Search

The aim of this study was to determine the possible impact of early socialization and an enriched neonatal environment to improve adaptation of piglets to weaning. We hypothesized that changes in the microbiota colonization process and in their metabolic response and intestinal functionality could help the animals face weaning stress. A total of 48 sows and their litters were allotted into a control (CTR) or an enriched treatment (ENR), in which piglets from two adjacent pens were combined and enriched with toys. The pattern of caecal microbial colonization, the jejunal gene expression, the serum metabolome and the intestinal physiology of the piglets were assessed before (-2 d) and after weaning (+ 3d). A differential ordination of caecal microbiota was observed after weaning. Serum metabolome suggested a reduced energetic metabolism in ENR animals, as evidenced by shifts in triglycerides and fatty acids, VLDL/LDL and creatine regions. The TLR2 gene showed to be downregulated in the jejunum of ENR pigs after weaning. The integration of gene expression, metabolome and microbiota datasets confirmed that differences between barren and enriched neonatal environments were evident only after weaning. Our results suggest that improvements in adaptation to weaning could be mediated by a better response to the post-weaning stress., We would like to acknowledge the funding from the Ministry of Economy, Industry and Competitiveness (MINECO) of Spain for granting the project AGL2016-75463-R within the framework of Proyectos I+D+I Convocatoria RETOS 2016 and the State Plan for Scientific and Technical Research and Innovation. MS received an FPI grant from the Spanish Ministry of Science and Innovation (grant number BES-2017-080018). MD received support from Opening Sphere UAB-CEI to Postdoctoral Fellows (project H2020-MSCA-COFUND-2014). HLK received the University, Research Center and Hospital Foundation Grants for the Contracting of New Research Staff (FI) from Agency for Management of University and Research Grants (AGAUR) of the Catalan Government. PL received support from the Tecniospring program (TECSPR15-1-0040) of ACCIÓ funded by the Catalan Government and the Marie Curie COFUND Fellowship Program within the 7th European Community Framework.

This study investigated the quality of life of individuals with acquired brain injuries (ABI) across a one- to fifteen-year post-injury time span. This allows us to identify the health and service needs of individuals with ABI and provide direction for further improvement. Twenty-nine individuals were invited from the local Self-Help Group for the Brain-Damaged to participate in this study. Four instruments were used to help in the investigation of the subjective components of the quality of life, including the Personal Wellbeing Index (PWI) and Positive and Negative Affect Scales (PANAS). The instruments used were the Modified Barthel Index (MBI) and Lawton Instrumental Activity of Daily Living (IADL) Scale. After analysis of the results and their interpretation, there was no significant difference between the post-injury groups in their scores of negative affect. It is suggested that there should be services, such as psychotherapy, to help reduce the existence of negative moods. Improvement in the IADL aspect should be more focused in future rehabilitation services to allow people to enjoy a fuller life.

Between 1. 1. 1988 and 31. 12. 1990, greater than or equal to 10 colony-forming units of Staph. saprophyticus were isolated from 55 of a total of 20,000 urine samples went in. The isolates from these 55 patients (52 women, 3 men; mean age 29 [17-58] years) were tested for specific adhesion molecules (lectins) to discover their relationship to blood-group characteristic carbohydrates. 52 of the 55 patients (94.5%) were blood-group A or AB (average for Middle-Europeans: 48.2%). Haemagglutination and inhibition tests with the Staph. saprophyticus isolates demonstrated in all instances N-acetylgalactosamine (GalNAc) specificity of the surface lectins. These findings support the hypothesis that the carbohydrate pattern of Blood group A (terminal GalNAc) is important for the colonization of exposed organs by Staph. saprophyticus with GalNAc-specific lectins.

Summary Clinical isolates of three encapsulated Klebsiella strains with type 1 (mannose-sensitive, MS + MR - ), type 3 (mannose-resistant, MS - MR + ), type 1.3 (MS + MR + ) fimbriae and facultatively coexpressing P-like fimbriae were investigated for their ability to adhere to uroepithelial cells (UECs) and tracheal epithelial cells (TECs). Irrespective of the type of epithelial cells, adhesion of the MS + MR + (type 1.3) fimbriated Klebsiella strain was significantly stronger than adhesion of strains carrying only type 1 (MS + MR - ) or type 3 (MS - MR + ) fimbriae. The coexpression of P-like fimbriae increased the adhesive properties of Klebsiella strains to UECs but not to TECs. Adhesion of P-like fimbriated Klebsiella strains to UECs was significantly inhibited in the presence of the P + fimbriae-specific Gal α-4-Gal s (galabiose). Such adhesion was unrelated to the coexpression of type 1, type 3 or type 1.3 fimbriae. However, adhesion to TECs was only moderately inhibited.

The galactoside-specific lectin (mistletoe lectin-1, VAA-1) and the N-acetylgalactosamine-specific lectin (mistletoe lectin-2, VAA-2) were purified from aqueous mistletoe extract and checked for their immunoactive potency. Regular subcutaneous administration of the optimal immunomodulating VAA-1 /VAA-2 dosage (1 ng lectin/kg body weight) could be shown to modulate thymocyte proliferation, maturation, emigration and activation in BALB/c-mice. Thus, the increase in thymocyte counts was statistically significant after VAA-1 treatment. However, analogue VAA-2 applications significantly decreased thymocyte proliferation. Determinations of lymphatic subsets revealed considerable upregulation (after VAA-1 treatment) and significant downregulation (after VAA-2 treatment) of immature L 3 T4(+)/Lyt-2(+) thymic cells. Counts of mature cells expressing helper/inducer (L3T4(+)) or suppressor/cytotoxic (Lyt-2(+)) phenotypes did not present remarkable differences after VAA-1/VAA-2 administration. Counts of BALB/c-mouse peripheral blood cells revealed evident (statistically non-significant) increases of lymphocytes (PBL) and monocytes (PBM) after VAA-1 treatment, however, cell counts after VAA-2 administration were comparable to non-treated control animals. The determination of activated PBL expressing interleukin IL-2 receptors proved that VAA-1 induced a potent immunostimulation, since these cells were significantly enhanced after VAA-1 administration but not after VAA-2 treatment.

Summary Inactivated cells of Propionibacterium avidum KP-40 could be shown to induce thymocyte proliferation and maturation in BALB/c-mice after intraperitoneal administration of the optimal immunomodulating dosage (1 mg per mouse). The increase in thymus weight and thymocyte numbers per mg organ weight was most pronounced and statistically significant 10 days after P. avidum KP-40 administration. Determinations of lymphatic subsets revealed a considerable up-regulation of mature cells expressing helper/inducer (L3T4 + ) or cytotoxic/suppressor (Lyt-2 + ) phenotypes and immature cells presenting both L3T4 + /Lyt-2 + antigens. Obviously, P. avidum KP-40 administration accelerated murine thymocyte proliferation and maturation. Counts of BALB/c-mouse peripheral blood lymphocytes (PBL) and monocytes (PBM) revealed statistically significant increases after P. avidum KP-40 administration with peak values after 6-10 days. The determination of activated PBL (expressing interleukin-2 receptors) or PBM (expressing MAC-3 antigens) proved that P. avidum KP-40 induced a potent immunostimulation since counts of these cells were significantly enhanced after P. avidum KP-40 treatment.

Anhand des etablierten BALB/c-Mausmodells wurden die EinflUsse von Hydrokortisonazetat als Immunsuppressivum und von ML-1, dem galaktosid-spezifischen Hauptmistellektin, als immunprotektiv wirken

Methods based upon the polymerase chain reaction (PCR) have been developed for distinguishing cereal species and cultivars. DNA isolated from the leaves of germinating seedlings or grain gave similar results. Primers designed to amplify the spacers between 5S ribosomal RNA genes were able to identify samples of maize, barley, sorghum, rye, rice, oat and wheat without any significant variation within these species. Arbitrary 10-mers allowed distinction between cultivars of the same species, although some variation was found within cultivars, and some primers gave products characteristic of the cereal species. These methods have potential for application in the analysis of the species and cultivars composition of cereal grain lots and cereal products.

In den letzten 20 Jahren konnte die 5-Jahres-Uberlebenszeit bei Patienten mit Kopf-Hals-Plattenepithelkarzinomen trotz verbesserter chirurgischer und radiologischer Techniken kaum gebessert werden. De

The genetic relationships between rice varieties were analysed by using the polymerase chain reaction (PCR), with arbitrary oligonucleotide primers in the random amplified polymorphic DNA (RAPD) method. PCR with 22 arbitrary primers applied to 37 varieties produced 144 useful markers, of which 67% were polymorphic. Thus, with selected primers sufficient polymorphism could be detected to allow identification of individual varieties. Visual examination of electrophoresis gels and analysis of banding patterns confirmed that commercial Australian and USA lines and their relatives were very closely related, with similarity indices of 88–97%. Three varieties originating from more distant geographical centres were easily distinguished, producing variety-specific amplification profiles and expressing a lower similarity index of 80% to all other varieties tested. PCR offers a potentially simple, rapid and reliable method for rice genotype identification and recognition of lines that could contribute genetic diversity to new commercial varieties.

Summary Lipoteichoic acid (LTA) was extracted from Staphylococcus saprophyticus strain S 1 and tested for the capacity to induce hematopoietic and lymphatic cell proliferation. As compared to nontreated cells, the number of human bone marrow cells significantly inreased in the presence of low LTA concentrations. Optimal growth was observed on the fifth day of in vitro incubation. After exposure to LTA, the lymphocyte proliferation rate also increased in a dose and time dependent manner. On the other hand, human epithelial cells and fibroblasts did not show enhanced growth activities in the presence of LTA.

Summary Type 1 fimbriae (T1F) and type 3 fimbriae (T3F) were isolated from Klebsiella species, purified, attached to latex beads and tested for their ability to stimulate human polymorphonuclear leukocyte (PMNL) oxidative activity. The luminol dependent chemiluminescence assay was used to evaluate the response of phagocytes. Latex particles coated with type 3 fimbriae (l-T3F) induced a significantly higher chemiluminescence response than those with type 1 fimbriae (l-T1F). Opsonization of l-T1F with pooled human serum induced chemiluminescence responses which were statistically significantly enhanced as compared to opsonized l-T3F and both kinds of non-opsonized fimbriae.

Summary The ability of bacteria and bacterial products to modulate the immune response to unrelated antigens is well documented. Propionibacteria are amongst the most potent immunomodulators stimulating cell populations involved in nonspecific resistance. Generally, the activated immune system provides protection from infectious pathogens and malignancies via mechanisms of recognition and elimination. Accordingly, administration of propionibacteria could be shown to be of benefit in the treatment of neoplastic and infectious diseases. Thus, it can be recommended for further clinical investigations.

The cytotoxic in vitro activity of standardized mistletoe extracts (ME) was examined by established assays towards the human ductal breast carcinoma cell line BT474. A dose-dependent (optimum 25 mg/mL medium) and significantly (p0.05) enhanced cytotoxic activity towards the BT474 cells was demonstrated. In vivo experiments on the antitumor activity of ME-A and ME-M were performed in a BALB/c-mouse / BT474 ductal breast carcinoma model. ME-A and ME-M were intratumorally administered according to an application schedule which was found to be optimal concerning dosage and time of administration. Standardized intratumoral application of ME-A and ME-M induced a significantly (p0.05) decreased tumor weight in experimental mice. Histological investigations were performed comprising analysis of mitosis and proliferation rates (Ki67 expression), as well as necrosis and apoptosis induction (ssDNA detection). As compared to tumors of control mice with intratumoral phosphate-buffered saline (PBS) injections, tumors of the ME-A and ME-M treated groups showed a decreased cell proliferation rate, as well as an increased cell necrosis and apoptosis rate. Standardized mistletoe extracts, interfering with defined tumor cell functions, e.g., proliferation, necrosis and apoptosis, may have an impact on local cancer treatment.

An aqueous plant extract from Azadirachta indica and its chromatographic fraction F1 (neem extract) exerted immunomodulating and antimetastatic activities in BALB/ c-mice. Regular subcutaneous administration of neem extract yielded significantly increased spleen weight and significant enhancement of peritoneal macrophage activity in the chemiluminescence assay, and activation marker CD-44 expression. The thymus weight and thymocyte counts did not show significant differences in the control and neem extract-treated groups, however, determination of peripheral blood cells revealed significant up-regulations of leukocyte subsets, the lymphocytes and monocytes. Flow cytometric analaysis of lymphocyte supopulations documented increased counts of CD-4 and CD-8 cells and an inreased activation marker expression on lymphocytes (CD-25) and monocytes (MAC-3) in neem-treated mice compared to the control animals. To evaluate the antimetastatic activity of neem extract, sarcoma L-1 cells and lymphosarcoma RAW cells were intravenously inoculated into BALB/c-mice. In these model systems the number of experimental lung and liver metastases decreased relevantly, however, biometrically non-significantly in neem extract-treated animals, as compared to the control mice which received injections of saline solutions. Neem extract can be regarded as an immunomodulating and antimetastatic substance which holds promise for further experimental and clinical investigation.

The immunomodulatory and antimetastatic activity of standardized aqueous mistletoe extract (sME) was evaluated in BALB/c-mice. Regular subcutaneous (s.c.) applications (three times per week for 14 consecutive days; 2, 20, 100 and 500 micrograms per injection and mouse) up-regulated thymocyte and peripheral blood leukocyte counts in tumor-bearing mice. Tumor weight and tumor volume were significantly down-regulated after application of sME doses greater than 20 micrograms per injection. To check the influence of sME treatment on growth of experimental metastases, RAW 117 H 10 lymphosarcoma cells and L-1 sarcoma cells were intravenously inoculated into BALB/c-mice to establish liver and lung colonization, respectively. sME was regularly administered starting 24 hours after tumor cell challenge. Organ colonization was investigated on day 14 after tumor cell inoculation and demonstrated statistically significant (p0.05) reductions of experimental liver and lung metastases for sME-treated mice.

The polymerase chain reaction (PCR) with oligonucleotide primer sequences from alpha‐amylase genes was used to distinguish between morphologically similar malting and feed barley varieties. The varieties “Chebec” (feed) and “Schooner” (malting) could be separated and the varieties “Skiff” (feed) and “Franklin” (malting) were identified by using two sets of primers. Primer BSW3 (5‐CAGCTTGGCCTCCGGGCAAGTC‐3) and BAS2 (5‐CACCTTGCCGTCGATCTC‐3) gave a 215 bp product that distinguished “Chebec” from “Schooner” and a 1230 bp fragment that distinguished “Skiff” from “Franklin”. Primer BSW5 (5‐GGAGCTGGAATTGATGTTG‐3) with primer BAS2 gave markers at 735 bp and 730 bp respectively to allow unique identification in comparisons of these pairs of varieties. DNA extracted from grain could be used for these analyses, but DNA from leaves gave clearer results. 1994 The Institute of Brewing & Distilling

The effects of biological response modifiers (BRMs) on the functions of two types of dendritic cells (DCs) were examined in relation to anti-tumor therapy. The two BRMs studied in our assay system were OK432 (a streptococcal preparation) and KP-40 (Propionibacterium avidum: a heat-inactivated bacterial vaccine). Recently, techniques for isolating human DCs from peripheral blood have been established, and DCs can be divided into two subsets: CD11c+ DCs (myeloid DC population) and CD11c- DCs (lymphoid DC population). Both OK432 and KP-40 were found to up-regulate the activity of myeloid-lineage DCs: the expression of major histocompatibility complex (MHC) class II molecules and adhesion/costimulatory molecules increased, and the production of IL-12 also increased. Therefore, DCs pulsed with OK432 and KP-40 could be applied to vaccination as a new adjuvant for specific immunotherapies.

The immunomodulating and antimetastatic activity of clinically approved, low molecular weight, standardized thymic peptide (TP) preparations was evaluated in BALB/c-mice. Daily applications (subcutaneously, s.c.; intraperitoneally, i.p.; intramusculary, i.m.) of two commercially available TP preparations (7 consecutive days, 10, 50 and 100 micrograms per mouse and injection) up-regulated the thymus weight and thymocyte counts as well as peripheral blood leukocyte and lymphocyte counts in liver metastases-bearing mice. The immunomodulating activity of TP application was most pronounced and statistically significant for thymus weight and counts of thymocytes, leukocytes and lymphocytes after s.c. administration of both TP preparations and concentrations. I.p. and i.m. TP-injections were less effective at reaching statistical significance, however, for defined dosages and parameters, only. To evaluate the influence of TP on experimental liver metastases, RAW 117 lymphosarcoma cells were intravenously inoculated into BALB/c-mice. TP (10, 50, 100 micrograms/mouse) were s.c., i.p. and i.m. administered daily for 7 consecutive days starting 24 hours after tumor cell challenge. Liver colonization was investigated on day 14 after tumor cell inoculation and demonstrated a statistically significant (p0.05) reduction of experimental liver metastases for s.c. (both preparations and concentrations) as well as i.p. and i.m. (dose-dependent) TP-treated mice.

Cardiac catheterization has been used frequently for the evaluation and treatment of patients with heart diseases. The working staff, particularly cardiologists who perform these procedures, have the highest potential risk of receiving high radiation doses due to close contact with patients. The purpose of this study was to measure and evaluate the accumulated radiation dosage of the cardiologists while they were performing clinical procedures in the cardiac catheterization laboratory. The working environment of the catheterization laboratory was also monitored for radiation.Thermoluminescent dosimeters (TLDs) with very high sensitivity were employed for dose evaluations. They were taped to various parts of the body of the cardiologists during catheterization procedures. For environmental monitoring, TLDs were also distributed at several sites of the catheterization rooms for a period of 2 to 4 weeks.The study showed that the left wrist of the cardiologists received the highest radiation dose (338 microsieverts [microSv]/procedure) and the left lens received the second highest dose (149 microSv/procedure) during the procedures. The dose to the knees was unexpectedly high (92 microSv/procedure), partly due to radiation leakage from the lead curtain shielding under the patient couch. On average, the effective radiation dose per year was 37 mSv/y for a cardiologist who performs 10 catheterization procedures per week. Compare this to the occupational exposure limit of 50 mSv/y. The estimated accumulated equivalent dose to the lens was 152 mSv/y, which exceeded the regulatory limit for occupational exposure.Using proper lead shielding and increasing the distance from the radiation source are good strategies for reducing the radiation dose in medical staff. The work area outside the catheterization room was considered safe because the radiation level was essentially equivalent to the background radiation level.

Commercially available mistletoe extract standardized for the galactoside-specific lectin (ML-1; Eurixor) and a chromatographically ML-1-depleted preparation (same charge no. and composition of remaining components) were tested for their immunomodulating potency. In BALB/c-mice, regular subcutaneous administration of the optimal immunomodulating dosage (1 ng ML-1/kg body weight) could be shown to induce no influence on spleen weight, a non-significant increase of thymus weight, a significant increase of thymocyte, peritoneal macrophage, peripheral blood leukocyte, lymphocyte and monocyte and monocyte counts, and a significant decrease of peripheral blood granulocyte counts. Administration of analogue volumes (concentrations) of ML-1-depleted extract, however, did not induce any immunopotentiation. Accordingly, it may be assumed, that the galactoside-specific lectin (ML-1) represents the main immunomodulating component in commercially available mistletoe extracts.

Experimental studies were performed to investigate further the effects of immunotherapy with Propionibacterium avidum KP-40 on thymocyte proliferation, maturation and emigration in BALB/c-mice. Thymus weight and thymocyte counts, especially cells presenting the immature or cytotoxic/suppressor phenotype were significantly increased. Due to enhanced emigration, peripheral blood lymphocyte and monocyte counts as well as expression of activation markers were significantly upregulated. The antimetastatic effect of Propionibacterium avidum KP-40 was demonstrated in BALB/c-mice, where RAW 117-H10 lymphosarcoma liver colonization was significantly reduced after immunostimulation. Clinical investigations proved that surgical treatment of colorectal carcinoma induced an evident decrease of peripheral blood lymphocytes as compared with preoperative counts. However, single preoperative Propionibacterium avidum KP-40 administration induced a considerable increase of peripheral white blood cell counts, especially lymphocytes. Clinical effects of preoperative immunostimulation by Propionibacterium granulosum KP-45 were investigated in a prospective randomized trial in colorectal carcinoma patients. Positive effects on survival time, local tumor recurrence and distant metastasis could be demonstrated in stages I and II, whereas no advantage of immunotherapy was found in advanced stages III and IV. A recent prospective randomized clinical trial was initiated on the quality of life of colorectal carcinoma patients. Three months after surgical treatment negative effects could not be determined after immunotherapy. Quality of life even proved to be better in patients with abdominoperineal resection as compared to non Propionibacterium avidum KP-40 treated control patients.

The antimicrobial activity of mercurius cyanatus complex (Oligoplex) and its components Mercurius cyanatus D5, Echinacea angustifolia D1, Ailanthus glandulosa D3, Ammonium bromatum D3, Baptisia tinctoria D3, Euspongia officinalis D2, alcohol 5% (dilution: D1 = 1: 10, D2 = 1 : 100 etc.) was tested in vitro by serial dilution tests against 105 clinical isolates (grampositive/negative, aerobes and anaerobes with relevance for pharyngitis). The bactericidal activity was compared with that of vancomycin when appropriate. One component of the composition (Mercurius cyanatus) exerted a considerable bactericidal activity against S. pyogenes, S. agalactiae, S. pneumoniae, S. aureus, E. faecalis in serial dilutions of the clinical relevant concentration D5. However, growth of H. influenzae, Bacteriodes sp. and Actinobacillus actinomycetemcomitans was not inhibited by Mercurius cyanatus and any other component of the composition. The composition, however, exerted a bactericidal range similar to that of Mercurius cyanatus, but less efficient. Analysis of the bactericidal effect of Mercurius cyanatus and vancomycin revealed comparability for S. pyogenes, S. agalactiae, S. pneumoniae, S. aureus and E. faecalis for vancomycin concentrations of 0.063-2 mg/l, which are clinically relevant.

Cellular aspects of the immunomodulating activity of a proprietary mistletoe extract (Eurixor) standardized for mistletoe lectin-1 (ML-1) were investigated in patients suffering from mammary carcinoma (n = 20). Regular subcutaneous injections of the different dosages (0.5 and 1.0 ng ML-1/kg body weight, twice a week, for 5 weeks) yielded statistically significant increases of defined peripheral blood lymphocyte subsets (helper T-cells, natural killer (NK)-cells) which are generally believed to be involved in antitumor activity. Moreover, administration of either ML-1 concentration resulted in enhanced expression of activation markers such as interleukin-2 receptors and HLA/DR-antigens on peripheral blood T-lymphocytes. This study suggests that regular subcutaneous administration of both ML-1 concentrations (0.5 and 1.0 ng/kg body weight) can efficiently stimulate the cellular immune system of cancer patients.

Adhesion of bacteria and of metastasizing tumour cells have much in common, especially the participation of lectins in this process. In the future it might be possible to inhibit the metastatic process and bacterial adhesion by blocking with lectins specific for appropriate (oligo) saccharides or glycoconjugates. Initial clinical trials are very promising.

The sensitivity of random amplified polymorphic DNA using arbitrary 10-mer oligonucleotide primers (RAPD) to detect genetic change in sugarcane (Saccharum spp. hybrid) plants during tissue culture was assessed. RAPD analysis of sugarcane plants regenerated from embryogenic callus revealed very few polymorphisms. However, RAPDs detected gross genetic change in protoplast-derived callus of sugarcane. This callus had been in tissue culture for over two years and had lost the ability to differentiate shoots and regenerate plants. RAPD assessment of the genetic integrity of sugarcane plants from an in vitro germplasm collection, regenerated from apical buds and maintained in storage at 18°C for 3, 6 and 12 months, revealed no significant genetic change. These results suggest that RAPDs are suitable for detecting gross genetic change but may not be sensitive enough to detect small changes and that minimal genetic change appears to take place in sugarcane plants regenerated from embryogenic callus or apical buds.

Hydrocortisone-acetate (HA)-treatment of BALB/c-mice induced a profound suppression of the lymphatic immune system with statistically significant decreases of thymocyte proliferation and maturation rates as well as peripheral blood lymphocyte (PBL) counts. To check its putative immunoprotective/immunorestoring activity, the optimal immunomodulating dosage of commercially available mistletoe extract standardized for the galactoside-specific mistletoe lectin (ML-1) was regularly administered (1 ng ML-1 per kg body weight; subcutaneously). As compared to counts of thymic lymphatic subsets of HA-treated mice, a considerable up regulation of mature cells expressing helper/inducer (L3T4+) as well as cytotoxic/suppressor (Lyt-2+) phenotypes and immature cells expressing both antigens (L3T4+/Lyt-2+) could be found after ML-1 co-administration. Counts of BALB/c-mouse peripheral blood mononuclear cells also revealed statistically significant increases after ML-1 co-administration, as compared to HA-treated animals. Accordingly, ML-1 treatment may be supposed to restore the lymphatic system after immunosuppressive corticoid treatment and thus this treatment may be of great benefit to patients.

Galactoside-specific mistletoe lectin-1 (ML-1) was isolated by affinity chromatography from proprietary mistletoe extract and checked in BALB/c-mice for its immunoactive potency. To investigate the optimal immunomodulating dosage, ML-1 (0.5, 1.0, 2.5, 5.0 ng/kg body weight, b.w.) was subcutaneously administered for three subsequent days followed by another injection 48 h later. These studies proved that injections of 1 ng ML-1/kg b.w. induced optimal immunomodulation, since thymocyte proliferation, maturation and emigration were significantly enhanced in this murine model as compared to non-treated control mice. Further on, counts of peripheral blood lymphocytes and monocytes as well as expression of relevant activation markers on these cells revealed significant increases after ML-1 (1 ng/kg b.w.) administration. However, increase of cell counts and activity of peritoneal macrophages were less pronounced but still statistically significant for this ML-1 concentration. Determination of immune responses after low dose ML-1 treatment (0.5 ng/kg b.w.) presented relevant (partly statistically significant) increases, too. However, high dose ML-1 treatment (2.5, 5.0 ng/kg b.w.) did not enhance (but suppress) relevant immune functions. For future clinical/therapeutical treatment strategies, ML-1 dosages ranging from 0.5-1.0 ng/kg b.w. may be supposed to be optimal.

Random amplified polymorphic DNA (RAPD) analysis using 10-mer oligonucleotide primers efficiently differentiated sugarcane cultivars and proved suitable for detecting gross genetic change such as that which can occur in sugarcane subjected to prolonged tissue culture, for example in protoplast-derived callus. However, RAPD analysis was not sufficiently sensitive to detect smaller genetic changes that occur during sugarcane genetic transformation. The length of DNA scored for polymorphism per primer averaged 13.2 kb, or 0.0001% of the typical sugarcane genome size of 1.2 × 107 kb (2C). RAPD analysis of sugarcane plants regenerated from embryogenic callus revealed very few polymorphisms, indicating that gross genetic change is infrequent during this tissue culture procedure, although epigenetic effects result in transient morphological changes in regenerated plants. More sensitive variations on the RAPD technique may increase the practicality of DNA-based screening of regenerated plant lines to reveal somaclonal variants.

Identification of cereal species and varieties is potentially useful in cereal production, storage, handling and processing. Labelling of transgenic foods may require the availability of reliable testing methods. Genotype analysis has been simplified by the development of methods based upon the polymerase chain reaction (PCR). Adaptation of this technique to the routine analysis of cereals is being investigated, with the objective of developing a reliable, simple and rapid protocol. Sampling, sample preparation and analysis procedures have been evaluated for several species. These studies have included an evaluation of PCR performance of DNA extraction methods and PCR cycles in different formats. Oligonucleotide primers with both arbitrary and specific sequences have proven successful in cereal analysis. Random amplification of polymorphic DNA (RAPD) can be applied in comparing and distinguishing varieties, while specific primers are required for species identification.

Maligne Tumore fuhren, wenn sie nicht adaquat therapiert werden, durch fortschreitendes Wachstum, Infiltration der Umgebung und Dissemination der Tumorzellen mit Bildung von Metastasen zum Tode. Trotz standiger Verbesserung der chirurgischen Behandlungsmethoden und Fortschritten der Chemo-, Strahlen-, Hormon- bzw. Immuntherapie besteht weiterhin ein erheblicher Bedarf an wirkungsvollen Erganzungen der etablierten Behandlungskonzepte.

Mucosal surfaces are habitats of the physiological microflora and are closely related to the mucosal immune compartment (mucosa-associated lymphoid tissue, MALT). Recently, considerable evidence has been accumulated showing that various members of the physiological microflora liberate low molecular weight peptides which, apparently, are essential for adequate immune responses of the host. Antibiotic decontamination (e.g. of the BALB/c-mouse intestinal tract) results in a lack of generation of immunopriming microbial peptides leading to immunosuppression. Biochemical analysis of the peptides revealed reproducible chromatographic fractions which selectively influence maturation, proliferation, and activation of lymphatic cells.

Commercially available mistletoe extract standardized for the galactoside-specific mistletoe lectin-1 (ML-1) could be shown to induce thymocyte proliferation and maturation in BALB/c-mice after regular subcutaneous administration of the optimal immunomodulating dosage (1ng lectin/kg body weight). The increase in thymocyte numbers per mg organ weight was statistically significant. Determinations of thymic lymphatic subsets revealed considerable up-regulation of mature cells expressing helper/inducer (L3T4) or cytotoxic/suppressor (Lyt-2) phenotype and immature cells presenting both (L3T4/Lyt-2) antigens. Thus, administration of ML-1 accelerated murine thymocyte proliferation and maturation. Counts of BALB/c-mouse peripheral blood lymphocytes (PBL) revealed evident (but statistically non-significant) increases after ML-1 administration. The determination of activated PBL expressing interleukin (Il)-2 receptors proved, however, that ML-1 induced a potent immunostimulation since these cells were significantly enhanced after ML-1 administration.

Comparative Studies on the Immunoactive Potency of Galactoside-specific Lectin from Mistletoe/Pure substance against standardized extract. Cellular and humoral aspects of the immunomodulating activity of the galactoside-specific lectin from mistletoe (ML-1) were investigated in cancer patients suffering from mammary carcinoma and compared to the immunoactive potency of a proprietary mistletoe extract standardized for ML-1 (ML-1 stand., Eurixor). Regular subcutaneous injections of the optimal dose of ML-1 and ML-1 stand. (1 ng/kg body weight; twice a week; for 4 weeks) yielded statistically significant increases of certain lymphocyte subsets (helper T-lymphocytes, natural killer (NK)-cells) which are generally believed to be involved in antitumor activity. Moreover, administration of either ML-1 preparation resulted in enhanced expression of interleukin (Il)-2 receptors on lymphatic cells and significantly increased serum levels of defined acute phase reactants (c-reactive protein, haptoglobin, C3 complement) as indicator of cellular and humoral activity. In vitro, exposition of human lymphocytes to ML-1 and ML-1 stand. resulted in enhanced expression of Il-2 receptors, which substantiated the capacity of both ML-1 preparations to affect immunological parameters within the host defense system. The effects of ML-1 and ML-1 stand. were comparable.

Adhesion of bacteria and adhesion of tumor cells have much in common, especially the participation of lectins in this process. In the future it might be possible to inhibit the metastatic process into the liver (e.g. during surgical operations of malignant tumors) and bacterial adherence to mucosal linings or plastic devices by blocking of adhesion molecules (lectins) with appropriate glycoconjugates. Initial clinical trials are very promising.

The obvious ability of certain lectins to activate (non)specific defence mechanisms supports the assumption that lectin-carbohydrate interactions may induce clinically beneficial immunomodulation. Recent investigations proved that lectins, especially small, nontoxic doses of the galactoside-specific lectin from mistletoe (ML), have immunomodulatory potency (Gabius 1987; Beuth et al. 1991, 1992a, b; Gabius and Gabius 1991).