170 mmol/L), and severe high sodium (≥ 170 mmol/L). Furthermore, we subdivided the 142 hypernatremic donors (≥ 155 mmol/L) into two subgroups: subgroup A, the exposure time of liver grafts from hypernatremia to reperfusion was36 h; and subgroup B, the exposure time was ≥ 36 h. The outcomes included initial graft function, survival rates of grafts and recipients, graft loss and early events within the first year following liver transplantation.There were no significant differences in the 1-year survival rates of grafts and recipients, 1-year graft loss rates and early events among the normal, moderate high and severe high sodium groups. However, the overall survival rates of grafts and recipients in subgroup A were significantly higher than those in subgroup B. Cox model showed that the exposure time (HR = 1.117; 95% CI: 1.053-1.186; P 0.001), cold ischemia time (HR = 1.015; 95% CI: 1.006-1.024; P = 0.001) and MELD (HR = 1.061; 95% CI: 1.003-1.121; P = 0.037) were the important prognostic factors contributing to the poor outcomes of recipients with hypernatremic donors.The level of donor sodium immediately before organ procurement does not have negative effects on the early outcomes following adult liver transplantation. For hypernatremia liver donors, minimization of the exposure time from hypernatremia to reperfusion is critical to prevent graft loss.

An increasing number of studies have demonstrated that the dysregulation of long non-coding RNAs (lncRNAs) may serve an important role in tumor progression. Previous studies have reported that the lncRNA, colon cancer associated transcript 2 (CCAT2), was highly expressed in various tumors. However, the function of CCAT2 in hepatocellular carcinoma (HCC) has not yet been elucidated. The aim of the present study was to identify novel oncogene lncRNAs and investigate their physiological function and mechanism in HCC. Using reverse transcription-quantitative polymerase chain reaction, it was observed that CCAT2 was upregulated in HCC tissues and human HCC cell lines. Furthermore, the impacts of CCAT2 on cell proliferation, migration and apoptosis were analyzed using cell migration, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and enzyme-linked immunosorbent assay analysis respectively. The overexpression of CCAT2 using a synthesized vector significantly promoted cell migration and proliferation, and inhibited apoptosis of HCC cells in vitro. The suppression of CCAT2 expression resulted in opposing effects. To the best of our knowledge, the present study is the first to demonstrate that CCAT2 functions as a oncogene in HCC. Further investigation is required to clarify the molecular mechanisms of this lncRNA in HCC development.

Hepatocellular carcinoma (HCC) is known for its high mortality rate worldwide. Based on intensive studies, microRNA (miRNA) expression functions in tumor suppression. Therefore, we aimed to evaluate the contribution of miR-146a-5p to radiosensitivity in HCC through the activation of the DNA damage repair pathway by binding to replication protein A3 (RPA3). First, the limma package of R was performed to differentially analyze HCC expression chip, and regulative miRNA of RPA3 was predicted. Expression of miR-146a-5p, RPA3, and DNA damage repair pathway-related factors in tissues and cells was determined. The effects of radiotherapy on the expression of miR-146a-5p and RPA3 as well as on cell radiosensitivity, proliferation, cell cycle, and apoptosis were also assessed. The results showed that there exists a close correlation between miR-146a and the radiotherapy effect on HCC progression through regulation of RPA3 and the DNA repair pathway. The positive rate of ATM, pCHK2, and Rad51 in HCC tissues was higher when compared with that of the paracancerous tissues. SMMC-7721 and HepG2 cell proliferation were significantly inhibited following 8 Gy 6Mv dose. MiR-146a-5p restrained the expression of RPA3 and promoted the expression of relative genes associated with the DNA repair pathway. In addition, miR-146a-5p overexpression suppresses cell proliferation and enhances radiosensitivity and cell apoptosis in HCC cells. In conclusion, the present study revealed that miR-146a-5p could lead to the restriction of proliferation and the promotion of radiosensitivity and apoptosis in HCC cells through activation of DNA repair pathway and inhibition of RPA3.

A new and novel signal probe based on silver nanoclusters (Ag NCs)/horseradish peroxidase (HRP) nanocomposite (Ag NCs-HRP) was developed. The probe was utilized for electrochemical immunoassay for the detection of carcinoembryonic antigen (CEA). The Ag NCs was synthesized via chemical reduction in the presence of DNA strand containing CEA aptamer (ATACCAGCTTATTCAATT) and the Ag NCs synthesis template (C 12 ). After the adsorption of HRP onto Ag NCs surface, the resulted Ag NCs-HRP could bind with CEA and acted as signaling probe. The assay involves the following steps: (1) construction of an immunosensor by immobilizing the antibody against CEA on a glassy carbon electrode; (2) incubate the immunosensor with sample containing CEA; (3) incubate the immunosensor with Ag NCs-HRP; (4) signal amplification via HRP catalyzed deposition of an insulating polymer film, poly(3,3′-dimethoxybenzidine) (PDB) onto electrode surface; (5) measurement via square wave voltammetry in Fe(CN) 6 3−/4− solution. The current decreased due to the formation of insulating PDB film is logarithmically related to the concentration of CEA in the 1 pg to 10 ng mL −1 range, with a detection limit of 0.5 pg mL −1 . The developed nanocluster/enzyme signal probe can certainly be modified for the detection of different other trace targets in bioanalytical fields.

Background Portal hypertension is one of the most important clinical conditions that cause intraoperative intensive hemorrhage in cirrhotic patients undergoing liver transplantation. Pre-transplant portal decompression may reduce the intraoperative bleeding during liver transplantation. Methods Splenic artery trunk embolization (SATE) was performed one month prior to liver transplantation. Platelet count, prealbumin, international normalized ratio, and blood flow in the portal vein and hepatic artery were monitored before and one month after SATE. The measurements above were collected on admission and before surgery in the non-SATE patients, who served as controls. We also recorded the intraoperative blood loss, operating time, required transfusion, post-transplant ascites, and complications within three months after operation in all patients. Results SATE significantly reduced portal venous blood flow, increased hepatic arterial blood flow, normalized platelet count, and improved prealbumin and international normalized ratio in the patients before liver transplantation. Compared to the non-SATE patients, the pre-transplant SATE significantly decreased the operating time, intraoperative bleeding, post-transplant ascites and severe surgical complications. Conclusion Pre-transplant SATE decreases portal pressure, improves liver function reserve, and reduces the surgical risk of liver transplantation effectively in patients with severe portal hypertension.

An electrochemical immunoassay is described for the detection of the protein biomarker mucin 1 (MUC-1) and of breast cancer cells of type MCF-7 where MUC-1 is overexpressed. The method is based on the use of silver nanoclusters (Ag-NCs) acting as a signalling probe. The Ag-NCs were synthesized via chemical reduction in the presence of a DNA strand with the sequence of 5′-GCAGTTGATCCTTTGGATACCCTGG-C12-3′. The strand contains mucin 1 aptamer (GCAGTTGATCCTTTGGATACCCTGG) that can specifically bind to MUC1 and the template (C12) for synthesis of Ag-NCs. The assay involves the following steps: (1) Construction of an immunosensor by immobilizing the antibody against MUC-1 on a glassy carbon electrode; (2) addition of sample containing MUC-1; (3) addition of Ag-NCs; (4) signal amplification via silver enhancement process (deposition of metal silver on Ag-NCs); (5) measurement via square wave voltammetry. The current measured at a potential of 0.11 V (vs. SCE) is logarithmically related to the concentration of MUC-1 in the 1 to 500 nM range, with a detection limit of 0.5 nM. We also demonstrate that MCF-7 cancer cells can be detected by this method with high sensitivity (50 cells per mL) due to the presence of MUC-1 proteins on the cell surface.

We investigated in vitro whether HLA highly sensitized patients with end-stage renal disease will be disadvantaged immunologically after a genetically engineered pig kidney transplant.Blood was drawn from patients with a calculated panel-reactive antibody (cPRA) 99% to 100% (Gp1, n = 10) or cPRA 0% (Gp2, n = 12), and from healthy volunteers (Gp3, n = 10). Serum IgM and IgG binding was measured (i) to galactose-α1-3 galactose and N-glycolylneuraminic acid glycans by enzyme-linked immunosorbent assay, and (ii) to pig red blood cell, pig aortic endothelial cells, and pig peripheral blood mononuclear cell from α1,3-galactosyltransferase gene-knockout (GTKO)/CD46 and GTKO/CD46/cytidine monophosphate-N-acetylneuraminic acid hydroxylase-knockout (CMAHKO) pigs by flow cytometry. (iii) T-cell and B-cell phenotypes were determined by flow cytometry, and (iv) proliferation of T-cell and B-cell carboxyfluorescein diacetate succinimidyl ester-mixed lymphocyte reaction.(i) By enzyme-linked immunosorbent assay, there was no difference in IgM or IgG binding to galactose-α1-3 galactose or N-glycolylneuraminic acid between Gps1 and 2, but binding was significantly reduced in both groups compared to Gp3. (ii) IgM and IgG binding in Gps1 and 2 was also significantly lower to GTKO/CD46 pig cells than in healthy controls, but there were no differences between the 3 groups in binding to GTKO/CD46/CMAHKO cells. (iii and iv) Gp1 patients had more memory T cells than Gp2, but there was no difference in T or B cell proliferation when stimulated by any pig cells. The proliferative responses in all 3 groups were weakest when stimulated by GTKO/CD46/CMAHKO pig peripheral blood mononuclear cell.(i) End-stage renal disease was associated with low antipig antibody levels. (ii) Xenoreactivity decreased with increased genetic engineering of pig cells. (iii) High cPRA status had no significant effect on antibody binding or T-cell and B-cell response.

Hepatic ischemia/reperfusion (I/R) injury is a common clinical problem. The present study was conducted to investigate the protective effect and mechanism of minocycline (Mino), a tetracycline with anti-inflammatory and antioxidant properties, on I/R injury of liver in rats. In total, 54 male Sprague-Dawley rats were randomly divided into 3 groups with 18 rats in each: Sham-operated (control group), I/R model (I/R group) and Mino preconditioning groups (Mino group). The rats of the Mino group were administered Mino (45 mg/kg) by gastric irrigation at 36 h before surgery and were subsequently administered with 22.5 mg/kg every 12 h for the 36 h before surgery. The rats were sacrificed at 2, 6 and 24 h after reperfusion, and the serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST) and lactate dehydrogenase (LDH) were measured. Hematoxylin/eosin staining of liver tissues was performed to detect the rat liver histological changes and the grade of liver I/R injury (Suzuki's criteria); the levels of malondialdehyde (MDA) and myeloperoxidase (MPO) were determined by spectrophotometry; hepatic tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) mRNA were measured by quantitative polymerase chain reaction; the Dickkopf-1 (DKK-1) and β-catenin gene products of the liver were detected by western blot analysis. Mino treatment significantly ameliorated the I/R injury of the liver, as shown by decreased Suzuki scores and liver function (ALT, AST and LDH). After 2, 6 and 24 h reperfusion, compared to the I/R group the MDA and MPO levels of the Mino group decreased in the liver tissues and the levels of hepatic TNF-α and IL-1β mRNA were decreased too. The protein expression of hepatic DKK-1 decreased, whereas β-catenin increased, which indicates that the Wnt/β-catenin pathway has been activated. In conclusion, Mino protects the liver from I/R injury mainly through reducing oxidative stress and inhibiting the release of pro-inflammatory cytokines by activating the Wnt/β-catenin signaling pathway in the liver.

We have developed a sensitive fluorescence assay for the protein biomarker mucin 1 (MUC1). It is based on the aggregation of functionalized carbon dots (CDs) in the presence of MUC1. The CDs with a size of ~2 nm display strong blue-green intrinsic fluorescence. Antibodies against MUC1 and the MUC1 aptamer were covalently conjugated to the CDs, and the immunoreaction between CD-labeled antibody to MUC1, and of the CD-labeled aptamer to MUC1 resulted in the formation of a sandwich structure that is accompanied by aggregation of CDs and quenching of fluorescence. The change in fluorescence is linearly related to the MUC1 concentration in the 5 to 100 nM range, with a detection limit at 2 nM. The assay was applied to the determination of MUC1 in (spiked) real serum samples, and good recoveries (ranging from 94.2 to 98.1 %) were obtained. This assay is cost-effective and convenient. It has a wide scope in that it, conceivably, can be extended to assays for other proteins and biomarkers of clinical interest.

ELISA type fluorescence immunoassay for the sensitive detection of protein biomarker tumor necrosis factor α (TNF-α) was proposed. The immuno-reaction was taken place in the wells of the 96 well plate using Fe3O4 nanoparticles as label. The signal amplification strategy was based on the released Fe3+ from Fe3O4 nanoparticles after acid treatment to trigger the fluorescence from nonfluorescent fluorophore. The fluorophore selected was rhodamine 6G derivative N-(rhodamine-6G)lactam-ethylenediamine (Rh6G-LEDA). Such signal turn-on strategy has advantages of low background current and less susceptibility to fluorescence quench. The immunoassay displays high sensitivity, wide linear range and good selectivity for TNF-α detection. The developed immunoassay combines the high throughput of ELISA type assay and the low cost as well as simplicity of nanoparticle label, which could find wide applications for clinical screening purposes.

Multiplexed electrochemical immunosensor was developed for ultrasensitive detection of interleukin-6 (IL-6) and interleukin-17 (IL-17) using electrochemical tag incorporated polystyrene sphere (PS) as label. The electrochemical tag contained in the PS, cadmium ion (Cd2+) or ferrocene (Fc), could be effectively detected by square wave voltammetry (SWV) after dissolving the PS with organic solvent to release the electrochemical tags onto electrode surface. With the immobilization of two different antibodies onto the PS surface, respectively, the position and intensity of the current peaks due to the two electrochemical tags could reflect the identity and level of the corresponding protein biomarkers. The significant amount of electrochemical tags incorporated into PS greatly enhanced the detection sensitivity. The proposed immunoassay exhibited high sensitivity and good selectivity for the detection of IL-6 and IL-17. The response current was linear to the logarithm concentrations of IL-6 and IL-17 in the range from 1 pg/mL to1 ng/mL and 2 pg/mL to 1 ng/mL, respectively. The detection limits of IL-6 and IL-17 were 0.5 and 1 pg/mL (S/N = 3). These results suggested that this electrochemical immunosensor would be widely applied for clinical screening of protein biomarkers.

The results of the assay for measuring anti-non-Gal antibodies (which affect pig xenograft survival) in recipients are important. Serum incubation time and concentration may be important factors in the extent of antibody binding to the graft. The aim of this in vitro study was to determine the optimal incubation time and serum concentration for measuring anti-non-Gal antibody binding to porcine aortic endothelial cells (pAECs). Pooled human, naive, and sensitized baboon sera were incubated with wild-type, α1,3-galactosyltransferase gene-knockout (GTKO), and GTKO/human CD55 pAECs. IgM/IgG binding to pAECs after varying serum incubation times (0.5, 1, 2, and 3 hour) and concentrations (5, 10, 20, and 40 μL) was determined by flow cytometry. An increase in incubation time from 30 minutes to 2 hour was associated with increases in anti-non-Gal IgM/IgG binding to GTKO and GTKO/hCD55 pAECs of pooled human, naive and sensitized baboon sera (P

Ultrasensitive electrochemical immunosensor for the detection of tumor necrosis factor-α (TNF-α) was reported based on Prussian Blue (PB) functionalized ceria nanoparticles (PB-CeO 2 ) as label. To prepare PB-CeO 2 , CeO 2 was first coated with a positively charged chitosan (CS) layer to adsorb negatively charged Fe(CN) 6 3− . Then, with the addition of FeCl 2 , PB nanoparticles were synthesized within the CS layer on the CeO 2 surface. The synthesized PB-CeO 2 was found to have high sensitivity toward H 2 O 2 detection. Secondary anti-TNF-α antibody (Ab 2 ) was cross-linked to the PB-CeO 2 through glutaraldehyde to obtain the label (PB-CeO 2 -Ab 2 ). The electrochemical immunosensor for the detection of TNF-α was constructed based on the traditional sandwich structure with the immobilization of primary anti-TNF-α antibody (Ab 1 ) onto gold nanoparticles (AuNPs) modified carbon nanotube (CNT) surface. With the response of the immunosensor toward 1 mM H 2 O 2 as signal, the proposed immunosensor has wide linear range (0.005–5 ng/mL) and low detection limit (2 pg/mL) to TNF-α. The proposed immunosensor preparation strategy successfully demonstrated a simple, sensitive and specific method that can be expanded to the detection of other proteins.

Background The transcription factor forkhead box P3 (Foxp3) is a master regulatory gene necessary for the development and function of CD4+CD25+ regulatory T cells (Tregs). Mesenchymal stem cells (MSC) have recently emerged as promising candidates for cell-based immunosuppression/tolerance induction protocols. Thus, we hypothesized that MSC-based Foxp3 gene therapy would improve immunosuppressive capacity of MSC and induce donor-specific allograft tolerance in rat’s liver allograft model. Methods The present study utilized a lentivirus vector to overexpress the therapeutic gene Foxp3 on MSC. In vivo, Injections of 2 × 106 MSC, FUGW-MSC or Foxp3-MSC into the portal vein were carried out immediately after liver transplantation. Results Successful gene transfer of Foxp3 in MSC was achieved by lentivirus carrying Foxp3 and Foxp3-MSC engraftment in liver allograft was confirmed by fluorescence microscopy. Foxp3-MSC treatment significantly inhibited the proliferation of allogeneic ACI CD4+ T cells to splenocytes (SC) from the same donor strain or third-party BN rat compared with MSC. Foxp3-MSC suppressive effect on the proliferation of CD4+ T cells is contact dependent and associated with Programmed death ligand 1(PD-L1) upregulation in MSC. Co-culture of CD4+ T cells with Foxp3-MSC results in a shift towards a Tregs phenotype. More importantly, Foxp3-MSC monotherapy achieved donor-specific liver allograft tolerance and generated a state of CD4+CD25+Foxp3+ Tregs-dependent tolerance. Conclusion Foxp3-engineered MSC therapy seems to be a promising and attractive cell therapy approach for inducing immunosuppression or transplant tolerance.

To explore the protective eff ect of minocycline on hepatic ischemia-reperfusion injury (IRI) in rats and the underlying mechanisms.A total of 54 male Sprague-Dawley rats were randomly divided into 3 groups: the sham-operated group (control group), the ischemic-reperfusion (IR group), and the minocycline preconditioning group (n=18 per group). The rats in the minocycline preconditioning group were given minocycline (45 mg/kg) by gastric irrigation at 36 h before operation and then were subsequently administered with minocycline (22.5 mg/kg) at every 12 h. Th e rats were sacrifi ced at 2, 6, 24 h after reperfusion. The serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST) and lactate dehydrogenase (LDH) were measured. HE staining of liver tissues was performed to detect the histological changes, and the degree of liver IRI according to Suzuki score were calculated. The levels of malondialdehyde (MDA) and myeloperoxidase (MPO) were determined by spectrophotometer; the mRNA expression of tumor necrosis factor-α (TNF-α) and interleukin-1 beta (IL-1β) in the liver were measured by real-time PCR; Dickkopf-1 (DKK-1) and beta-catenin (β-catenin) protein expression in the liver were detected by Western blot.After 2, 6, 24 h reperfusion, compared with the IR group, the liver function (ALT, AST and LDH) in the minocycline group was significantly improved (all P0.05); the Suzuki's scores and the levels of hepatic TNF-α and IL-1β mRNA were significantly decreased (all P0. 05); the MDA and MPO levels the liver were decreased (both P0.05); the protein expression of hepatic DKK-1 was decreased (P0.05), while the protein expression of β-catenin was increased (P0.05).Minocycline can alleviate the ischemic-reperfusion injury mainly through reducing oxidative stress and inhibiting the release of pro-inflammatory cytokines depends on the activation of the Wnt/β-catenin signaling pathway in the liver.

Prunella vulgaris L. belongs to the Prunella genus and has been proven effective in the treatment of gastric cancer, however, the therapeutic activity of the endophytic fungi is not yet well understood. The results of the present study suggest that the ethyl acetate extract (S03-EA) of the endophytic fungus XKC-S03, isolated from Prunella vulgaris L. spica, is a potent anticancer agent with the potential to treat gastric cancer. In the present study, the effects of S03-EA on gastric cancer in vitro and in vivo were determined using the 1-(4,5-dimethylthiazol-2-yl)-3,5-diphenylformazan assay and the human gastric cancer SGC 7901 cell xenograft model. The tumor tissue was fixed with 10% formaldehyde solution and the levels of the apoptotic proteins, B-cell lymphoma protein-2 (Bcl-2), Bcl-2-associated X protein (Bax) and pro-angiogenic vascular endothelial growth factor (VEGF), were measured by immunohistochemistry. The results indicated that treating SGC 7901 cells with petroleum ether (S03-PE), ethyl acetate (S03-EA) or dichloromethane (S03-DM) extracts from the XKC-S03 fermentation broth inhibited cell proliferation. S03-EA demonstrated the best activity, with a half maximal inhibitory concentration of 25.89 μg/ml and dose-dependent suppression of the SGC 7901 tumor cells in vivo, without any evident adverse effects. In addition, the 100-mg/kg/day S03-EA-treated tumor tissue revealed a downregulation of Bcl-2 and VEGF expression and an upregulation of Bax expression. In conclusion, the S03-EA extract of XKC-S03, isolated from Prunella vulgaris L. spica, exhibits a growth-suppressive activity on gastric cancer in vitro and in vivo.

Axis inhibition protein 1 (AXIN1) is a negative regulator of Wnt/beta-catenin signaling via regulating the level of beta-catenin. However, the role of AXIN1 in the tumorigenesis and progression of hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC) is less clear. PCR sequence analysis, immunohistochemistry, and Western blot were performed on 22 HBV-related HCC samples and corresponding nontumor liver tissues to detect variants in AXIN1 gene and the expression level of AXIN1. Human hepatoma cell lines SNU475 and SNU423 were transfected with pCDNA3.1-AXIN1-myc or AXIN1 G425S-myc mutant. The growth curve and apoptosis rate of cell lines, phosphorylation of beta-catenin, and cell cycle regulatory proteins depending on beta-catenin transcriptional activity were detected. We identified four mutations of AXIN1 in 22 primary HBV-related HCCs and demonstrated a lower expression of AXIN1 in HBV-related HCC tissues than that in paired adjacent nontumor tissues. Overexpression of AXIN1 wild-type but not AXIN1 mutant inhibited the growth of HCC cell lines, accelerated their apoptosis, and negatively regulated beta-catenin-dependent transcriptional activity. Our study revealed that alterations of AXIN1 were involved in HBV-related HCC. Overexpression of AXIN1 but not AXIN1 mutant negatively regulated beta-catenin-dependent transcriptional activity and downregulated the level of cell cycle regulatory proteins, suggesting that AXIN1 may be a potential target for gene therapy of primary HCC.

MicroRNAs are a class of small, noncoding RNAs that function as critical regulators of gene expression by targeting mRNAs for translational repression or degradation. In this study, we demonstrate that expression of microRNA-124 (miR-124) is significantly downregulated in colorectal cancer tissues and cell lines, compared to the matched adjacent tissues. We identified and confirmed inhibitor of apoptosis-stimulating protein of p53 (iASPP) as a novel, direct target of miR-124 using target prediction algorithms and luciferase reporter gene assays. Overexpression of miR-124 suppressed iASPP protein expression, upregulated expression of the downstream signaling molecule nuclear factor-kappa B (NF-κB), and attenuated cell viability, proliferation, and colony formation in SW480 and HT-29 colorectal cancer cells in vitro. Forced overexpression ofiASPPpartly rescued the inhibitory effect of miR-124 on SW480 and HT29 cell proliferation. Taken together, these findings shed light on the role and mechanism of action of miR-124, indicate that the miR-124/iASPP axis can regulate the proliferation of colorectal cancer cells, and suggest that miR-124 may serve as a potential therapeutic target for colorectal cancer.

Both angiotensin (Ang)-II and endothelin-1 (ET-1) are involved in the pathogenesis of liver fibrosis. Activated hepatic stellate cells (HSCs) are considered a key effector of liver fibrosis. To explore the effect of Ang-II on ET-1 expression in cultured human HSCs and the underlying mechanisms. Human HSCs were treated with Ang-II in different concentrations (0.1, 0.5, 1, 5, or 10 nM) for different lengths of time (0.5, 1, 2, 4, or 6 h) with or without transcription inhibitor actinomycin D, Ang-II type 1 (AT1) receptor blocker losartan, AT2 receptor blocker PD123177, or different kinase inhibitors. Ang-II increased the ET-1 mRNA level in a statistically significant dose- and time-dependent manner within 4 h, which led to dose-dependent up-regulation of the ET-1 protein level. Actinomycin D (1 mg/ml), losartan (50 μM), and phosphatidylinositol-3 kinase inhibitor LY294002 (50 μM) abolished the promoting effect of Ang-II on ET-1 expression. Ang-II (10 nM) significantly increased the expression of α-smooth muscle actin and type I collagen in HSCs, which was abolished by losartan, LY294002, ET A receptor blocker BQ123, and ET-1 siRNA, but not PD123177 and ET B receptor blocker BQ788. Ang-II induces ET-1 expression in human HSCs via the AT1 receptor by the PI3 K/Akt signaling pathway. The ET-1/ET A receptor axis could mediate the promoting effects of Ang-II on HSCs’ transdifferentiation into myofibroblast-like cells. This is the first evidence of crosstalk between the Ang-II/AT1 axis and the ET-1 system in regard to the pathogenesis of liver fibrosis.

The accessory or replaced right hepatic artery (A/R RHA), which arises from the superior mesenteric artery (SMA), represents a challenge to the surgeon during combined procurement of liver and whole pancreas allografts. We have herein described an angiographic investigation of this aberrant artery among 553 patients who underwent angiography of both the celiac axis and SMA trunks to measure the diameters of the arteries to be anastomosed as well as to clarify the locational relationship between the inferior pancreaticoduodenal artery (IPDA) and A/R RHA. Sixty-nine (12.5%) of 553 patients had an unambiguous site of the A/R RHA. In 6 patients the IPDA was not visible. We separated the remaining 63 patients into 2 groups: group A whose A/R RHA shared a common origin with IPDA, and group B whose A/R RHA had a noncommon origin with IPDA. Fifteen (23.8%) of these 63 patients had a common origin of IPDA and A/R RHA. The results showed that the diameters of A/R RHA and gastroduodenal artery (GDA) were matched in both groups whether or not the IPDA shared a common origin with A/R RHA. The similar vascular diameters between A/R RHA and GDA in these 2 groups simplified the anastomosis, but management of the A/R RHA with different locational relationships between the IPDA and A/R RHA remains a problem. We recommend a safe method to be applied to all donors with an A/R RHA regardless of the origin of the IPDA.

To investigate the expression of T helper (Th) 17 cells and the related interleukin 17 (IL-17) in acute renal allograft rejection in mice and its significance.We established a mouse renal allograft model, in which mice were randomly divided into a renal isograft group and an acute renal allograft rejection group. Three and 7 d after the transplantation, the serum interferon (IFN)-γ and IL-17 levels in the mice were determined by enzyme-linked immunosorbent assay, the percentage of Th1 and Th17 cells in the total kidney-infiltrating lymphocytes was investigated by flow cytometry, and the transplanted kidney species were given routine pathological examination after fixation with 10% formalin.Compared with the isograft group, the allograft mice showed a significantly higher content of IL-17 (P0.05) but not IFN-γ in the serum 3 d after transplantation, and showed significantly higher serum IL-17 and IFN-γ contents 7 d after transplantation (P0.05). Also, compared with the isograft group, the allograft mice exhibited significantly higher percentage of Th1 and Th17 cells on both day 3 and day 7 (P0.05). In the allograft group, the contents of serum IFN-γ and IL-17 and the percentage of Th1 and Th17 cells were significantly higher on day 7 than on day 3 (P0.05). Routine pathological examination indicated that, as time passed, the allograft mice showed gradually stronger rejection responses.Th17 cells might play an important role in the development of acute renal allograft rejection, and IL-17 can be used as an early indicator of acute rejection.

To investigate the surgical procedures of orthotopic small bowel transplantation (SBT) model in mice to study the function and rejection of SBT.We established a mouse SBT allograft model as follows: the donor portal vein was anastomosed end by side with the recipient inferior vena cava; the donor superior mesenteric artery with aorta patch was anastomosed end by side with recipient abdominal aorta. After an appropriate length of the recipient's small bowel was removed, the donor's small bowel and the recipient's small bowel were end-to-end anastomosed discontinuously. The mice were fasted for 4 d after the operation, free access to water and subcutaneously injection of 2 mL of 5% glucose saline twice daily. Operation success was regarded as survival for more than 5 d. There is no antibiotic and immunosuppressor.A total of 30 transplantations were done, the 5 d survival rate was 60% (18/30), and 12 died within 5 d. Among the dead recipients, 5 died of arterial anastomotic stenosis and anastomotic thrombosis, 2 of hemorrhagic shock caused by anastomotic bleeding, and the other 5 of intra-abdominal infection caused by postoperative intestinal fistula. The donors' operative time was (40 ± 4.5) min, warm ischemia time was about 0.5 min, donor preparation time was about 3 min, and cold preservation time was (30 ± 7.5) min. The recipients' operative time was (95 ± 8.0) min, among which, the abdominal aorta and inferior vena cava clamping time was (38 ± 3.5) min, the venous anastomotic time was (10 ± 2.0) min and the arterial anastomotic time was (15 ± 3.0) min. The mean intra-operative blood loss of the surviving recipient mice was about 0.2 mL.High quality vascular anastomosis, and rehydration of donors and recipients are crucial factors for improving the success rate of SBT.

To investigate the association between p53 codon 72 polymorphisms and gastric cancer risk, a meta-analysis published in 2007 was updated with new data. Relevant literature was retrieved by searching PubMed and statistical analysis conducted using Review Manager software. Twenty-eight case–control studies were included in this meta-analysis, with 6,859 cases and 9,277 controls. The pooled results for all included studies showed that patients with gastric cancer had a borderline lower frequency of the Arg/Arg phenotype (odds ratio (OR) = 0.91, 95 % CI = 0.83–1.00, p = 0.04). When stratified for race, the difference in Arg/Arg frequency was significant among Asians (OR = 0.87, 95 % CI = 0.78–0.97, p = 0.01). On stratifying the various studies we found that, among Asians: (i) patients with cardial gastric cancer had a significantly higher frequency of the Pro/Pro genotype (OR = 1.35, 95 % CI = 1.03–1.77, p = 0.04) than those with non-cardial gastric cancer; (ii) patients with advanced (stage III/IV) gastric cancer had a significantly higher frequency of Arg/Arg (OR = 1.30, 95 % CI = 1.06–1.61, p = 0.01) than those with early (stage I/II) cancer; and (iii) patients with metastasis had a significantly higher frequency of Pro/Pro (OR = 3.31, 95 % CI = 1.31–8.41) than those without metastasis. Our study suggests that, among Asians, the p53 codon 72 Arg/Arg genotype is associated with a modestly decreased risk of gastric cancer, and that this difference in genotype distribution may be associated with cancer stage, location, differentiation and metastasis.