Search

Background: The present study aims to estimate leisure-time physical activity and television (TV) viewing curves according to age stratified by sex, area of residence, and socioeconomic position. Methods: Using data from the Brazilian National Health Survey, we estimated the prevalence of leisure-time physical activity and TV viewing according to continuous age. The estimates were calculated using fractional polynomials and stratified by sex, wealth, skin color, and area of residence. Results: The sample included 87,376 adults (aged 18 y or over). In general, leisure-time physical activity decreased according to age while TV viewing increased. Regarding behavior of curves according to stratifiers, for leisure-time physical activity the disadvantaged groups maintained a pattern of low physical activity across all age groups or presented the decrease earlier when compared to groups in social advantage. On the other hand, for TV viewing, women presented an increase in prevalence before men, and individuals living in the urban area and the wealthiest group were those with a higher increase according to age. Conclusions: Our findings may help researchers and policymakers further explore inequalities in physical activity across life in different settings, as well as develop sensitive cultural actions to support more vulnerable people to adopt public health recommendations. [ABSTRACT FROM AUTHOR]

Introduction: The Cuban population is genetically diverse, and information on the prevalence of genetic variants is still limited. As complex admixture processes have occurred, we hypothesized that the frequency of pharmacogenetic variants and drug responses may vary within the country. The aims of the study were to describe the frequency distribution of 43 single-nucleotide variants (SNVs) from 25 genes of pharmacogenetic interest within the Cuba population and in relation to other populations, while taking into consideration some descriptive variables such as place of birth and skin color. Materials and Methods: SNVs were analyzed in 357 unrelated healthy Cuban volunteers. Genotype, allele frequencies, and ancestry proportions were determined, and the pairwise fixation index (FST) was evaluated. Results: Hardy–Weinberg equilibrium (HWE) deviations in six loci (rs11572103, rs2740574, rs776746, rs3025039, rs861539, and rs1762429) were identified. Minor allele frequencies (MAFs) ranged from 0.00 to 0.15 for variants in genes encoding xenobiotic metabolizing enzymes. They also ranged from 0.01 to 0.21 for variants in DNA repair, growth factors, methyltransferase, and methyl-binding proteins, while they ranged from 0.04 to 0.27 for variants in the O-6-methylguanine-DNA methyltransferase enzyme. Moderate genetic divergence was observed upon comparison to Africans (FST = 0.071 and SD 0.079), with 19 markers exhibiting moderate-to-large genetic differentiation. The average European, African, and Amerindian ancestry proportions were 67.8%, 27.2%, and 5.3%, respectively. Ancestry proportions differed by skin color and birthplace for both African and European components, with the exception of the European component, which showed no significant difference between individuals from Western and Eastern regions. Meanwhile, the statistical significance varied in comparisons by skin color and birthplace within the Amerindian component. Low genetic divergence was observed across geographical regions. We identified 12 variants showing moderate-to-large differentiation between White/Black individuals. Conclusion: Altogether, our results may support national strategies for the introduction of pharmacogenetic tools in clinical practice, contributing to the development of precision medicine in Cuba. [ABSTRACT FROM AUTHOR]

In the face of global climate change, adapting to intensive temperature variation and maintaining stable body temperature in outdoor settings are crucial for keeping personal health and boosting labor productivity. Developing zero‐energy fabrics with switchable thermoregulation provides a feasible strategy for responding to this climate circumstance. However, integrating switchable thermoregulation into fabrics without compromising their structural integrity, comfortability, and fabrication scalability remains challenging. Here, inspired by the Bokermannohyla alvarengai, which adapts its skin color in Janus mode to different sunlight and temperature conditions by varying its pigment cells, the fabrics with Janus spectral responsiveness are designed. The radiative cooling micro‐fibers and photothermal micro‐fibers are assembled into tailored textures, constructing the single‐layer fabrics coupled with distinct thermoregulation functions on each side. The resulting Janus spectral responsiveness fabrics present a solar reflectivity of 83.9% in cooling mode and a solar absorptivity of 84.3% in heating mode, while the robust interlaced coil configuration of the fabrics not only maintains the rich porous structures but also enhances the structural integrity of the fabrics. Advancing single‐layer, dual‐mode fabrics may provide a promising pathway for all‐weather switchable personal thermoregulation, potentially optimizing the market for personal thermal management. [ABSTRACT FROM AUTHOR]

Organisms possess remarkably adaptive ability to complex environments. For example, chameleons can alter their skin color to adapt to varying environments, which has inspired significant advances in bioinspired soft electronic skins (E‐skins), and their wide applications in wearable sensors, intelligent robots, and health monitoring. However, current bioinspired E‐skins face challenges in ultra‐stretchability, high sensitivity, and long‐term stability owing to the intrinsic limitations associated with their mismatched interface between soft matrix and hard conductive fillers, hindering their practical applications. Here, it is reported that bioinspired structural color electronic skins (SC E‐skins) that consist of liquid metal particles (LMPs), periodical ordered colloidal crystal arrays, and ultra‐stretchable hydrogel, imparting synergistic and durable electrical–optical sensing capabilities. Such SC E‐skins demonstrate outstanding performances including superior flexibility (elongation at break > 1100%), high sensitivity (gauge factor = 3.26), fast synergetic electric–optical response time (≈100 ms), outstanding durability (over 1500 cycles), and high accuracy (R2 > 99.5%). These bioinspired SC E‐skins with excellent capability of converting mechanical signals into synergetic electrical–optical outputs hold great promise for smart wearable devices, affording a new horizon in developing advanced health monitoring technologies. [ABSTRACT FROM AUTHOR]

SUMMARY: The external appearance of fruit commodities is an essential trait that has profound effects on consumer preferences. A natural melon variety, characterized by an uneven and patchy arrangement of dark green streaks and spots on the white‐skinned rind, resembles shooting stars streaking across the sky; thus, this variety is called "Shooting Star" (SS). To investigate the mechanism underlying the SS melon rind pattern, we initially discovered that the variegated dark green color results from chlorophyll accumulation on the white skin. We then constructed a segregation population by crossing a SS inbred line with a white rind (WR) inbred line and used bulk segregant analysis (BSA) revealed that the SS phenotype is controlled by a single dominant gene, CmAPRR2, which has been previously confirmed to determine dark green coloration. Further genomic analysis revealed a hAT‐like transposable element (TE) inserted in CmAPRR2. This TE in CmAPRR2 is recurrently excised from rind tissues, activating the expression of CmAPRR2. This activation promotes the accumulation of chlorophyll, leading to the variegated dark green color on the rind, and ultimately resulting in the SS rind phenotype. Therefore, we propose that the SS phenotype results from the recurrent excision of the hAT‐like TE in CmAPRR2. Significance Statement: Currently, there are numerous studies on transposons in asexual reproduction, but few focus on their role in sexual reproduction. In this paper, we investigate melon skin color through map‐based cloning to locate the gene responsible for skin color and identify the transposons affecting it. [ABSTRACT FROM AUTHOR]

Objective: N6-methyladenosine (m6A) is the most prevalent methylation of mRNA and plays crucial roles in various physiological processes, including pigmentation. Yet, the regulatory mechanisms, including long noncoding RNAs (lncRNAs) m6A methylation contributing to pigmentation in sheep skin remains unclear. The purpose of this study was to identify potential lncRNAs and the m6A methylation of lncRNAs associated with pigmentation. Methods: RNA-seq and MeRIP-seq were performed to study the expression of lncRNAs and the m6A methylation of lncRNAs in black and white sheep skin. Furthermore, quantitative real-time polymerase chain reaction (qRT-PCR) was used to verify the consistency with the RNA-seq and MeRIP-seq data. Results: We identified 168 differentially expressed lncRNAs between the two sheep skin colors. The differentially expressed lncRNAs enriched in the pathway of ECM-receptor interaction, Rap1 signaling pathway, and Non-homologous end-joining may play essential roles in pigmentation. We identified 577 m6A peaks and 617 m6A peaks in black and white sheep skin, respectively, among which 20 m6A peaks showed significant differences. The enriched motif in sheep skin was "GGACU", which aligned with the consensus motif "RRACH" (R = A or G, H = A, C or U). Differently methylated lncRNAs enriched in PI3K-Akt signaling pathway and Wnt signaling pathway might participate in skin pigmentation. ENSOARG00020015168 was the unique lncRNA with high expression and methylation (Hyper-Up) in black sheep shin. A lncRNA-mRNA network was constructed, with pigmentation-related genes, such as PSEN2, CCND3, COL2A1, and ERCC3. Conclusion: The m6A modifications of lncRNAs in black and white colored sheep skin were analyzed comprehensively, providing new candidates for the regulation of pigmentation. [ABSTRACT FROM AUTHOR]

Aim: To examine the personal experiences and perceptions of people with dark skin tones and their carers, in relation to pressure injury. Design: Qualitative study using semi‐structured interviews. Methods: Twenty‐two interviews with people with dark skin tone and/or their family carers, who were known to and visited by community nurses for pressure area management or who had been identified as being at high risk for developing a pressure injury were carried out. Results: Thematic analysis of the interview transcripts revealed that skin discolouration towards a darker hue than usual was the commonest symptom identified by participants as a sign of altered skin integrity and potential pressure damage. Four main overarching themes were revealed through comprehensive analysis of the transcripts: (1) indicators of pressure injury; (2) experienced symptoms of pressure damage; (3) trust in healthcare workers; and (4) improving care for populations with dark skin tones. Conclusion: The findings from this study clearly present how early‐stage pressure damage is identified among people with dark skin tones. Implications for the Profession and/or Patient Care: These findings have the potential to reduce health inequality by influencing and informing clinical policies and strategies in practice. Findings could also lead to the development of patient‐informed educational strategies for nurses and health workers which will enable the early identification of pressure ulcers among people with dark skin tones. Further research is needed to better understand health disparities in relation to preventable patient safety harm. Impact: The findings demonstrate the importance of engaging with and listening to the stories and experiences of people living with pressure damage to help in the early recognition of pressure injuries. Reporting Method: The Consolidated Criteria for Reporting Qualitative Research (COREQ) guidelines for qualitative research were followed. Patient or Public Contribution: A project steering group reviewed information sheets for participants and checked the interview questions were relevant and suitable. [ABSTRACT FROM AUTHOR]

In Brazil, ethnic-racial inequalities exist in all fields, obstructing access to goods, services, and opportunities, including healthcare services. However, there are no apparent studies that assess, at a national level, ethnic-racial disparities in poisoning cases, emphasizing skin color as a determining factor. The study aimed to examine the relationship between race/ethnicity and general poisoning cases, by medications, pesticides, and drug of abuse in Brazilian states. Poisoning cases data were extracted for the years 2017, 2018, and 2019. Notification data for general poisoning cases and toxic agents were collected: medications, pesticides, and drugs of abuse. Data were categorized between whites and non-whites (blacks, browns, and indigenous) and without information on skin color/ethnicity. Rates of poisonings amongst ethnic-racial groups and cases of not declared skin color as well as relative risk (RR) of poisoning among non-whites were calculated. All states in the North, Northeast (states with the worst Human Development Index), Midwest, and 2 states in the Southeast exhibited higher rates of poisoning cases per 100,000 inhabitants among non-whites. The RR values for nonwhite individuals were higher in the North and Northeast regions for all types of poisonings. The type of poisoning cases that presented the highest RR for non-whites over the 3 years was drugs of abuse (2–2.44), when compared to other types of poisonings from pesticides (2–2.33) and medications (1.5–1.91). The spatial distribution of poisoning cases rates and RR of nonwhite population support public policies to reduce socioeconomic and environmental inequalities. [ABSTRACT FROM AUTHOR]

Curcuma longa has been reported to impart fairness to human skin traditionally. However, the empirical evidence of this report has barely being actualized. Efforts were made by using Molecular Docking approach and Adsorption Distribution Metabolism Excretion and Toxicity (ADMET) analysis to identify the potential compounds responsible for imparting fairness. The results showed that the hit compounds - Turmerone, curlone, 6-Octadecenoic acid (Z)-, Ar-turmerone, 9-Octadecenoic acid and Hexanoic acid, 5-oxo-,ethyl ester were the most abundant compounds with percentages 16.7 %, 9.31 %, 9.19 %, 7.98 %, 6.65 % and 5.24 % have more stable binding affinity on the human tyrosinase-related protein 1 and ADMET analysis proved these hit compounds to be skin friendly. [ABSTRACT FROM AUTHOR]

Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and blackskinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different redskinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of longterm interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish. [ABSTRACT FROM AUTHOR]

Photonic‐ionic skins (PI‐skins) featuring multi‐signal synergistic outputs exhibit fascinating interactive sensing potential in flexible iononics. However, the existing ones are susceptible to irreversible damage in usage due to their poor toughness and deficiency in self‐healing. Herein, a novel tough mechanochromic PI‐skin is ingeniously constructed, from both molecular engineering and nanostructural engineering perspectives, via integrating the ordered photonic array and robust metal‐imidazole cross‐linked network. The PI‐skin displays synchronous structural color variation and sensitive electrical response under strain. Notably, the synergy of dense physical cross‐linking network and microphase‐separation structure achieved by strong metal‐imidazole coordination greatly promotes energy dissipation. PI‐skin possesses a combination of exceptional properties, including high fracture strength (8.22 MPa), remarkable toughness (10.23 MJ m−3), and robust adhesion behavior (2.30 MPa). Furthermore, favorable self‐healing capability at room temperature is realized thanks to the dynamic topological rearrangement of metal‐imidazole coordination. The PI‐skin demonstrates promising uses as a visually interactive wearable device for human motion monitoring and remote communication. This work not only broadens design considerations for the development of high‐performance artificial skins but also offers a general optical platform for high‐level interactive wearable devices. [ABSTRACT FROM AUTHOR]

Melanosomes play a pivotal role in skin color and photoprotection. In contrast to the well-elucidated pathway of melanosome biogenesis, the process of melanosome degradation, referred to as melanophagy, is largely unexplored. Previously, we discovered that 3,4,5-trimethoxycinnamate thymol ester (TCTE) effectively inhibits skin pigmentation by activating melanophagy. In this study, we discovered a new regulatory signaling cascade that controls melanophagy in TCTE-treated melanocytes. ITCH (itchy E3 ubiquitin protein ligase) facilitates ubiquitination of the melanosome membrane protein MLANA (melan-A) during TCTE-induced melanophagy. This ubiquitinated MLANA is then recognized by an autophagy receptor protein, OPTN (optineurin). Additionally, a phospho-kinase antibody array revealed that TCTE activates PTK2 (protein tyrosine kinase 2), which phosphorylates ITCH, enhancing the ubiquitination of MLANA. Furthermore, inhibition of either PTK2 or ITCH disrupts the ubiquitination of MLANA and the MLANA-OPTN interaction in TCTE-treated cells. Taken together, our findings highlight the critical role of the PTK2-ITCH-MLANA-OPTN cascade in orchestrating melanophagy progression.Abbreviations: α-MSH: alpha-melanocyte-stimulating hormone; dichlone: 2,3-dichloro-1,4-naphthoquinone; ITCH: itchy E3 ubiquitin protein ligase; MITF: melanocyte inducing transcription factor; MLANA: melan-A; NBR1: NBR1 autophagy cargo receptor; OPTN: optineurin; PINK1: PTEN induced kinase 1; PTK2: protein tyrosine kinase 2; SQSTM1/p62: sequestosome 1; TCTE: 3,4,5-trimethoxycinnamate thymol ester; TPC2: two pore segment channel 2; VDAC1: voltage dependent anion channel 1. [ABSTRACT FROM AUTHOR]

A 70‐year‐old African American female with a history of stage IV mycosis fungoides in remission presented with a gradually enlarging, red, ulcerated nodule on her right dorsal hand. The lesion was biopsied, and it showed intraepidermal proliferation with cytologic atypia and increased vasculature in the papillary dermis. Immunohistochemical staining indicated a yes‐associated protein 1 (YAP1) rearrangement, confirmed by RNA sequencing, revealing a YAP1::MAML2 (mastermind‐like transcriptional coactivator 2) fusion. The lesion was diagnosed as an eccrine porocarcinoma (EPC). The occurrence of EPCs following radiotherapy or trauma has been documented. This case highlights the importance of considering EPCs in patients with extensive skin treatments and immunosuppression history. [ABSTRACT FROM AUTHOR]

Copyright of Food & Fermentation Industries is the property of Food & Fermentation Industries and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Cephalopods can change their skin color by using high‐speed electron transduction among receptors, neural networks, and pigmentary effectors. However, it remains challenging to realize a neuroelectrical transmission system like that found in cephalopods, where electrons/ions transmit on nanoscale, which is crucial for fast adaptive electrochromic tuning. Inspired by that, hereby an ideal, rapidly responsive, and multicolor electrochromic biomimetic skin is introduced. Specifically, the biomimetic skin comprises W18O49 nanowires (NWs) that are either colorless or blue, Au nanoparticles@polyaniline (Au NPs@PANI) ranging from green to pink, and a flexible conductive substrate. As the applied voltage changes from 0.4 V to ‐0.7 V and back to 0 V, the color of the biomimetic skin transforms from green to blue and ultimately to pink. This color change is attributed to the electrically induced redox reaction of Au NPs@PANI and W18O49 NWs, triggered by the transfer of electrons and ions. Furthermore, the high versatility and adaptability of electrical stimulus enable the creation of a highly interactive electrochromic biomimetic skin system through the integration of sensitive acoustic sensors, providing a perfect environment‐responsive platform. This work provides a biomimetic multicolor electrochromic skin that depends on electron/ion transfer on nanoscale, expands potential uses for camouflage skin. [ABSTRACT FROM AUTHOR]

Objective: Unusual setting of medical care Background: Giant cell tumors of bone typically occur in early adulthood, when the growth plate has closed. The distal radius is the second most common location affected, accounting for 10% to 12% of cases. Complications of poor soft tissue healing are rare in the distal radius, owing to its rich blood supply. However, the curettage procedure and use of bone cement and external fixation can affect the local blood supply. Case Report: We present a rare case of a 24-year-old woman with no significant medical history who underwent surgery at a local hospital to treat a giant cell tumor of the radius. During postoperative wound dressing changes, a 4×3-cm area of flushed skin color with a small blister and reduced local sensation was found on the dorsal side of the wrist. The skin condition worsened despite treatment at the surgical outpatient clinic, leading to referral to scar specialist outpatient treatment. Examination revealed a well-healed surgical scar on the palmar side of the wrist, but a skin defect with necrotic tissue and tendon exposure on the dorsal side. The diagnosis was postoperative soft tissue necrosis of the skin with a giant cell tumor of the bone. Conclusions: This case report discusses the management of chronic non-healing postoperative wounds in giant cell tumors of the distal radius. It emphasizes the importance of appropriate dressing changes, selecting suitable dressings, nutritional support, and effective nurse-patient communication. The case serves as an example of best practices for managing these types of wounds. [ABSTRACT FROM AUTHOR]

Elucidating the key genes and metabolites responsible for fruit skin color is essential for the breeding of strawberry varieties with beautiful fruit color. Here, transcriptome and metabolome analyses were used to identify the key genes and metabolites associated with fruit skin color in strawberry accessions of red skin (Kaorino), white skin (2012-W02), and the pink skin (Fenyu NO.1, the F1 hybrid of Kaorino and 2012- W02). The metabolomic data showed that the content of anthocyanin-related metabolites, such as p-Coumaroyl quinic acid, 5-Hydroxyconiferyl alcohol and Coumestrol were significantly higher in red-skinned strawberry line Kaorino than in the white-skinned line 2012-W02. The flavonoids and isoflavonoids such as syringetin and 2,7,4’-trihydroxy-isoflavone, were less expressed in the Kaorino than in the other two accessions. Transcriptome analysis revealed that the expression of genes involved in anthocyanin biosynthesis, such as BZ1, F3H, CHS, CHI, DFR, 4CL, PAL, CCR, 4CL, F5H, REF1 and UGT72E, were also significantly upregulated in the red-skinned line Kaorino compared to the white-skinned line 2012-W02, while the HCT, CYP75B1, FG3, HIDH, IF7MAT, I2’H, and VR was downregulated in Kaorino. Combined transcriptome and metabolome analyses revealed that the pathways of isoflavonoid biosynthesis and flavone and flavonol biosynthesis, and the phenylpropanoid biosynthesis pathway essential for anthocyanin synthesis were commonly enriched by DRMs and DEGs. In addition, themetabolites of peonidin 3-O-glucoside, 2’-hydroxydaidzein and daidzin, and the genes of CYP93B2_16 and UGT73C6 were detected andmost accumulated in pinkskinned Fenyu NO.1. This result suggested that the main strategy for obtaining a red skin color is to enhance the upstream pathway of anthocyanin biosynthesis, including the phenylpropanoid biosynthesis pathway, and to restrict the downstream steps in the flavonoid biosynthesis pathway, such as the branch pathway of flavone and flavonol biosynthesis and isoflavonoid biosynthesis. [ABSTRACT FROM AUTHOR]

The olive fruit is a drupe whose development and ripening takes several months from flowering to full maturation. During this period, several biochemical and physiological changes occur that affect the skin color, texture, composition, and size of the mesocarp. The final result is a fruit rich in fatty acids, phenolic compounds, tocopherols, pigments, sterols, terpenoids, and other compounds of nutritional interest. In this work, a transcriptomic analysis was performed using flowers (T0) and mesocarp tissue at seven different stages during olive fruit development and ripening (T1–T7) of the 'Picual' cultivar. A total of 1755 genes overexpressed at any time with respect to the flowering stage were further analyzed. These genes were grouped into eight clusters based on their expression profile. The gene enrichment analysis revealed the most relevant biological process of every cluster. Highlighting the important role of hormones at very early stages of fruit development (T1, Cluster 1), whereas genes involved in fatty acid biosynthesis were relevant throughout the fruit developmental process. Hence, genes coding for different fatty acid desaturase (SAD, FAD2, FAD3, FAD4, FAD5, FAD6, and FAD7) enzymes received special attention. In particular, 26 genes coding for different fatty acid desaturase enzymes were identified in the 'Picual' genome, contributing to the improvement of the genome annotation. The expression pattern of these genes during fruit development corroborated their role in determining fatty acid composition. [ABSTRACT FROM AUTHOR]

Background: Sweet syndrome (acute febrile neutrophilic dermatosis) is an uncommon inflammatory disorder characterized by the abrupt appearance of painful, edematous, and erythematous papules, plaques, or nodules on the skin. There are various subtypes, such as classical, drug-induced, malignancy-associated, and the less common variant giant cellulitis-like Sweet syndrome. This case is unique due to its presentation of the giant cellulitis-like variant of Sweet syndrome in a patient from Ethiopia. The unusual distribution of the skin lesions and the initial lack of response to antibiotics make this case particularly noteworthy. It underscores the importance of considering Sweet syndrome in differential diagnoses when faced with atypical skin manifestations and ineffective antibiotic treatment. This contribution adds valuable insights to the scientific literature by highlighting the need for heightened awareness of this rare variant and improving diagnostic accuracy in similar clinical scenarios. Case presentation: A 60-year-old Ethiopian male patient who presented to the accident and emergency department with a 5-day history of fever, chills, sweating, and rigor accompanied by a reddish skin color change around the anterolateral region of the right chest wall. On physical examination, there were erythematous, indurated tender plaques with ill-defined borders over the right antero- and posterolateral chest wall with extension to the lateral part of the right neck and medial aspect of the right arm. Subsequently, the patient was started on antibiotics, but there was a suboptimal response. Skin biopsy revealed features suggestive of giant cellulitis-like Sweet syndrome. He was then started on steroids, which significantly improved his symptoms. Conclusion: A cautious stance is essential when identifying Sweet syndrome in individuals displaying erythematous plaque-like skin lesions in atypical areas of the body with uneven distribution. Such presentation may signal Sweet syndrome rather than a common infection. If conventional treatments, such as antibiotics, fail to resolve symptoms, consider Sweet syndrome as a potential diagnosis. This approach ensures timely and appropriate treatment, preventing treatment delay and misdiagnosis. [ABSTRACT FROM AUTHOR]

Vitiligo is a common skin disorder where melanocytes, the cells that produce skin pigment, are destroyed by the immune system, leading to white patches on the skin and mucous membranes. This condition affects 0.4% to 2.0% of the global population, with a higher prevalence in females and often beginning in childhood. In India, about 1% of the population is affected, particularly in northern regions, with a higher incidence in females and links to other autoimmune diseases. This review examines recent progress in understanding vitiligo and its treatment. It focuses on the genetic, autoimmune, and environmental factors involved in the disease and highlights new therapies, such as targeted molecular treatments and advanced repigmentation methods. Current research shows that oxidative stress and genetic predispositions contribute to the autoimmune destruction of melanocytes. Novel drug delivery systems, including liposomes, nanoemulsions, and nanostructured lipid carriers, have improved treatment effectiveness. Clinical trials are exploring new treatments like Ruxolitinib cream and melanocyte transplantation, while teledermatology is becoming useful for managing patients. Vitiligo also poses a significant economic burden due to its impact on patients’ quality of life. Continued research is essential to develop better, more accessible treatments and reduce the economic impact of vitiligo. [ABSTRACT FROM AUTHOR]

Dermatosis papulosa nigra (DPN) is a variant of seborrheic keratosis that typically presents as hyperpigmented pedunculated papules on the face, trunk, and/or back in those with skin of color. Although benign, the lesions can cause significant discomfort and distress. Management options are limited and often unaffordable, as treatment is elective in most cases. This study was undertaken to provide an updated summary of safe and efficacious treatments for DPN. Five databases were searched to identify full‐text publications reporting on treatments and outcomes in adults with DPN. Seventeen publications met inclusion criteria and were included: six cohort studies, one randomized controlled trial, five case report studies, one case series, and four pilot studies. Treatment options included simple excision, curettage, electrodesiccation, cryotherapy, topicals, and laser therapies. These modalities varied in their documented outcomes and associated potential adverse effect profiles. Postinflammatory hyperpigmentation is a common adverse effect that often leads to patient dissatisfaction. It can be mitigated with topical treatments aimed at reducing local inflammation. Study limitations included small sample size in individual studies, lack of consistent reporting of Fitzpatrick skin type, and lack of comparison to the standard treatment of electrodesiccation or curettage. Ultimately, treatment should consider the patient's Fitzpatrick type, treatment area, associated costs, and potential adverse effects. [ABSTRACT FROM AUTHOR]

Racism and xenophobia are growing in Europe. The dignity and human rights of the thousands of immigrants who arrive on our beaches fleeing misery or war are being violated. The principles and values of the European Union, enshrined in its Treaty and Charter of Fundamental Rights-which have structured its internal and international action-are not being upheld with respect to the immigration issue. Not long ago, illustrious representatives of the EU proudly proclaimed these values: "The European way of life consists of pooling our main talents and energies. We have to respect others regardless of the color of their skin and the states they come from. Accepting those who come from distant lands is part of the European way of life". However, solidarity is increasingly absent. There is no migration crisis but a crisis of humanity, which the EU does not address. It has renounced acting according to its constitutional norms. Immigration, instead of being considered a humanitarian issue of primary interest, has become a security issue. There is no justice for the damaged of the Earth. It seems that the gods of the EU have forgotten what is fair and unfair. [ABSTRACT FROM AUTHOR]

Psoriasis is a chronic, relapsing inflammatory skin disorder that is associated with substantial physical and psychosocial comorbidity. Although biologic agents have offered transformative therapeutic advantages to those unresponsive to traditional treatments, data from recent literature indicate significant undertreatment of certain populations, highlighting potential barriers to access. This review aims to comprehensively elucidate barriers to biological therapy, addressing a recognized gap in the current literature. A search was conducted using MEDLINE, Embase, and Web of Science to investigate the obstacles and disparities that prevent access to biologic treatments in biologic‐naïve psoriatic patients. Emergent themes were then systematically categorized into five primary domains: patient‐level, prescriber‐level, medicine‐level, organizational‐, and external environment‐level factors. Our results demonstrate pronounced barriers and disparities encompassing increased age, race, socioeconomic status, rural location, cost and insurance, and insufficient knowledge that may hinder access to biologic treatments among psoriatic patients. Further research on how these barriers can be effectively addressed is needed to optimize treatment outcomes. [ABSTRACT FROM AUTHOR]

Squamous cell carcinoma of the nail unit (nSCC) is a rare malignant tumor of the hand and nail. Although skin cancer rarely affects individuals with phototypes IV–VI, its occurrence in these groups is often associated with greater morbidity and mortality. This study aims to characterize the clinical symptoms, presentations, and treatments of nSCC in patients with darker skin types. A systematic review of PubMed and Embase was performed in May 2023 for all peer‐reviewed, English‐language nSCC studies involving individuals with Fitzpatrick types IV–VI. Most tumors were located on the fingernails (84%), with the right third finger being the most frequently affected (31%). The nail bed (67%) exhibited a higher prevalence than the lateral/proximal nail folds (33%). The duration of symptoms before diagnosis ranged from 1 month to 7 years. nSCC was most commonly treated with Mohs surgery (38%), followed by amputation (35%). Our study was limited to case reports because of a lack of large nSCC studies that provide information on race or images of each patient. These tumors are generally slow‐growing yet often misdiagnosed, leading to delays in presentation and diagnosis. Increased awareness about nSCC in phototype IV–VI individuals will reduce misdiagnoses, unnecessary treatment, and recurrences. [ABSTRACT FROM AUTHOR]

Vascular anomalies can be broadly classified as vascular tumors or vascular malformations, depending on the degree of endothelial involvement. These lesions can be subtle and challenging to diagnose in individuals with darker skin tones, which can lead to a delay in treatment. Improving diagnostic accuracy of these lesions may prevent progression and potential adverse outcomes when left untreated. Here, we present a review of common vascular anomalies with a focus on diagnostic considerations in individuals with skin of color. [ABSTRACT FROM AUTHOR]

Objective: We sought to examine possible differences in BCC characteristics and treatment patterns between two matched cohorts of Hispanic White and non-Hispanic White individuals. Methods: In this single institution, retrospective matched cohort study, data from patients with biopsy proven BCC from June 2005 to May 2022 was collected. Demographic, BCC, and treatment characteristics were compared between Hispanic White and non-Hispanic White individuals using a Wilcoxon rank-sum test, for continuous and ordinal variables, and Fisher's exact test, for categorical variables. Results: A total of 604 individuals with a diagnosis of biopsy-proven BCC were matched in a 1:1 fashion by age (± 0 years) and sex, based on self-identified ethnicity as Hispanic or non-Hispanic. Since all patients self-identified as White race, the two cohorts were labeled Hispanic White (n=302) and non-Hispanic White (n=302). The most frequent location for BCC was in the H area, 129 [42.7%] White Hispanic group vs 132 [43.7%] White non-Hispanic group (p = 0.87). In both Hispanic White and non-Hispanic White groups, the predominant subtype of BCC was the nodular (149 [50.2%] vs 164 [54.7%], p = 0.25). The median BCC pre-operative size in the Hispanic White group was 0.9 cm, whereas in the non-Hispanic White group, it was 1.0 cm (p = 0.004). Furthermore, the MMS defect size in the Hispanic White group had a median of 1.3 cm, while in the non-Hispanic White group, it was 1.6 cm (p < 0.001). Limitations: Retrospective design, single-center study, and self-reported race and ethnicity. Conclusion: Both groups had similar demographics, tumor features, treatments, and post-operative complications. Notably, preoperative lesion and MMS defect sizes were larger in non-Hispanic Whites than in Hispanic Whites, contrary to expectations. Despite assumptions of poorer skin cancer outcomes among Hispanics, our findings indicate increased sizes in non-Hispanic Whites. Given the diversity in genetics and clinical traits within ethnicities, especially Hispanics, more research is needed for precise insights into disease outcomes across diverse backgrounds. [ABSTRACT FROM AUTHOR]

In popular materials designed to teach American students about the evolution of human skin color, students are guided toward a model in which ancestral latitude predicts levels of skin pigmentation. While this model agrees with data from people whose ancestors practiced intensive agriculture in Europe, Asia, and Africa, this model does not match data from other human populations across the globe, including the predicted skin pigmentation of ancient hunter-gatherer populations who maintained long-term settlements in these same regions. In this review, we discuss findings from ancient genome sequencing and provide guidance on teaching an updated model on the evolution of human skin color. (To increase accessibility for non-specialists, we present here a targeted rationale for updating classroom teaching practices, with a set of frequently asked questions regarding the current state of scientific research on this topic addressed in supplemental material.) With this update, we hope to help students avoid common misconceptions about human evolution—particularly, that the evolutionary pressures encountered by those who adopted a single human culture would apply to all humans, everywhere—and leverage authentic data and argumentation to convey the anti-racist reality that people with a wide range of skin colors thrived in high-latitude regions for many thousands of years, just as students with a wide range of skin colors can thrive in whatever place they currently call home. [ABSTRACT FROM AUTHOR]

Context • Pigmented dermatoses are skin diseases characterized by pigmentation changes in the skin’s surface due to abnormal melanocyte production. Photon-skin- rejuvenation technology can be effective for the management of facial pigmented dermatoses. Black Gold Delicate Pulse Light (DPL) Super Photon Skin Rejuvenation therapy is a new technology based on traditional photo rejuvenation. Objective • The study intended to evaluate the therapeutic efficacy of DPL therapy in the management of targeted pigmented skin diseases, such as melasma, solar lentigines, and postinflammatory hyperpigmentation. Design • The research team conducted a prospective cohort study. Setting • The study took place at Department of Dermatology, Affiliated Hospital of Shaoxing University, Shaoxing, China. Participants • Participants were 130 patients with facial pigmented dermatoses treated at the hospital between February 2021 and December 2021. Interventions • The research team assigned participants to one of two groups, with 65 participants in each group: (1) the control group, the intense pulsed light (IPL) group, who received IPL treatment, and (2) the intervention group, the DPL group, who received black gold DPL super photon skin rejuvenation. Both groups received the treatments once a month for 6 months. Outcome Measures • At baseline and postintervention for both groups, the research team: (1) collected 5 ml of fasting venous blood from participants and measured serum concentrations of melatonin (MEL), vascular endothelial growth factor (VEGF) and endothelin-1 (ET- 1) using enzyme-linked immunosorbent assay (ELISA); (2) assessed the degree of reduction of facial pigmentation using the Visia skin test and each participant’s clinical results and calculated total efficacy; and (3) monitored and recorded adverse events. Results • Compared to the IPL group, the DPL group: (1) had greater symptom mitigation of the facial pigmented dermatosis, as evinced by significantly lower serum MEL (P = .001) and ET-1 (P = .020) concentrations and higher VEGF levels (P = .001); (2) for participants with freckles (P = .045), cafe-au-lait spots (P = .021), or post-acne hyperpigmentation (P = .029), had a significantly higher total efficacy; and (3) had a lower incidence of adverse events (P = .041). Conclusions • Black Gold DPL Super Photon Skin Rejuvenation offers a significantly higher safety profile and treatment efficacy for pigmented-skin diseases compared to IPL treatment. These promising results suggest potential for its use in clinical practice, but clinical adoption requires future trials. [ABSTRACT FROM AUTHOR]

Background: A shortage of images of pathology on diverse skin tones has been recognized for decades in health professions education. Identifying skin manifestations of disease depends on pattern recognition, which is difficult without visual examples. Lack of familiarity with visual diagnosis on skin of color can lead to delayed or missed diagnoses with increased morbidity and mortality. As the United States continues to increase in ethnic and racial diversity, addressing the disparity in health outcomes with education is vital. Case Presentation: At the Hackensack Meridian School of Medicine, students, librarians, and faculty came together to address this problem and develop a database of dermatological conditions in people with darker skin tones. A student group initiated a series of meetings with faculty to determine the best approach to address and enhance the representation of diversity in disease images within the curriculum. With the guidance of faculty and librarians, students performed a literature search and created a database of images of skin pathologies in people with darker skin tones. The database was disseminated to course directors and lecturers, and the noted disparities were corrected for the next cohort of students. The database provides an easily accessible resource for creating lecture slides. Conclusion: This project brought awareness of the need for inclusivity and generated a broad review of the curriculum to be more representative of all patient populations. Most importantly, our experience provides a roadmap for institutional change through student, librarian and faculty collaboration and cultivation of a culture of optimism and acceptance. [ABSTRACT FROM AUTHOR]

Introduction: Historically, patients with skin of color are underdiagnosed with psoriasis and underrepresented in clinical trials. In this study, we assess the efficacy and safety of risankizumab in patients with moderate-to-severe plaque psoriasis by race and ethnicity in the open label extension LIMMitless (NCT03047395). Methods: Patients received continuous treatment with 150 mg risankizumab through their initial trial and the open label extension. Patients self-identified their race and ethnicity. Efficacy was assessed using Psoriasis Area Severity Index (PASI) and Dermatology Life Quality Index (DLQI). Safety is reported by events/100 patient-years. Results: A total of 897 patients (race: 662 White, 196 Asian, 25 Black or African American, 14 Other; ethnicity: 98 Hispanic or Latino, 799 non-Hispanic or Latino) were included in this analysis. Compared to baseline, patients had a mean percent reduction in PASI between 94.6% (Asian) and 99.3% (Black or African American) and reported mean percent improvements in DLQI ranging from 87.1% (Asian and Black or African American) to 93.7% (Hispanic or Latino) at week 100. Conclusion: While the data presented here comprise a small retrospective descriptive analysis and cannot detect statistical differences, efficacy of risankizumab for the treatment of moderate-to-severe plaque psoriasis appears similar across the racial and ethnic groups studied and no new safety signals were detected. [ABSTRACT FROM AUTHOR]

Growth factor receptor-bound protein 2 (GRB2) is a negative regulator of insulin signaling and a positive regulator of angiogenesis. Its expression is increased in a mouse model of retinal neovascularization and in patients with type 2 diabetes mellitus (T2DM). This case–control study aimed to investigate the association between the rs9896052 polymorphism (A>C) upstream of GRB2 and proliferative diabetic retinopathy (PDR) in patients with T2DM from Southern Brazil, taking into consideration self-reported skin color (white or non-white) and the known duration of diabetes (<10 years or ≥10 years). Genotypes were determined by real-time PCR in 838 patients with T2DM (284 cases with PDR and 554 controls without DR). In the total study group and in the analysis stratified by skin color, the genotype and allele frequencies were similar between cases and controls. However, among patients with less than 10 years of diabetes, the C allele was more frequent in cases than in controls (63.3% versus 51.8%, p = 0.032), and the CC genotype was independently associated with an increased risk of PDR (adjusted OR = 2.82, 95% CI 1.17–6.75). In conclusion, our findings support the hypothesis that the rs9896052 polymorphism near GRB2 is associated with PDR in Brazilian patients with T2DM. [ABSTRACT FROM AUTHOR]

Background: A typical broiler production program includes three feeding phases: Pre-starter (from day 1 to 10), Starter (11-21 days), and Grower (from day 22 to slaughter). The program should allow the bird to express its genetic potential and respond to the nutritional challenges. Objective: To determine the effect of duration of the starter and grower phases on growth performance parameters (feed intake and feed conversion), mortality, skin pigmentation, and carcass yield in broiler chickens. Methods: A total of 1,500 Ross 308 AP male broilers were randomly assigned to five feeding programs with different duration, feed presentation (pellet vs. crumble), and anticoccidial (narasin + nicarbazin vs. salynomicin). The variables evaluated were growth performance (body weight, feed intake, and feed conversion), carcass (weight and yield), breast weight and yield, and skin pigmentation. Statistical evaluations were conducted on d 28 and 40 of age. Results: On d 28 of age, differences (p<0.05) were observed for body weight and feed conversion, but not for feed intake. T4 and T5 resulted in the best weight and feed conversion. Differences (p<0.05) were recorded on d 40 for body weight, with higher values in T4 and T5 compared to T1. Carcass weight differed between T1 and T4 (p<0.05), without difference for carcass or breast performance. The statistical analyses of carcass pigmentation showed an effect on redness ("a") and yellowness ("b") at d 28. Conclusions: Body weight and feed conversion of broilers from d 22 to 28 improve by extending the starter phase one week, using pelleted feed added with an ionophore anticoccidial. Skin pigmentation of broilers at slaughter is not affected by restricting pigment intake for one week. [ABSTRACT FROM AUTHOR]

Red pitaya fruit has become a source of natural colorant, because it is rich in betalains, a pigment that imparts a red‐purple color that interests the food and cosmetics industries. This fruit also possesses high nutritional value, with a range of bioactive compounds known to confer potential health benefits and prevent chronic diseases, such as diabetes, which makes it useful for use as pharmaceutical agents and dietary supplements. In order to improve its technological and biological effects, a concentration will be required. Thus, the microfiltration, followed by vacuum concentration, can be an interesting strategy for this purpose. This study aimed to explore tangential microfiltration to produce microfiltered material, which is an important step to obtain the microfiltered red‐purple pitaya concentrate. Therefore, physicochemical and chemical characterization (including 1H NMR analysis) and biological properties (toxicity and diabetes) of this concentrate were assessed, using adult zebrafish as a model. The results show that microfiltration was carried out efficiently, with an average consumption of 95.75 ± 3.13 and 74.12 ± 3.58 kW h m−3, varying according to the material used ("unpeeled pitaya pulp" or "pitaya pulp with peel," respectively). The in vivo tests indicated non‐toxicity and hypoglycemic effect of the concentrate, since the blood glucose levels were significantly lower in the zebrafish groups treated with this concentrate in comparison with that of control group. Thus, this study suggests the potential of microfiltered red‐purple pitaya concentrate as a promising multifunctional food‐derived colorant, exhibiting beneficial biological effects far beyond its attractive color. Practical Application: Hylocereus polyrhizus (F.A.C. Weber) Britton & Rose has attracted attention as a potential source of natural colorants because of its red‐purple skin and flesh color. In addition, this fruit has a range of bioactive compounds, which make it a valuable resource for providing potential health benefits and preventing chronic diseases such as diabetes. In this paper, the microfiltered red‐purple pitaya concentrate showed beneficial biological effects far beyond its attractive color. Thus, this product can be considered a promising multifunctional food‐derived colorant to use in the food, pharmaceutical, or cosmetics industries. [ABSTRACT FROM AUTHOR]

We investigated the phenolic compound profile, antioxidant capacity, rooting of cutting and fruit mineral concentration on 15-year-old trees of four Iranian figs (Ficus carica cvs. "Siyah", "Kashki", "Shahanjir" and "Sabz") planted under rain-fed conditions with different fruit skin color, as well as the correlation between these traits. The range of TSS and antioxidant capacity of fruit (without significant differences) was 75.3–76.7°Brix and 87.9–90.3 DPPHsc %, respectively. "Kashki" had the highest total phenolic (TP) (mg GAE/100 g dw) in both the fruit (1964) and the stem bark (1702) and "Sabz" had the lowest flavonoid content (µg CE mg−1 dw) in the fruit (652.3), leaf (1274.5), and stem bark (1501.9). Although the rooting percentage of cuttings was similar in "Siyah", "Shahanjir", and "Sabz", the lowest rooting percentage (62.7%) and the lowest polyphenol oxidase enzyme (PPO) activity (42.5 U.mL−1) were in "Kashki". Rooting of the cuttings had a direct correlation with PPO activity and catechin and a negative correlation with the TP, vanillin and trans-ferulic acid concentration in cutting bark. These results showed that the fresh cultivar such as "Shahanjir" with outstanding characteristics, such as high potassium and antioxidant content of fruits and good rooting of the cuttings (97.2%) can be recommended for the development programs of light-colored fresh figs. On the other hand, there were two cultivars, "Siyah" and "Kashki" with dark fruit color; due to their content of TP, total flavonoid, quercetin, trans-ferulic acid and high calcium content in the fruit, these should also be considered. [ABSTRACT FROM AUTHOR]

Objectives: The aim of this study was to analyze how farmworkers are represented in stock photos available in commercial libraries for use in agricultural health and safety education materials. Methods: We searched for images in five commercial stock photo libraries using the terms "farmworkers" and "women farmworkers" in April 2022. We used quantitative content analysis. We coded each image for containing a visible face, age, gender, skin tone, work activity, mechanization, presence of hazards, technology use, and protective equipment/clothing after establishing inter-coder reliability. We used descriptive statistics to characterize the available stock photos. Results: We identified stock photos (n = 127) in three databases (Adobe Stock Images, Canva, and Getty Images). Two databases (Microsoft Office Image Library and Pixabay) had no relevant images at the time of the search. Only half of the photos analyzed contained a face. Light skin tones and young or middle-aged adults were more common. A majority of farming activities represented in photos were manual tasks (e.g., harvesting) with few depictions of equipment, hazards, and protective equipment/clothing. Conclusions: Health and safety professionals tasked with developing materials for education in agricultural settings face a severe lack of imagery pertinent to the realistic conditions of farmworkers in the United States. In the databases we reviewed, photos displaying human faces, photos showing a range of skin tones and ages, and photos displaying an array of different farm hazards are likely not sufficient for material development. Health and safety professionals may benefit from sharing photos from their own work with other professionals and allocating resources for professional photo shoots in their material development projects. [ABSTRACT FROM AUTHOR]

Melanin plays an important role in protecting skin cells from harmful UV radiation, but its uneven pigmentation in the skin sometimes demands cosmetic resolution. As a safe and effective way of evening the skin tone, enzymatic decolorization of melanin at the stratum corneum has been proposed. In this regard, the use of lignin peroxidase, in the presence of hydrogen peroxide and veratryl alcohol, an electron mediator, has been explored. Here, we first show that versatile peroxidase (VP) and aryl alcohol oxidase (AAO) purified from the Pleurotus eryngii liquid culture can be used to decolorize melanin without exogenous hydrogen peroxide. This resembles the oxidative degradation pathway of lignin in nature; AAO generates hydrogen peroxide from veratryl alcohol, and VP utilizes generated hydrogen peroxide while using veratryl alcohol as a mediator. We further explored the use of POX_Pe, the crude peroxidase preparation of the Pleurotus eryngii liquid culture, for melanin decolorization because of its better stability. Using POX_Pe and veratryl alcohol, over 60 % of melanin decolorization was obtained in 1 h in the absence of exogenous hydrogen peroxide addition. Furthermore, POX_Pe could decolorize melanin in a 3D human pigmented epidermis model, demonstrating its possible applications in cosmetics. [Display omitted] • Enzymatic decolorization of the skin pigment, melanin, is drawing great attention. • Lignin degrading pathway of Pleurotus eryngii was re-purposed to decolorize melanin. • The system consists of versatile peroxidase and aryl alcohol oxidase. • The crude preparation of the enzymes showed benefits over purified enzymes. • High degree of melanin decolorization in the absence of toxic H 2 O 2 is described. [ABSTRACT FROM AUTHOR]

Farming of red tilapia is one promising direction in aquaculture. The objective of this study was to investigate the impact of long-day photoperiod on the growth performance, reproductive parameters, maturity, sex ratio, β-carotene content, and skin coloration of red tilapia. Early life larvae were allocated into three treatment groups in triplicates: T1 = control group (12L:12D), T2 = long-day group (18L:6D), and T3 = continuous illumination group (24L:0D) for 90 days. By the end of the experiment, gonadosomatic index (GSI), relative fecundity, steroid hormones, maturity stages, sex ratio, and ovarian and testicular histology were examined; also, growth performance, survival rate, skin color, and total β-carotene content were measured. The results indicated that GSI% and serum testosterone (T) in T3 group significantly increased with greater amount of spermatozoa of male fish. Also, growth parameters and HSI% in female fish displayed significantly increased for T3 group. Females in group T2 showed significant elevation in GSI%, relative fecundity, and estradiol (E2) with higher number of mature stage. Continuous light group (T3) showed shifted male sex ratio, while female percentage was higher in T2 group. The total β-carotene content of T3 group showed significant elevation with less number of black spots. This study demonstrated that continuous light manipulation during red tilapia early life could stimulate the growth and enhance coloration by reducing black spots that significantly affects economic profitability. Long-day application was effective in female reproductive performance and maturity. This study also served as an important reference for red tilapia aquaculture. [ABSTRACT FROM AUTHOR]

Pressure ulcer is considered a common and costly problem in the care of patients. Prevention and management of pressure ulcer are very important due to the high cost of treatment and the adverse consequences of pressure ulcer. This study aimed to evaluate the effect of implementing “aSSKINg” model in reducing pressure ulcer risk. This study used a before- and afterintervention quasi-experimental design. This study was performed on 60 patients who were not randomly selected and assigned in to control and study group. The data collection tool was a 3-part sheet (Braden scale, skin health assessment, and Pressure ulcer assessment). The incidence of pressure ulcer was 19 (60.0%) in the control group versus 9 (30.0%) in the study group with statistical significant differences. The most common site of pressure ulcer was coccyx (6 [31.6%]) in the control group and Heel (3 [33.3%]) in the study group. The application of “aSSKINg” model in the patients with pressure ulcers is effective in reducing the incidence and severity of pressure ulcers. [ABSTRACT FROM AUTHOR]

An extensive literature has focused on the association between human, social, and economic capital and better immigrant economic attainment, and how these characteristics contribute to stratification among members of the same group. However, few studies have explored how racialization processes contribute to these within-group differences. We examine the role of intragroup differences in skin tone in stratifying outcomes among Mexican immigrants in the early twentieth century. We create a new dataset of 1910–1940 Mexican border-crossing records that we then link to the U.S. 1940 census. We use characteristics at entry to predict income in 1940 and find that—in line with dominant assimilation theories—standard measures of capital are associated with within-group attainment differences. However, we also find skin tone to be a source of within-group stratification: being perceived as having darker skin is associated with lower subsequent economic attainment than being perceived as having lighter skin. Furthermore, whereas human and social capital transcended context to allow migrants to transfer those skills anywhere, the effect of skin tone was significant only in Texas and not in other major receiving places like California. We argue that although standard measures of assimilation typically predict later outcomes, the stratifying effect of skin tone has long been a feature of Mexican immigration. [ABSTRACT FROM AUTHOR]

Understanding the immune response generated by SARS‐CoV‐2 is critical for assessing efficient therapeutic protocols and gaining insights into the durability of protective immunity. The current work was aimed at studying the specific humoral responses against SARS‐CoV‐2 in Cuban COVID‐19 convalescents. We developed suitable tools and methods based on ELISA methodology, for supporting this evaluation. Here, we describe the development of an ELISA for the quantification of anti‐RBD IgG titers in a large number of samples and a similar test in the presence of NH4SCN as chaotropic agent for estimating the RBD specific antibody avidity. Additionally, a simple and rapid ELISA based on antibody‐mediated blockage of the binding RBD‐ACE2 was implemented for detecting, as a surrogate of conventional test, the levels of anti‐RBD inhibitory antibodies in convalescent sera. In a cohort of 273 unvaccinated convalescents, we identified higher anti‐RBD IgG titer (1 : 1,330, p < 0.0001) and higher levels of inhibitory antibodies blocking RBD‐ACE2 binding (1 : 216, p < 0.05) among those who had recovered from severe illness. Our results suggest that disease severity, and not demographic features such as age, sex, and skin color, is the main determinant of the magnitude and neutralizing ability of the anti‐RBD antibody response. An additional paired longitudinal assessment in 14 symptomatic convalescents revealed a decline in the antiviral antibody response and the persistence of neutralizing antibodies for at least 4 months after the onset of symptoms. Overall, SARS‐CoV‐2 infection elicits different levels of antibody response according to disease severity that declines over time and can be monitored using our homemade serological assays. [ABSTRACT FROM AUTHOR]

ABSTRACT Background Methods Results Conclusion Monobenzyl ether hydroquinone (MEBHQ) is a cream that promotes the spread and evenness of skin patches in vitiligo. Our aim was to investigate the oxidative and inflammatory effects of this cream on vitiligo patients consuming MEBHQ.A case–control study was conducted with three groups of 30 people from the control group, vitiligo patients before and after treatment. The percentage of vitiligo spots was determined by a specialist doctor. The levels of biochemical factors, oxidative stress profile and inflammatory factors were measured by enzymatic, colorimetric and ELISA methods, respectively.Vitiligo patients showed a high level of inflammation and oxidative stress compared to healthy people. Although after 3 months of using MBEHQ cream, the percentage of skin spots in vitiligo patients increased from an average of 63%–91% and the skin color became almost uniform, but it still increased the level of oxidative stress and inflammation in these patients. Although the level of oxidative stress increased significantly in these patients, there was no significant increase in the level of malondialdehyde. The lack of significant differences in the levels of biochemical factors between healthy people and vitiligo patients before and after using the treatment shows the absence of side effects.The use of MBEHQ increased the size of skin spots and uneven skin color in vitiligo patients. Although MBEHQ did not show side effects such as diabetes, liver and kidney diseases, it increased the levels of oxidative stress and inflammatory cytokines, which needs further study. [ABSTRACT FROM AUTHOR]

Atopic dermatitis (AD) is a prevalent chronic inflammatory skin disease with a substantial global burden and negative impact on quality of life. While genetics and pathophysiology are key to understanding AD, emerging evidence indicates that social and structural determinants of health (SDOH and StDOH) strongly influence the condition's onset, severity, and outcomes. SDOH, such as economic stability, education quality and access, healthcare quality and access, neighborhood environment, and social/community context, shape individual risk and disease experience. StDOH, including government processes, economic policies, social/public policies, and cultural/societal values, further act as upstream forces that directly and indirectly influence AD outcomes. In this review, we synthesize current knowledge on the impacts of SDOH and StDOH on AD incidence, severity, and disparities. Embracing a biopsychosocial model is crucial to elucidate the etiology, epidemiology, and optimal management of AD. Future research should adopt a holistic approach, moving beyond a purely biological perspective to consider the intricate interplay of social and structural determinants in understanding and managing AD. [ABSTRACT FROM AUTHOR]

Background: Melanin in the black-bone chicken's body is considered the material basis for its medicinal effects and is an economically important trait. Therefore, improving the melanin content is a crucial focus in the breeding process of black-bone chickens. Luning chickens are black-bone chickens, with black beaks, skin, and meat. To investigate the genetic diversity and molecular mechanisms of melanin deposition in Luning chickens, we conducted whole-genome resequencing to analyze their breeding history and identify candidate genes influencing their black phenotype, along with transcriptome sequencing of dorsal skin tissues of male Luning chickens. Results: Population structure analysis revealed that Luning chickens tend to cluster independently and are closely related to Tibetan chickens. Runs of homozygosity analysis suggested potential inbreeding in the Luning chicken and Tibetan chicken population. By combining genetic differentiation index (Fst) and nucleotide diversity (θπ) ratios, we pinpointed selected regions associated with melanin deposition. Gene annotation identified 540 genes with the highest Fst value in LOC101750371 and LOC121108313, located on the 68.24–68.58 Mb interval of chromosome Z. Combining genomic and transcriptomic data, we identified ATP5E, EDN3, and LOC101750371 as candidate genes influencing skin color traits in black-bone chickens. Conclusions: This study characterized the evolutionary history of Luning chickens and preliminarily excavated candidate genes influencing the genetic mechanism of pigmentation in black-bone chickens, providing valuable insights for the study of animal melanin deposition. [ABSTRACT FROM AUTHOR]

Colorism is an important determiner of life outcomes among Black people. Yet, we know little about how it impacts socioeconomic conditions outside the United States. This study expands the existing literature on intraracial stratification by using Jamaica as a case example. Drawing on data from the 2010 and 2023 waves of the AmericasBarometer social survey, I examine the impacts of colorism on two key indicators of socioeconomic status. Although colorism is often regulated as a “public secret,” findings reveal that it is a significant determinant of socioeconomic outcomes. And while the penalty of skin color has lessened in 2023 for tertiary education and household amenities, it remains for incomplete primary education. Findings thus: (1) provide empirical evidence of the continued significance of colorism within Jamaica, (2) expand the extant literature, and (3) highlight the need for the consideration of “racial” inequality in fostering equity, even in majority African-descended nations. [ABSTRACT FROM AUTHOR]

Automatic skin lesion subtyping is a crucial step for diagnosing and treating skin cancer and acts as a first level diagnostic aid for medical experts. Although, in general, deep learning is very effective in image processing tasks, there are notable areas of the processing pipeline in the dermoscopic image regime that can benefit from refinement. Our work identifies two such areas for improvement. First, most benchmark dermoscopic datasets for skin cancers and lesions are highly imbalanced due to the relative rarity and commonality in the occurrence of specific lesion types. Deep learning methods tend to exhibit biased performance in favor of the majority classes with such datasets, leading to poor generalization. Second, dermoscopic images can be associated with irrelevant information in the form of skin color, hair, veins, etc.; hence, limiting the information available to a neural network by retaining only relevant portions of an input image has been successful in prompting the network towards learning task-relevant features and thereby improving its performance. Hence, this research work augments the skin lesion characterization pipeline in the following ways. First, it balances the dataset to overcome sample size biases. Two balancing methods, synthetic minority oversampling TEchnique (SMOTE) and Reweighting, are applied, compared, and analyzed. Second, a lesion segmentation stage is introduced before classification, in addition to a preprocessing stage, to retain only the region of interest. A baseline segmentation approach based on Bi-Directional ConvLSTM U-Net is improved using conditional adversarial training for enhanced segmentation performance. Finally, the classification stage is implemented using EfficientNets, where the B2 variant is used to benchmark and choose between the balancing and segmentation techniques, and the architecture is then scaled through to B7 to analyze the performance boost in lesion classification. From these experiments, we find that the pipeline that balances using SMOTE and uses the adversarially trained segmentation network achieves the best baseline performance of 91% classification accuracy with EfficientNet B2. Based on the scaling experiments, we find that optimal performance is reached with the B6 architecture that classifies with a 97% accuracy. Furthermore, the proposed pipeline for lesion characterization outperforms the state of the art performance on the ISIC dataset. [ABSTRACT FROM AUTHOR]

The impact of premade beef patty (BBP) with red onion skin powder (OSP) at 0, 1, 2, and 3% levels on color, lipid, and protein oxidative stability, and infection degree of microorganisms during cold storage was investigated. The objective was to determine the effect of color by L*, a*, b*, and the content of MetMb. The inhibitory effect of OSP on the oxidation of lipid and protein was studied based on TBARS and the carbonyl content of protein in samples at different storage times. TVB-N content was used to characterize the degree of infection of microorganisms and their effect on meat quality. The results showed that the addition of OSP reduced the pH, L *, a*, and b * values of BBP, and improved the hardness, springiness, gumminess, and cohesiveness of BBP, but had no significant effect on the chewiness of BBP (p > 0.05). After 12 days of storage, the carbonyl group and TBARS content in the BBP supplemented with 3%OSP was significantly lower than that in the control group (p < 0.05). Furthermore, the addition of OSP significantly inhibited the TVB-N increase during beef patty storage. These results indicated that OSP has a good research prospect as a natural antioxidant or preservative. [ABSTRACT FROM AUTHOR]

BACKGROUND As the racial/ethnic diversity of the US population grows, it is imperative for dermatologists to recognize the nuances in the aesthetic treatment of diverse populations. OBJECTIVE This comprehensive review explores the safety and efficacy of botulinum toxin A (BTX-A) in skin of color (SOC) populations and highlights variations in aging patterns, skin properties, and aesthetic concerns in SOC populations. MATERIALS AND METHODS A review of PubMed/MEDLINE databases from 2004 to 2024 was performed using combinations of the terms botulinum toxin, SOC, Fitzpatrick, race/ethnicity, and Asian, Latin American, Caribbean, Middle Eastern, African, and Pacific countries. RESULTS Twenty-three articles examining the use of BTX-A in SOC populations were identified. Twelve studies were from East Asia, 5 from the United States and/or Canada, 3 from South Asia/Southeast Asia, 2 from South America, and 1 from the Middle East. Available data suggest that BTX-A is efficacious and well tolerated in SOC populations. CONCLUSION Increased SOC representation in clinical trials may guide the development of tailored treatment approaches to optimize aesthetic outcomes for patients with SOC. A comprehensive knowledge of the variations in aging patterns, skin properties, and aesthetic concerns across SOC populations is essential for providing culturally sensitive cosmetic dermatologic care for diverse populations. [ABSTRACT FROM AUTHOR]

Background: Skin conditions are common in patients on maintenance hemodialysis and those with pancreatitis. However, there is a lack of research on dermatological issues in patients who have both hemodialysis and pancreatitis concurrently. Case presentation: A 62-year-old male patient with a 4-year history of maintenance hemodialysis (MHD) presented with pain and was diagnosed with acute pancreatitis and gallbladder stones. Markedly elevated blood amylase, creatine kinase, and myoglobin were noted, alongside a purplish-red skin discoloration. Treatment included inhibition of digestive fluid secretion, anti-infection measures, blood purification, fasting, rehydration, and symptomatic care. Notably, continuous renal replacement therapy (CRRT) combined with hemoperfusion (HP) was employed. The patient's dialysis effluent initially appeared red. Upon examination of the patient's peripheral blood smear, red blood cell debris was not observed. The dialysis effluent (on Day 0) was analyzed, revealing no hemoglobin (0 g/L) but an elevated myoglobin concentration of 80.4 U/L. After the therapeutic intervention, the indicators, including the blood amylase, C-reactive protein, total bilirubin, creatine kinase, and myoglobin were improved. The patient experienced resolution of sternal and upper abdominal pain within two days. After four consecutive days of CRRT and HP treatment, the skin color returned to normal, alongside improved clarity of the dialysis effluent. Subsequently, the patient's method of blood purification was reverted to conventional hemodialysis. On the eighth day of hospitalization, the patient resumed normal diet and was discharged. Conclusions: In the case of the current patient with acute pancreatitis undergoing MHD, it is noteworthy to report the observation of a unique purplish-red skin discoloration. This phenomenon may be attributable to inflammation resulting from acute pancreatitis, and the retention of myoglobin within the body. [ABSTRACT FROM AUTHOR]

A new persimmon (Diospyros kaki L. Thunb.) cultivar ‘Yeonsu’ was derived from a cross between ‘Ro-19’ and ‘Taishu’ in 2009 and finally selected in 2016. The average maturing date was October 20th in Yeoung-am province. ‘Yeonsu’ has a medium average fruit size (235 g) and high soluble solids (17.0 °Bx). The flesh taste was good with soft texture and juice. The fruit shape was very wide ovule when viewed from the side and the fruit's skin color was yellow-orange. Physiological disorders, including fruit cracking or skin fine cracking rarely occurred, but intense sunlight may cause pericarp blackening (Registration No. 8918). [ABSTRACT FROM AUTHOR]

This biology lesson uses the science of central dogma to "critique and question the politics of representation that systematically devalue[s] Blackness" (hooks, 131). Students' understanding of protein synthesis is extended in discussing melanin and its significance to protecting the body from harmful radiation from the sun. Through data analysis, students are able to explain the function of melanin and the evolutionary benefits to various skin colors. In addition to a discussion on the biology of skin color and the gene responsible (mc1r), students engage in a lesson that is culturally relevant/responsive. Through challenging racist ideologies and understanding the biology of skin color, students are the center of discussions on racism and the impacts of the social construction of race. The title "Black is Beautiful" is inspired by Jamaican reggae artist Chronixx and the work of Michelle Grace Williams, "They Never Told Us Black is Beautiful: Fostering Black Joy and Pro-Blackness Pedagogies in Early Childhood Classrooms." Through artivism, students challenge eurocentric ideologies on beauty and genius through literary or visual arts. In addition to being an act of activism, artwork will also demonstrate an understanding of melanin's role. [ABSTRACT FROM AUTHOR]