Search

In June 2019, Angelica acutiloba plants showing virus-like symptoms such as chlorotic local lesion and mosaic on the leaves were found in a greenhouse in Nonsan, South Korea. To identify the causal virus, we collected 6 symptomatic A. acutiloba leaf samples and performed reverse transcription polymerase chain reaction (RT-PCR) analysis using specific detection primers for three reported viruses including tomato spotted wilt virus (TSWV). RT-PCR results showed that five symptomatic samples were positive for TSWV. Mechanical sap inoculation of one of the collected TSWV isolate (TSWV-NS-AG28) induced yellowing, chlorosis and mosaic symptoms in A. acutiloba and necrotic local lesions and mosaic in Solanaceae species. Phylogenetic analysis based on the complete genome sequences showed that TSWV-NS-AG28 had a maximum nucleotide identity with TSWV-NS-BB20 isolated from butterbur in Nonsan, South Korea. To our knowledge, this is the first report of TSWV infection in A. acutiloba.

The Smart City Council defines a smart city as one that has simple, easy, and practical digital technology embedded across all city functions. Though cities and communities around the world have elaborated a variety of climate actions and plans, their development and implementation often follow a project-based approach with no network connections between projects. Climate smart and wise cities extends the concept and approach of smart cities to include the diverse dimensions of climate actions in a holistic manner. This chapter describes how climate smart and wise cities can support climate actions with a variant of the New Urbanism called the climate smart and wise urbanism., which is intended to be more climate-oriented and nature-based. The chapter argues that our task now is to mainstream climate city planning into urban planning and development policy. The contents of this chapter include new issues and solutions for climate emergency which need a new tenet of planning, a conceptual framework, and key components of the planning system for integrated climate smart and wise cities, planning procedure, and planning methodology. The models include holistic planning models, sub-system planning models, and sectoral dynamic platform models with the use of automation and Internet control system technology development. © 2022, The Author(s), under exclusive license to Springer Nature Switzerland AG.

The global contribution from buildings toward energy consumption, both residential and commercial, has steadily increased reaching features between 20 and 40% in developing countries and has exceeded the other major sectors: industrial and transportation. In European countries, buildings account for 40% of total energy consumption. Growth in population, increasing demand for building services, and comfort levels, together with the rise in time spent inside buildings due to COVID-19 pandemic, assure the upward trend in energy demand will continue in the future. Market mechanism in the building sector from an urban perspective is essential as reducing building sector emissions will have to be a critical part of any effective global effort to reduce climate risks. This chapter explores how to build the market mechanism in the building sector from an urban perspective. The first section of this chapter overviews the issues when combining different market mechanisms within building sector and energy market-. The second section describes a framework for integrating renewable energy sources, solar water heating, lighting and cooling, centralized air conditioning, and the use of energy-efficient equipment at different component and spatial levels such as each component, a whole building and at a site or district level. The third section covers the methodologies for the market mechanisms in the building sector, while the fourth section addresses a testbed approach for a new modality and procedure of market mechanism in the building sector as a guide for a Blockchain-based community smart and resource wise market mechanism. The fifth and final section addresses the cases at residential community, site, and a whole building levels. © 2022, The Author(s), under exclusive license to Springer Nature Switzerland AG.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

Study question Could the reduction of RPL-protease A be involved in the dysfunctional trophoblast for resulting in recurrent pregnancy loss (RPL). Summary answer Low expression of RPL-protease A may result in RPL and low serum RPL-protease A level may be a potential biomarker for predicting RPL. What is known already The RPL-protease A is expressed and secreted by placenta. The RPL-protease A is involved in the pathogenesis of pre-eclampsia, and the serum RPL-protease A level is higher in the patients with pre-eclampsia than that of normal groups. In our previous study, we identified that the RPL-protease A mRNA level was lower in the villi of patients with RPL than that of normal groups. Study design, size, duration Using the CRISPR/Cas9 system, the RPL-protease A gene knockout BeWo cell (BeWo KO) line was established, and the wild type (BeWo WT) and BeWo KO cells were applied to investigate the roles of RPL-protease A in trophoblasts. The human serum RPL-protease A levels were investigated by Western blot analysis and ELISA kit. Participants/materials, setting, methods The cell-cell fusion, cell counting analysis, invasion and scratch wound assays, cell cycle analysis, and immunocytochemical analysis were used to investigate cellular functions of RPL-protease A in trophoblast. The sera were obtained from 32 normal pregnant women and 60 women with RPL. The Western blot analysis and ELISA were used for detection of serum RPL-protease A levels. Main results and the role of chance The β-hCG was detected in fused BeWo WT cells, while the BeWo KO cells cannot fuse and did not express the β-hCG. The ability of invasion was decreased, but the capacity of migration and proliferation was higher in BeWo KO cells than BeWo WT cells. Cell fusion related factor (β-hCG), and cell invasion related factors (MMP–2 and MMP–9) were highly expressed in BeWo WT cells, and cell related factor (FAK), and cell proliferation related factors (ERK, p38, JNK, MKK3, MKK6, Raf, and Ras) were highly expressed in BeWo KO cells. The Western blot analysis and ELISA indicate that the serum RPL-protease A level was decreased in patients with RPL compared to that of normal groups. Limitations, reasons for caution The results of this study have the limitation of RPL-protease A functions in vitro. Wider implications of the findings: The cellular functions of RPL-protease A in trophoblasts were investigated to explain the pathogenesis of RPL, and low serum RPL-protease A level can be used for a potential biomarker predicting RPL. Trial registration number Not applicable

Study question Is vapor cryopreserved LN2 storage beneficial for clinical outcomes of vitrified human embryos that are frozen compared to vitrified human embryos having direct contact with LN2. Summary answer There are no significant differences compared to clinical outcomes of human embryos stored in LN2 vapor and direct store in LN2. What is known already There has been concerned about potential cross-contamination and biohazard issues of embryos for long term storage using direct LN2. This study aimed to compare clinical outcomes of human embryos transfer between vapor phase and liquid LN2. Study design, size, duration The embryo has undergone vitrification for long term storage with vapor or direct contact in LN2. After the thawing of the embryo, we checked on the survival rates. We transferred only one or two embryos per patient and kept analyzing the implantation and pregnancy rates Participants/materials, setting, methods This retrospective study was carried out from January 2018 to December 2019 with 3272cycles 4713embryos; vitrified for long term storage in vapor phase or direct contact with LN2. We compared the clinical outcomes of frozen embryo transfer cycles using vitrified for long term storage in vapor phase and direct contact with LN2. Clinical outcomes monitored were embryo survival, subsequent implantation and pregnancy after single or double embryo transfer Main results and the role of chance A total of 4713 fertilized human embryos are vitrified and then stored in LN2 vapor (n = 2520 cycles) or direct contact LN2 (n = 752 cycles). The study showed that the blastocyst stored in vapor able to retain full development. Survival was 97.8% (vapor) and 97.6% (direct contact LN2), and the vapor storage of human embryos had no significant difference in survival rates after a long term storage. For single blastocyst transfer, pregnancy and implantation rates were 51.5%, 52.4% in vapor, 54.6%, 54.9% in direct LN2; respectively (p=NS). In double blastocyst transfer, the pregnancy and implantation rates were 61.8%, 42.0% in vapor and 64.7%, 44.5% in direct LN2; respectively (p=NS). There were also no significant differences between two groups. Limitations, reasons for caution The study showed that the blastocyst stored in vapor can retain full development. A vapor storage system thus is safe and effective for long term vapor storage of vitrified human embryos.Within the limits of this study, there was no detection of an adverse effect of vapor storage. Wider implications of the findings: Vapor storage systems thus represent a useful alternative for safe and effective long-term storage of vitrified human embryos that can avoid cross contamination chances from having direct contact with LN2. Trial registration number Not applicable

Dual-channel thin-film transistors (TFTs) show excellent effective mobility ( μ eff ) and reliability, including negative-bias-illumination stability. To enhance the performance of these devices, post-thermal annealing in air is performed for 2 h at the low temperature of 250°C. To investigate the effects of low-temperature thermal annealing, indium–zinc-oxide/gallium–indium–zinc-oxide (IZO/IGZO) dual-channel TFTs with various IZO thicknesses are fabricated and examined. The observed parameters are μ eff , saturation mobility ( μ sat ), subthreshold slope (SS), and threshold voltage ( V TH ). The interface quality may be improved by low-temperature thermal annealing, which was confirmed by the improvement in μ eff and SS . However, these performance enhancements are intensively observed only in the channels with an IZO thickness below 10 nm. When the IZO thickness becomes 10 nm or more, the improvement in μ eff due to low-temperature thermal annealing hardly occurs. This is because μ eff is greatly influenced by the interface quality due to Coulomb scattering when the IZO thickness is

Colorectal cancer is presently the third most commonly diagnosed cancer in the United States. In this study, we identified molecular differences between hepatic and non-hepatic metastases in colorectal cancer and evaluated their prognostic significance.We downloaded primary data from the NCBI Gene Expression Omnibus (GSE6988, GSE62321, GSE50760, and GSE28722). To identify the molecular differences, we used the Significance Analysis of Microarray method. We selected nine prognostic genes (SYTL2, PTPLAD1, CDS1, RNF138, PIGR, WDR78, MYO7B, TSPAN3, and ATP5F1) with hepatic metastasis prediction score in colorectal cancer (hereafter referred to as LASSO Score). We confirmed the prognostic significance of the LASSO Score by using Kaplan-Meier survival analysis, multivariate analysis, the time-dependent area under the curve (AUC) of Uno's C-index, and the AUC of the receiver operating characteristic curve at 1-5 years.Survival analysis revealed that a high LASSO Score is associated with a poor prognosis in colorectal cancer patients with hepatic metastases (p = 0). Analysis of C-indices and AUC values from the receiver operating characteristic curve further supported this prediction by the LASSO Score. Multivariate analysis confirmed the prognostic significance of the LASSO Score (p = 1.13e-06).This study reveals the biological mechanisms underlying hepatic metastases in colorectal cancer and will help in developing targeted therapies for colorectal cancer.

BackgroundProtein phosphatase Mg2+/Mn2+-dependent 1A (PPM1A) is a phosphatase which regulates various intracellular cell signaling pathways including inflammation. We previously suggested that the inflammatory signal decreased the PPM1A protein level in macrophage and this reduction had correlation with the chronic inflammatory bone disease, implying the possible role of PPM1A in inflammatory responses of macrophage.ObjectivesIn this study, we aim to elucidate the potential role of PPM1A in macrophage to regulate inflammatory response during the disease progression of systemic lupus erythematosus.MethodsWe generated macrophage-specific conditional gene-knockout (PPM1Afl/fl;LysM-Cre) mice and developed a lupus-like disease with immune complex glomerulonephritis in these PPM1Afl/fl;LysM-Cre mice by intraperitoneal pristane injection. Mouse serum was collected every 4 weeks after pristane injection. Serum anti-dsDNA IgG, anti-ssDNA IgG, interleukin-17 (IL-17) and tumor necrosis factor-α (TNF-α) was quantified by ELISA. After 41 weeks from pristane injection, histological changes in the kidney, spleen, and lung tissues were observed. To analyze M1/M2 polarization in vitro, LysM-Cre and PPM1Afl/fl;LysM-Cre mouse bone marrow-derived macrophages were cultured with lipopolysaccharide (LPS)/interferon-γ (IFN-γ) or interleukin-4 (IL-4) to check M1 or M2 related genes.ResultsWe found that macrophages of PPM1Afl/fl;LysM-Cre mice displayed different gene expression with LPS stimulation especially in M1/M2 related genes through the RNA-seq analysis and showed a decrease in both M1 and M2 polarization induced by LPS/IFN-γ or IL-4 stimulation. Notably, we found that PPM1Afl/fl;LysM-Cre mice with pristane injection showed a significant increase of anti-ssDNA IgG compared to LysM-Cre mice. PPM1Afl/fl;LysM-Cre mice showed severe lupus-like phenotypes such as global glomerular enlargement indicated by endocapillary proliferation and glomerular cellularity in kidney and lung inflammation accompanied by fibrosis, compared to LysM-Cre mouse by pristane injection. Together, serum IL-17 and TNF-α, which are proinflammatory cytokines, were increased in PPM1Afl/fl;LysM-Cre after pristane injection. These results indicate that PPM1A depletion in macrophage deteriorates inflammation and contributes to the tissue damage in a lupus-like disease.ConclusionOur findings suggest that the deficiency of PPM1A in macrophages impairs M1/M2 macrophage polarization leading to an immune imbalance in lupus-like disease model, providing a potential link between the loss of function of PPM1A in macrophages and its molecular target for treatment of systemic lupus erythematosus.References[1]Kwon, O. C., Choi, B., Lee, E. J., Park, J. E., Lee, E. J., Kim, E. Y., Kim, S. M., Shin, M. K., Kim, T. H., Hong, S., Lee, C. K., Yoo, B., Robinson, W. H., Kim, Y. G., & Chang, E. J. (2020). Negative Regulation of Osteoclast Commitment by Intracellular Protein Phosphatase Magnesium-Dependent 1A. Arthritis & rheumatology (Hoboken, N.J.), 72(5), 750–760. https://doi.org/10.1002/art.41180[2]Smith, S. R., Schaaf, K., Rajabalee, N., Wagner, F., Duverger, A., Kutsch, O., & Sun, J. (2018). The phosphatase PPM1A controls monocyte-to-macrophage differentiation. Scientific reports, 8(1), 902. https://doi.org/10.1038/s41598-017-18832-7Disclosure of InterestsNone declared.

Tospovirus transmitted by thrips can cause serious diseases in many economically important plants. Based on molecular and biological assays, a virus infecting boxthorn plants in Korea was identified as tomato spotted wilt virus (TSWV). To the best of our knowledge, this is the first report of TSWV in L. chinense.

Low impact development (LID) technologies mimic the natural water cycle through the physico-chemical and biological interactions of plants, filter media and soil, and microorganisms, thereby reducing the release of pollutants. In LID facilities, plants carry out photosynthesis, facilitate microbial growth, and uptake pollutants contained in stormwater runoff. However, de-icers (CaCl2) used to melt snow during winter slow the growth of plants and even increase plant mortality. In addition, de-icers change the soil structure, causing changes in soil content and affecting the growth of plants and microorganisms. Therefore, this study examined the effects of CaCl2 on the resistance of plants, the removal efficiency of non-point source pollutants, and water circulation. The mortality rate of the tree and shrubs caused by CaCl2 was found to be in the order of Rhododendron indicum > Spiraea prunifolia var. simpliciflora > Metasequoia glyptostroboides. For herbaceous plants, mortality rate was in the order of Pratia pedunculata > Aquilegia japonica > Tagetes erecta > Sedum makinoi aurea > Hosta longipes > Dianthus chinensis > Acorus gramineus > Liriope platyphylla. In addition, it was found that the amount of chlorophyll decreases with high concentrations of CaCl2. The findings of this research will be useful for plant selection considering CaCl2 concentrations applied to paved areas during the winter.

Brugmansia suaveolens, known as angel's trumpet, is a perennial ornamental shrub in the Solanaceae with large fragrant flowers. In June 2018, a leaf sample of B. suaveolens that showed virus-like symptoms including chlorotic spots, yellowing and mottle on leaves was collected from a greenhouse in Seongnam, South Korea for disease diagnosis (Supplementary Figure S1a, b). Disease incidence in the greenhouse was greater than 80% for about 2,000 B. suaveolens plants. To identify a causal virus, transmission electron microscopy (TEM) was used to analyze symptomatic leaf samples using leaf dips and thin section methods. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Supplementary Figure S1c, d). To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for three potyviruses that infect Brugmansia spp.: Colombian datura virus (CDV), Brugmansia mosaic virus (BruMV), and Brugmansia suaveolens mottle virus (BsMoV) (Lucinda et al, 2008; Park et al., 2014; Verma et al., 2014). The sample was positive only for CDV. CDV is transmitted by aphids in a nonpersistent manner and mechanical inoculation and can infect plants in the Solanaceae family including tomato and tobacco (Kahn and Bartels 1968; Schubert et al. 2006; Verhoeven et al. 1996) and has been designated a quarantine virus in Korea. Additional analysis of 13 symptomatic B. suaveolens plants from the infected greenhouse found that all samples except one were infected with CDV. To isolate CDV from B. suaveolens, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Nicotiana tabacum cv. BY via three single-lesion passages followed by propagation in N. benthamiana. For the bioassay of the CDV isolate (CDV-AT-Kr), sap from infected N. benthamiana was mechanically inoculated on 31 indicator plants, including B. suaveolens (Supplementary Table S2). CDV-AT-Kr induced chlorotic local lesions, necrotic local lesions, mottle, and/or mosaic systemically in 10 Nicotiana spp., and mottle and yellowing in tomato. On inoculated B. suaveolens, te mild mottle symptom was reproduced. No symptoms were observed in pepper or Datura stramonium. These results were confirmed by RT-PCR. To characterize CDV-AT-Kr genetically, the complete genome sequence of CDV-AT-Kr was obtained by RT-PCR using specific primers (Supplementary Table S3) and deposited in GenBank (accession no. MW075268). The CDV-AT-Kr RNA consists of 9,620 nt, encoding a polyprotein of 3,076 aa. BLASTn analysis showed that CDV-AT had maximum nucleotide identities of 98.9% at the complete genome level with a CDV isolate (accession no. JQ801448) from N. tabacum in the UK. To our knowledge, this is the first report of CDV infection in B. suaveolens in Korea and the second report in the world of the complete genome sequence. As B. suaveolens is cultivated by vegetative propagation, production and maintenance of virus-free, healthy B. suaveolens is needed. In addition, as new CDV hosts have been repeatedly reported (Pacifico et al., 2016; Salamon et al., 2015; Tomitaka et al., 2014; Verma et al., 2014), we are monitoring nationwide occurrence to prevent the spread of the virus to other crops.

Eustoma (Eustoma grandiflorum), also called lisianthus, belongs to the family Gentianaceae and is cultivated for flower production globally (1), including in Korea. At least 10 viruses can infect eustoma, including Cucumber mosaic virus (genus Cucumovirus), Tobacco mosaic virus (genus Tobamovirus), Tomato spotted wilt virus (genus Tospovirus), and Tomato yellow leaf curl virus (TYLCV, genus Begomovirus) (1,2). In December 2012, disease symptoms such as leaf curling and stunting were observed on eustoma plants grown in Gumi, Korea, where TYLCV outbreak was reported on tomato farms. In a eustoma greenhouse, about 5% of eustoma plants showed the leaf curling and stunting symptoms. Total DNA was isolated from 15 symptomatic eustoma plants with a Viral Gene-spin Viral DNA/RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea) and viral DNA was amplified by rolling circle amplification (TempliPhi Amplification Kit, GE Healthcare Life Sciences, Uppsala, Sweden) following the manufacturer's instructions. All amplicons were digested with the restriction enzyme SacI (TaKaRa Bio, Shiga, Japan) and 2.8-kb DNA fragments were verified on an agarose gel. Fifteen digested DNA fragments were purified from the gel, ligated into pGEM-T easy vector (Promega, Madison, WI), and sequenced (Macrogen, Seoul, Korea, GenBank Accession No. KF225312.1). A BLAST search exhibited a 99% identity to TYLCV previously reported in Korea (GenBank HM856911.1). This is the first report of TYLCV in eustoma plants in Korea. To identify the movement and replication of TYLCV in infected eustoma plants, PCR and Southern hybridization analysis were performed with samples from four organs (flower, leaf, stem, and root) of three individual TYLCV-infected plants. TYLCV TYL DNA from each organ sample was amplified using 2× Taq PCR MasterMix (Bioneer, Daejeon, Korea) with TYLCV-specific primers (TYLCV-F: 5′-ATATTACCGGATGGCCGCGCCT-3′, CV-R: 5′-TCCACGGGGAACATCAGGGCTT-3′). Single-stranded as well as double-stranded TYLCV DNA were identified from all organs of symptomatic eustoma, indicating TYLCV can replicate and move systemically in eustoma plants. Whitefly (Bemisia tabaci)-mediated plant-to-plant viral transmission was performed with one TYLCV-infected eustoma plant and five healthy eustoma plants and revealed that 80% (4 of 5) of the eustoma plants were infected by whitefly-mediated transmission. These results indicate that TYLCV-infected eustoma plants could act as virus reservoirs to healthy eustoma plants as well as other potential TYLCV hosts, such as tomatoes. In Korea, TYLCV has been the most notorious plant virus since 2008 (3), but, until now, TYLCV infection in eustoma plants has not been reported in Korea. References: (1) C. C. Chen et al. Plant Dis. 84:506, 2000. (2) A. Kritzman et al. Plant Dis. 84:1185, 2000. (3) H. Lee et al. Mol. Cells 30:467, 2010.

Leonurus sibiricus L. (family Lamiaceae) has been used as a traditional herbal remedy to treat various gynecologic diseases. Although it is a widely distributed subtropical weed in Southeast Asia, L. sibiricus have been commercially cultivated on a small scale in many geographic areas of Korea. In August 2012, field-grown L. sibiricus plants showing mosaic, yellowing, and stunting symptoms were collected near a pepper field in Andong, Korea. Since L. sibiricus is only consumed as a raw material of traditional medicine in Korea, symptomatic plants lose commercial value entirely. To identify the causal agent(s) of the virus-like symptoms, total RNA was extracted from the symptomatic leaves, and a transcriptome library was generated using the TruSeq Stranded Total RNA with Ribo-Zero plant kit (Illumina, San Diego, CA) according to the standard protocol. Next-generation sequencing (NGS) was performed using an Illumina HiSeq2000 sequencer. De novo assembly of the quality filtered NGS reads (101-bp paired-end reads) were performed using the Trinity pipeline and the assembled contigs (92,329 contigs) were analyzed against the viral reference genome database in GenBank by BLASTn and BLASTx searches (3). The entire NGS procedure was performed by Macrogen Inc. (Seoul, South Korea). Among the analyzed contigs, only two large contigs were clearly of viral origin. Nucleotide blast searches showed that the first and second contigs (5,914 and 3,534 bp, respectively) have maximum identities of 91 and 95% to RNA1 of the isolate RP3 (GenBank Accession No. JX183225) and RNA2 of the isolate RP7 (JX183234) of Broad bean wilt virus 2 (BBWV-2), which were isolated from pepper in Korea. The NGS results were confirmed by analyzing the sequences of the fragments covering the entire BBWV-2 genome amplified by RT-PCR using specific primers for BBWV-2 as described previously (1). To obtain the complete genome sequence, terminal sequences of both RNA segments were analyzed by the 5′ and 3′ rapid amplification of cDNA ends (RACE) method as described previously (1). The assembled full-length sequences of BBWV-2 RNA1 and RNA2 isolated from L. sibiricus were 5,951 and 3,575 nucleotides in length, respectively, and deposited in GenBank under the accessions KM076648 and KM076649, respectively. BBWV-2 belongs to the genus Fabavirus in the family Secoviridae and it is known to have a wide host range. To investigate the host range of the BBWV-2 isolated from L. sibiricus, sap from the symptomatic leaves of L. sibiricus was inoculated to the test plants including Nicotiana benthamiana, Capsicum annuum (red pepper), and C. annuum var. gulosum (Paprika). RT-PCR detection and sequencing of the amplicons showed that all the inoculated test plants were infected with the BBWV-2 isolated from L. sibiricus. Currently, BBWV-2 is epidemic in pepper fields in Korea (1,2). Because BBWV-2 is easily transmitted by various aphids, and L. sibiricus is widely distributed in both wild and cultivated fields in Korea, this host might serve as a potential source of BBWV-2 to other crops such as pepper. To the best of our knowledge, this is the first report of BBWV-2 in L. sibiricus. References: (1) H.-R. Kwak et al. Plant Pathol. J. 29:274, 2013. (2) H.-R. Kwak et al. Plant Pathol. J. 29:397, 2013. (3) S.-E. Schelhorn et al. PLoS Comput. Biol. 9:e1003228, 2013.

Cudrania tricuspidata (Moraceae) is a deciduous tree widely distributed in East Asia, including China, Korea, and Japan. It produces delicious fruit, and its cortex and root bark have been used as a traditional medicine to treat neuritis and inflammation. As C. tricuspidata has become known as a functional food, its cultivation area and production gradually have increased in Korea. However, information of viral disease in C. tricuspidata is very limited. In September 2012, open-field-grown C. tricuspidata trees showing virus-like symptoms of mosaic, yellowing, and distortion on the leaves were found in Naju, Korea. The fruit production in the diseased trees decreased to 20 to 40% of that in healthy trees. To identify causal agent(s), total RNA was isolated from the symptomatic leaves and used to generate a transcriptome library using the TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA) according to the manufacturer's instruction. The transcriptome library was analyzed by next-generation sequencing (NGS) using an Illumina HiSeq2000 sequencer. NGS reads were quality filtered and de novo assembled by the Trinity pipeline, and the assembled contigs were analyzed against the viral reference genome database in Genbank by BLASTn and BLASTx searches (3). The entire NGS procedure was perofrmed by Macrogen Inc. (Seoul, South Korea). Among the analyzed contigs, one large contig (10,043 bp) was of viral origin. Nucleotide blast searches showed that the contig has a maximum identity of 89% (with 100% coverage) to the isolate MS1 (Genbank Accession No. EU761198) of Bean common mosaic virus (BCMV), which was isolated from Macroptilium atropurpureum in Australia. The presence of BCMV was confirmed by a commercially available double-antibody sandwich (DAS)-ELISA kit (Agdia, Elkhart, IN). To confirm the BCMV sequence obtained by NGS, two large fragments covering the entire BCMV genome were amplified by reverse transcription-polymerase chain reaction (RT-PCR) using two sets of specific primers (5′-AAAATAAAACAACTCATAAAGACAAC-3′ and 5′-AGACTGTGTCCCAGAGCATTTC-3′ to amplify the 5′ half of the BCMV genome; 5′-GCATCCTGAGATTCACAGAATTC-3′ and 5′-GGAACAACAAACATTGCCGTAG-3′ to amplify the 3′ half of the BCMV genome) and sequenced. To obtain the complete genome sequence, the 5′ and 3′ terminal sequences were analyzed by the 5′ and 3′ rapid amplification of cDNA ends (RACE) method as described previously (1). The assembled full-length sequence of BCMV isolated from C. tricuspidata was 10,051 nucleotides in length without a poly(A) tail. It was deposited in Genbank under the accession number KM076650. BCMV, a member of the genus Potyvirus, is one of the most common viruses naturally infecting legumes, including Phaseolus vulgaris (2). In general, BCMV is known to have a restricted host range outside legume species (2). Therefore, the identification of BCMV from C. tricuspidata in this report is very exceptional. Because BCMV is easily transmitted by various aphids like other potyviruses, a large-scale survey may be required for exact investigation of the BCMV incidence in C. tricuspidata to prevent rapid spread of the virus. To the best of our knowledge, this is the first report of BCMV in C. tricuspidata. References: (1) H.-R. Kwak et al. Plant Pathol. J. 29:274, 2013. (2) M. Saiz et al. Virus Res. 31:39, 1994. (3) S.-E. Schelhorn et al. PLoS Comput. Biol. 9:e1003228, 2013.

Butterbur (Petasites japonicus [Siebold & Zucc.] Maxim.) is a perennial herb of the Asteraceae family that is cultivated for medicinal and nutritional purposes. Due to long-term vegetative propagation of virus-infected native species, the yield and quality of butterbur plants have deteriorated. Five viruses have been reported to infect this species: alfalfa mosaic virus (AMV), arabis mosaic virus (ArMV), butterbur mosaic virus (ButMV), broad bean wilt virus 2 (BBWV-2), and cucumber mosaic virus (CMV) (Ham et al. 2016; Tochihara and Tamura 1976). From 2018 to 2019, butterbur plants in four greenhouses in Nonsan, South Korea (Supplementary Figure S1a, b) were found to show virus-like symptoms such as chlorotic and necrotic ring spots, necrosis, and mild mosaic on the leaves. Disease incidence was greater than 80% in one greenhouse (~1,000 m2). To identify the causal virus, we collected 17 symptomatic butterbur leaf samples from these greenhouses and performed reverse-transcription polymerase chain reaction (RT-PCR) analysis using species-specific detection primers for the five reported viruses and tomato spotted wilt virus (TSWV) (Supplementary Table S2). RT-PCR results showed that 12 samples from three greenhouses showing necrotic ring spots and mosaic symptoms were infected with a mixture of TSWV and ButMV, whereas 5 samples from one greenhouse showing mild mosaic symptoms were infected only with ButMV. TSWV (genus Orthotospovirus, family Tospoviridae) is transmitted by thrips and causes serious damage to a wide range of economically important plants (Pappu et al. 2009). ButMV (genus Carlavirus, family Betaflexiviridae) is transmitted by aphids, as well as infected vegetative propagation material (Hashimoto et al. 2009) and is the most predominant virus in butterbur in Korea (Ham et al. 2016). To isolate TSWV from butterbur, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Chenopodium quinoa, via three single-lesion passages followed by propagation in Nicotiana tabacum cv. Samsun. Thirty different indicator plant species were used for the bioassay of the TSWV isolate (TSWV-NS-BB20) by mechanical inoculation method (Supplementary Table S3). RT-PCR analysis confirmed that TSWV-NS-BB20 induced necrotic local lesions and mosaic on Nicotiana species and ring spots and mosaic on tomatoes and peppers. Notably, TSWV-NS-BB20 reproduced necrotic local lesions and mild mosaic symptoms on butterbur plants which were infected with ButMV with no obvious symptoms. To characterize TSWV-NS-BB20 genetically, the complete genome sequences of L (8914 nt), M (4751 nt), and S (2917 nt) RNA segments were obtained by RT-PCR using specific primers for TSWV as described previously (Kwak et al., 2020). The obtained sequences were deposited in GenBank under accession nos. MT643236, MT842841, and MN854654, respectively. BLASTn analysis showed that sequences of each segment had maximum nucleotide identities of 99.0, 98.9, and 98.6% to TSWV-L, M, and S (KP008128, FM163373, and KP008129) of TSWV-LL-N.05 isolate from tomato in Spain. Since 2018, TSWV outbreaks on butterbur are observed every year and thus may act as a potential source of TSWV infection for other crops of importance to Korea, such as pepper. Owing to the butterbur vegetative propagation, the identification of TSWV infection in butterbur will be helpful for future virus management to generate virus-free materials. To our knowledge, this is the first report of TSWV infection of butterbur.

Clad ballooning and the resulting partial flow blockage are one of the major thermal-hydraulic concerns associated with the coolability of partially blocked cores during a loss-of-coolant accident (LOCA). Several in-pile tests have shown that fuel relocation causes a local power accumulation and a high thermal coupling between the clad and fuel debris in the ballooned regions. However, previous experiments in the 1980s did not take into account the fuel relocation phenomena and resulting local power increase in the ballooned regions. The present paper presents the results of systematic investigations on the coolability of rod bundles with flow blockages. The experiments were mainly performed in 5 × 5 rod bundles, 2 × 2 rod bundles and other test facilities. The experiments include a reflood heat transfer, single-phase convective heat transfer, flow redistributions phenomena, and droplet break-up behavior. The effects of the fuel relocation and resulting local power increase were investigated using a 5 × 5 rod bundle. The fuel relocation phenomena increase the peak cladding temperature.

Background Recent researches reported that inflammatory bowel disease (IBD) in Asia has become more prevalent. Since IBD is chronic inflammation disorder and its relapse is frequent, obtaining and maintaining remission is important. As our knowledge on the pathogenesis of IBD deepened, many immunosuppressants and biological agents were introduced and confirmed to be both safe and effective. However, biologics known as anti-tumour necrosis factor (anti-TNF) agents was reported to lose response over time in 23–46% of patients. Therefore, combination therapy adding immunomodulator drug such as azathioprine was introduced and showed better outcome by optimising biologic pharmacokinetics and minimising immunogenicity. Adversely, rates of tuberculosis are increased, but there is no large population data estimating and comparing these risk in combination therapy. Methods We used 2008–2016 data of the South Korean Health Insurance and Review Agency (HIRA), and odd ratio (OR) for tuberculosis in IBD patients who underwent anti-tumour necrosis factor (TNF) agent, azathioprine, or combination therapy. Results Between 2008 and 2016, 47,760 patients were newly diagnosed as IBD, 29,440 as UC and 15,320 as CD. We compared the risk of tuberculosis according to the medication divided into 5 groups; infliximab only, azathioprine only, combination of azathioprine and infliximab, azathioprine monotherapy and infliximab monotherapy, and azathioprine and infliximab whether simultaneously or separately. We also compared the risk between male and female. Hazard ratio of tuberculosis in infliximab monotherapy, azathioprine, and combination therapy in IBD patients were 1.132, 1.256, and 2.118, respectively. Conclusion Our study shows that Korean IBD patients are at risk for tuberculosis, and this results may highlight the importance of screening for tuberculosis in IBD patients.

Low impact development (LID) technologies mimic the natural water cycle through the physico-chemical and biological interactions of plants, filter media and soil, and microorganisms, thereby reducing the release of pollutants. In LID facilities, plants carry out photosynthesis, facilitate microbial growth, and uptake pollutants contained in stormwater runoff. However, de-icers (CaCl

Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made., The payload of the UFFO (Ultra-Fast Flash Observatory)-pathfinder now onboard the Lomonosov spacecraft (hereafter UFFO/Lomonosov) is a dedicated instrument for the observation of GRBs. Its primary aim is to capture the rise phase of the optical light curve, one of the least known aspects of GRBs. Fast response measurements of the optical emission of GRB will be made by a Slewing Mirror Telescope (SMT), a key instrument of the payload, which will open a new frontier in transient studies by probing the early optical rise of GRBs with a response time in seconds for the first time. The SMT employs a rapidly slewing mirror to redirect the optical axis of the telescope to a GRB position prior determined by the UFFO Burst Alert Telescope (UBAT), the other onboard instrument, for the observation and imaging of X-rays. UFFO/Lomonosov was launched successfully from Vostochny, Russia on April 28, 2016, and will begin GRB observations after completion of functional checks of the Lomonosov spacecraft. The concept of early GRB photon measurements with UFFO was reported in 2012. In this article, we will report in detail the first mission, UFFO/Lomonosov, for the rapid response to GRB observations. © The Author(s) 2017., The Korean work is supported by the National Research Foundation grants funded by MSIP of Korea (Creative Research Initiatives program for RCMST, No. 2015R1A2A1A01006870, and No. 2015R1A2A1A15055344). The Russian work was partially supported by ROSCOSMOS grants and by RFFI grants No. 13-02-12175 and No. 15-35-21038 and acknowledges support from the Development Program of Lomonosov Moscow State University. AJCT acknowledges support from the Spanish MINECO Projects AYA 2009-14000-C03-01/ESP and AYA 2015-71718R (including EU/FEDER funds). The Taiwanese authors thank Taiwan's National Science Council Vanguard Program (100-2119-M-002-025) and Ministry of Science and Technology (MOST) funding (104-2811-M-002-160). SJ acknowledges the support from the Korea Basic Science Research Program through NRF-2014R1A6A3A03057484 and NRF-2015R1D1A4A01020961. MBK acknowledges the support from NRF-2015-GPF.

Supplemental material for Systemic lupus erythematosus is a risk factor for cardiovascular disease: a nationwide, population-based study in Korea by S Y Lim, E H Bae, K-D Han, J-H Jung, H S Choi, HY Kim, C S Kim, S K Ma and S W Kim in Lupus

Poster presentada en el 50th ERA-EDTA Congress (European Renal Association - European Dialysis Transplant Association), celebrado del 18 al 21 de mayo de 2013 en Estambul (Turquia)

Sweet potato leaf curl virus (SPLCV) infects sweet potato and is a member of the family Geminiviridae (genus Begomovirus). SPLCV transmission occurs from plant to plant mostly via vegetative propagation as well as by the insect vector Bemisia tabaci. When sweet potato seeds were planted and cultivated in a whitefly-free greenhouse, some sweet potato plants started to show SPLCV-specific symptoms. SPLCV was detected by PCR from all leaves and floral tissues that showed leaf curl disease symptoms. More than 70% of the seeds harvested from SPLCV-infected sweet potato plants tested positive for SPLCV. SPLCV was also identified from dissected endosperm and embryos. The transmission level of SPLCV from seeds to seedlings was up to 15%. Southern blot hybridization showed SPLCV-specific single- and double-stranded DNAs in seedlings germinated from SPLCV-infected seeds. Taken altogether, the results show that SPLCV in plants of the tested sweet potato cultivars can be transmitted via seeds and SPLCV DNA can replicate in developing seedlings. This is the first seed transmission report of SPLCV in sweet potato plants and also, to the authors' knowledge, the first report of seed transmission for any geminivirus.

In this paper we present the Inverted-Conical light guide designed for optical crosstalk reduction in the scintillator-MAPMT assemblies. The research was motivated by the 30% crosstalk observed in UFFO X-ray telescope , UBAT, during the preliminary calibration with MAPMTs of 64 2.88 × 2.88 mm2 pixels and identically gridded YSO crystal matrices. We began the study with the energy and crosstalk calibrations of the detector, then we constructed a GEANT4 simulation with the customized metallic film model as the MAPMT photocathode . The simulation reproduced more than 70% of the crosstalk and explained it as a consequence of the total reflection produced by the photocathode. The result indicated that the crosstalk mechanism could be a common case in most of the contact-assembled scintillation detectors. The concept of the Inverted-Conical light guide was to suppress the total reflection by contracting the incident angle of the scintillation. We optimized the design in the simulation and fabricated a test sample. The test sample reduced 52% crosstalk with a loss of 6% signal yield. The idea of the Inverted-Conical light guide can be adapted by scintillation detectors multi-pixel, imaging-purpose scintillation detectors such as the ultra-fast GRB observatory UFFO-UBAT, whose performances are sensitive to responding time, image resolution, and geometrical modifications.

The UFFO/Lomonosov has been successfully launched into Sun synchronous orbit and is operational through tests and calibrations since its launch on Apr. 28, 2016. As a pathfinder of UFFO, it will be the first space instrument to use a fast slewing mirror which reduce the trigger latency of optical telescope, less than a second, to explore early time domain of GRB evolution. In this article, we will report in detail the first mission, UFFO/Lomonosov, for the rapid response to observe early photons from GRBs in orbit.

The Ultra-Fast Flash Observatory (UFFO) Pathfinder for Gamma-Ray Bursts (GRBs) consists of two telescopes. The UFFO Burst Alert & Trigger Telescope (UBAT) handles the detection and localization of GRBs, and the Slewing Mirror Telescope (SMT) conducts the measurement of the UV/optical afterglow. UBAT is equipped with an X-ray detector, analog and digital signal readout electronics that detects X-rays from GRBs and determines the location. SMT is equipped with a stepping motor and the associated electronics to rotate the slewing mirror targeting the GRBs identified by UBAT. First the slewing mirror points to a GRB, then SMT obtains the optical image of the GRB using the intensified CCD and its readout electronics. The UFFO Data Acquisition system (UDAQ) is responsible for the overall function and operation of the observatory and the communication with the satellite main processor. In this paper we present the design and implementation of the electronics of UBAT and SMT as well as the architecture and implementation of UDAQ.

Precisely detecting oestrus is important for artificial insemination. The aims of this study were to identify oestrus-specific sow mucus proteins to determine the optimal time for artificial insemination. The proestrous- and oestrous-stage mucus proteins were purified and analysed with proteomic tools such as two-dimensional gel electrophoresis and matrix-assisted laser desorption/ionization-time-of-flight analyses. Among the differentially expressed proteins, the dimethylarginine dimethylaminohydrolase 2 (DDAH2) protein showed a 3.6-fold increase during the proestrous stage compared to that during the oestrous stage. A western immunoblot study revealed that two of three sow mucus samples clearly showed negative anti-DDAH2 antibody activity during the oestrous stage. This study demonstrated that the pig DDAH2 mucus protein exists during the proestrous stage, but not during the oestrous stage, suggesting that mucus DDAH2 could be useful as an oestrus detection marker.

It is critical that the risk of lymph node metastasis (LNM) is evaluated for determining the suitability of endoscopic resection for T1 colorectal cancer (CRC). Reported risk factors for LNM in completely resected T1 CRC are deep submucosal invasion, grade 3, angiolymphatic invasion, and budding. The aim of the present study was to identify the histopathologic factors associated with LNM in T1 CRC.The study involved 435 patients with T1 CRC treated by endoscopic or surgical resection between January 2001 and April 2010 at the National Cancer Center, Korea. The 435 patients were classified into two groups - those undergoing surgical resection (n = 324) and those undergoing endoscopic resection (n = 111). In the surgically resected group, details regarding depth of submucosal invasion, angiolymphatic invasion, tumor grade, budding, and background adenoma (BGA) were evaluated with respect to presence or absence of LNM. In the endoscopically resected group, the results of follow-ups and additional salvage surgeries were studied.In the surgically resected group, LNM was detected in 42 patients (13.0 %). Grade 3, angiolymphatic invasion, budding, and the absence of BGA were identified as factors associated with LNM in univariate and multivariate analyses (P0.05). Among the 50 patients in the endoscopically resected group with high risk, three were diagnosed as being LNM-positive during the follow-up period. There was no LNM in the endoscopically resected group with low risk.Grade 3, angiolymphatic invasion, budding, and the absence of BGA are the risk factors that predict LNM in patients with T1 CRC. In cases where endoscopically resected T1 CRC has no risk factor, cautious follow-up could be recommended. However, if the tumor has any risk factor, additional surgical resection should be considered.

Background Capsaicin is an ingredient of red peppers that binds to transient receptor potential vanilloid subtype 1 (TRPV1), and Koreans eat more capsaicin-rich food than do Japanese. This study aimed to compare symptom generation according to TRPV1 genotypes and the intake of spicy foods. Methods Consecutive functional dyspepsia (FD) patients who were evaluated at Konkuk University Medical Centre (Korea) and Keio University Hospital (Japan) were included. Questionnaires on spicy food intake, patient assessment of gastrointestinal symptoms (PAGI-SYM), patient assessment of quality of life, and hospital anxiety and depression scale were provided. Blood was sampled for the detection of TRPV1 polymorphisms, and upper gastrointestinal endoscopy was performed with biopsies. Key Results Of 121 included subjects, 35 and 28 carried the TRPV1 CC and GG genotypes, respectively, with the prevalence rates not differing between Japan and Korea. The prevalence of FD subtypes did not differ with the spicy food intake, TRPV1 genotypes, or Helicobacter pylori infection. Neither TRPV1 polymorphisms nor H. pylori infections were related to scores on the PAGI-SYM questionnaires, but spicy food intake was positively correlated with the scores for stomach fullness (p = 0.001) and retching (p = 0.001). Using the linear regression analysis, stomach fullness was associated with spicy food intake (p = 0.007), whereas retching was related to younger age (p < 0.001) and female gender (p = 0.014). Conclusions & Inferences Upper gastrointestinal symptoms are more common in subjects with a higher consumption of spicy foods, younger age and female gender, regardless of TRPV1 genotypes and the H. pylori infection status. Capsaicin-rich foods may induce stomach fullness.

Tomato spotted wilt virus (TSWV) is the type member of the Orthotospovirus genus, in the family Tospoviridae. TSWV has a wide host range that includes ornamentals and vegetable crops. It causes serious disease of many economically important plants over 35 plant families. Orthotosovirus including TSWV and Impatiens necrotic spot virus (INSV) have been identified from Hoya spp. (Baker et al. 2015; Hausbeck et al. 1992; Melzer et al. 2014). In 2016, virus-like symptoms including chlorosis, necrosis, and ringspots were observed on leaves of Hoya carnosa from a commercial greenhouse in Gyeonggi, South Korea. The disease incidence based on symptom observation was 10 to 50%. The symptomatic leaf samples reacted positively using a commercially immunostrip with TSWV (from Agdia). For further confirmation of TSWV and other viruses, total RNA was extracted from leaves of two H. carnosa plants using the total RNA extraction kit (Plant RNA Prep Kit, Biocubesystem, Korea) and tested in RT-PCR using specific primers of TSWV (TSWV-6F 5′-GAGATTCTCAGAATTCCCAGT-3′ and TSWV-6R 5′-AGAGCAATCGTGTCAATTTTATTC-3′, expected amplicon size 459 bp), INSV (INSV-1F 5′-ATCAATAGTAGCATTAAACAT-3′ and INSV-1R 5′-GACTCAATCTGATTCCTTAGA-3′, expected amplicon size 800 bp), and Tomato chlorotic spot virus (TCSV) (TCSV-F 5′-TCCCTTGGTTTCATTGACCAAACGC-3′ and TCSV-R 5′-ACATGACACTTGCAAATGAGACTCC-3′, expected amplicon size 590 bp). A 500-bp product of the expected amplicon size from the TSWV CP gene was obtained from these plants, whereas no amplification was obtained with INSV and TCSV. Complete nucleoprotein (N) gene of TSWV was amplified by RT-PCR using primers TSWV N gene-F 5′-CAGCTGCTTTTAAGCAAGTTCTG-3′ and J13-R 5′-CCCGGATCCAGAGCAAT-3′. The product was purified from the agarose gel using nucleic acid purification columns (GeneAll Expin Combo GP, GeneAll Biotechnology, Korea) and cloned into the pGEM-T Easy vector (Promega, Madison, WI). Three clones in each sample were sequenced in both directions by a commercial sequencing service (Geno Tech Corp., Daejeon, Korea). The amplified N gene of TSWV sequences contained 777 nucleotides (MG257896 and MG257897) and BLAST analysis of the consensus sequence showed that two isolates (TSWV-Hy1 and -Hy2) had 97 to 99% nucleotide sequence identity with TSWV-HJ (LC273307, Humulus japoncus, Korea), TSWV-Peperomia (LC167301, Baby Rubber plant, Korea), and 97% identity with a TSWV isolate MAF05 (KC494493, Hoya arnottiana, New Zealand). To our knowledge, this is the first report of TSWV on H. carnosa from Korea. Recently, severe damage in ornamental plants has been caused by TSWV after it was first detected on vegetables in South Korea in 2003 (Choi et al. 2004; Yoon et al. 2017). To prevent the spread of the virus disease, rapid detection and elimination of sources of virus is important.

This paper deals with stress update algorithm based on finite difference method. The proposed algorithm is based on Euler backward method with multi-step return mapping approach. Central difference method was utilized for the approximation of the first and second derivatives of yield function. With the proposed algorithm, it is possible to perform elastic-plastic finite element simulation without any analytical derivatives of yield function. General yield functions including Hill's (1948) and Yld2000-2d, and also the HAH distortion hardening model were implemented to an implicit finite element code (ABAQUS/STANDARD). For the verification purpose, various finite element simulations were performed. With the anisotropic functions, single element loading-unloading and cup-drawing simulation were carried out. The results obtained from the proposed algorithm were compared with the results from analytical derivatives and reference data. The availability of the proposed algorithm for distortional plasticity such as HAH model was evaluated by single element loading-reloading simulations: tension-compression and tension-orthogonal tension. The effectiveness of the proposed algorithm compared to the classical Euler backward method was identified from the simulation results.

Zusammenfassung In den ersten sechs Trachtigkeitsmonaten wurden bei Fleckviehkuhen Blutentnahmen durchgefuhrt und die Konzentration von Androstendion, Testosteron und Epitestosteron mittels Radioimmunoassay bestimmt. Ab dem 3. Trachtigkeitsmonat stieg die Konzentration aller drei untersuchten Androgene im Blut der Kuhe signifikant an. Fur diesen Anstieg der Androgenkonzentration ist unserer Ansicht nach die aufgrund der Gewichtszunahme im starkeren Ausmas vorhandene Fahigkeit der Plazenta zur Androgenbiosynthese verantwortlich. Summary Androstendione, testosterone and epitestosterone in the blood of cows during the first six months of pregnancy In Fleckvieh cattle during the first 6 months of pregnancy blood samples were subjected to radioimmunoassay to measure the concentration of androstendione, testosterone and epitestosterone. From the 3rd month of pregnancy the concentrations of all 3 hormones in the blood rose significantly. This rise in androgen concentrations is, in the authors’ view, the result of the marked increase in weight of the placenta with its ability to biosynthesize androgens. Resume Androstendione, testosterone et epitestosterone dans le sang de vaches durant les six premiers mois de la gestation Des echantillons de sang ont ete preleves chez des vaches tachetees durant les six premiers mois de la gestation et les concentrations d'androstendione, de testosterone et d'epitestosterone ont ete determinees au moyen d'un radioimmunoassay. La concentration des trois androgenes augmente de facon significative dans le sang des vaches a partir du troisieme mois de gestation. Les auteurs pensent que la capacite de biosynthese des androgenes du placenta augmentee en grande partie par l'augmentation du poids est responsable de l'elevation de la concentration des androgenes. Resumen Androstendiona, testosterona y epitestosterona en sangre de vacas durante los seis meses primeros de gestacion En los seis meses primeros de gestacion se tomaron muestras de sangre a vacas de la raza Simmental, valorandose las concentraciones de androstendiona, testosterona y epitestosterona mediante ensayo radioinmunitario (RIA). A partir del 3er mes de gestacion aumento significativamente la concentracion en sangre de las vacas de todos los tres androgenos examinados. Segun nuestro parecer, es responsable de este incremento de concentracion de androgenos la capacidad presente de la placenta para la biosintesis de androgenos, la cual aumenta con el peso de aquella.

Zusammenfassung Bei neun Fleckviehstieren im Alter von acht bis zwolf Monaten wurden uber einen Zeitraum von sechs Stunden Blutproben entnommen und die Konzentration von LH, Testosteron, Androstendion und Epitestosteron mittels Radioimmunoassay gemessen. Am nachsten Tag wurde den Stieren je 100μg Gn-RH (Lutal®) intramuskular verabreicht und wiederum die Konzentration der angefuhrten Hormone bestimmt. Wahrend der sechs Stunden variierten die Hormonkonzentrationen im Blut der Stiere zwischen 3,3 und 1,72ng/ml fur LH, 4,2 und 1,0ng/ml fur Testosteron, 0,17 und 0,07ng/ml fur Androstendion sowie 1,7 und 0,9ng/ml fur Epitestosteron. Die Gn-RH-Applikation bewirkte einen Anstieg aller untersuchten Hormone, der bei LH bereits 30 Minuten nach der Verabreichung ein Maximum von 17,3ng/ml erreichte. Die Androgenkonzentrationen stiegen erst spater an und erreichten erst 2 Stunden nach der Gn-RH-Applikation Maximalwerte von 8,1 ng/ml fur Testosteron, 0,3 ng/ml fur Androstendion und 2,0 ng/ml fur Epitestosteron. Epitestosteron ist somit im peripheren Blut ein Parameter der testikularen Androstendionsekretion. Summary Androstendione, Epitestosterone, Testosterone and Luteinizing Hormone in Plasma of steers before and after administration of GnRH (Lutal®) In 9 spotted steers aged 8–12 months blood samples were taken over a period of 6 hours and the concentrations of LH, testosterone, androstendione and epistestosterone were determined by radioimmunoassay. On the following day the steers received 100μg Gn-RH (Lutal®) intramuscularly and the hormone concentrations were again measured. During the 6-hours period the hormone concentrations in the blood of the steers varied between 3.3 and 1.72 ng/ml for LH and 4.2 and 1. 0ng/ml for testosterone, 0.17 and 0.07 ng/ml for androstendione and 1.7 and 0.9 ng/ml for epitestosterone. Gn-Rh administration caused a rise in all the hormones examined, which for LH 30 minutes after dosage reached a maximum of 17.3 ng/ml. The androgen levels took longer to rise and reached their maximal values 2 hours after Gn-RH administration, when the maxima were for testosterone 8.1 ng/ml, for androstendione 0.3 ng/ml and for epitestosterone 2.0 ng/ml. Epitestosterone is thus, in peripheral blood, a parameter of testicular androstendione secretion. Resume Androstendione, epitestosterone, testosterone et hormone luteinisante dans le plasma sanguin de taureaux avant et apres application de Gn-RH (Lutal®) On a mesure par Radioimmunoassay la concentration en LH, testosterone, androstendione et epitestosterone dans des echantillons de sang preleves toutes les six heures chez neuf taureaux tachetes âges de huit a douze mois. Les taureaux ont recu chacun le jour suivant 100μg Gn-RH (Lutal®) par voie intramusculaire et on a denouveau determine la concentration des hormones citees. Les concentrations d'hormones mesurees a six heures d'intervalle ont varie de la maniere suivante dans le sang des taureaux: entre 3,3 et 1,72 ng/ml pour LH, 4,2 et 1,0 ng/ml pour la testosterone, 0,17 et 0,07 ng/ml pour l'androstendione et 1,7 et 0,9ng/ml pour l'epitestosterone. L'aplication de Gn-RH a provoque une augmentation de toutes les hormones examinees; la concentration de LH a atteint un maximum de 17,3 ng/ml 30 minutes deja apres l'application. Les concentratione d'androgenes augmenterent plus tard et ont atteint des valeurs maximales de 8,1 ngml seulement 2 heures apres l'application de Gn-RH pour la testosterone, de 0,3 ng/ml pour l'androstendion et 2,0 ng/ml pour l'epitestosterone. L'epitestosterone est un parametre de la secretion testiculaire d'androstendione dans le sang peripherique. Resumen Androstendiona, epitestosterona, testosterona y hormona luteinizante en el plasma sanguineo de toros antes y despues de la administracion de Gn-RH (Lutal®) En nueve toros Simmental o manchados de las alturas, de ocho hasta doce meses de edad, se tomaron muestras de sangre a lo largo de un espacio de tiempo de seis horas, midiendose las concentraciones de LH, testosterona, androstendiona y epitestosterona mediante el ensayo radioinmunitario. Al dia siguiente, se administraron a cada toro, por via intramuscular, 100μg de Gn-RH (Lutal®) y de nuevo se valoraron las concentraciones de las hormonas indicadas. Durante las seis horas variaban las concentraciones de hormonas en sangre de los toros entre 3,3 y 1,72ng/ml para LH, 4,2 y 1,0ng/ml para testosterona, 0,17 y 0,07ng/ml para androstendiona, y 1,7 y 0,9 ng/ml para epitestosterona. La aplicacion de Gn-RH ocasionaba el aumento de todas las hormonas examinadas, el cual alcanzaba en la LH al cabo de 30 minutos un maximo de 17,3 ng/ml. Las concentraciones de androgeno aumentaban mas tarde y alcanzaban a las 2 horas despues de la administracion de Gn-RH valores maximos de 8,1 ng/ml para testosterona, 0,3 ng/ml para androstendiona y 2,0 ng/ml para epitestosterona. Por lo tanto, la epitestosterona en la sangre periferica es un parametro de la secrecion testicular de la androstendiona.