Search

Rice yellow mottle virus in Senegal is reported here for the first time. The near-complete genomic sequences of two isolates (Se1 and Se5) were obtained. A comparison with 18 sequences from West Africa revealed a new cluster with an isolate from Gambia, located at a basal position in the phylogenetic tree.

Rice yellow mottle virus (RYMV) in Madagascar Island provides an opportunity to study the spread of a plant virus disease after a relatively recent introduction in a large and isolated country with a heterogeneous host landscape ecology. Here, we take advantage of field survey data on the occurrence of RYMV disease throughout Madagascar dating back to the 1970s, and of virus genetic data from ninety-four isolates collected since 1989 in most regions of the country to reconstruct the epidemic history. We find that the Malagasy isolates belong to a unique recombinant strain that most likely entered Madagascar through a long-distance introduction from the most eastern part of mainland Africa. We infer the spread of RYMV as a continuous process using a Bayesian statistical framework. In order to calibrate the time scale in calendar time units in this analysis, we pool the information about the RYMV evolutionary rate from several geographical partitions. Whereas the field surveys and the phylogeographic reconstructions both point to a rapid southward invasion across hundreds of kilometers throughout Madagascar within three to four decades, they differ on the inferred origin location and time of the epidemic. The phylogeographic reconstructions suggest a lineage displacement and unveil a re-invasion of the northern regions that may have remained unnoticed otherwise. Despite ecological differences that could affect the transmission potential of RYMV in Madagascar and in mainland Africa, we estimate similar invasion and dispersal rates. We could not identify environmental factors that have a relevant impact on the lineage dispersal velocity of RYMV in Madagascar. This study highlights the value and complementarity of (historical) nongenetic and (more contemporaneous) genetic surveillance data for reconstructing the history of spread of plant viruses., info:eu-repo/semantics/published

The full-length genomes of two isolates of Rice yellow mottle virus from Ethiopia were sequenced. A comparison with 28 sequences from East Africa showed that they clustered within a new strain named S4et, related to the S4mg and S4ug strains found in the Lake Victoria Basin and Madagascar, respectively.

Five isolates of Rice yellow mottle virus from western Kenya were fully sequenced. One isolate of strain S4lv had been collected in 1966. Two isolates belonged to the emerging strain S4ug recently described in Uganda. Two isolates collected in 2012 are putative recombinants between the S4lv and S4ug strains.

UMR BFP - Equipe Virologie UMR BFP - Equipe VirologieUMR BFP - Equipe Virologie; National audience

Quand l'écologie pose son diagnostic. L'actualité nous le rappelle sans cesse : les maladies comme le paludisme, le Sida, ébola ou zika sont difficiles à combattre, et les maladies chroniques de type cancer, diabète ou maladies cardio-vasculaires toujours plus meurtrières. Pour la première fois de son histoire, l'humanité voit même son espérance de vie diminuer. Pour comprendre les raisons de cette crise sanitaire, l'écologie scientifique pose un autre regard sur la santé qui prend en considération les transformations de l'environnement et l'évolution de nos modes de vie. Cette nouvelle approche évolutive et écologique des problèmes de santé tente d'élucider les mécanismes en jeu dans la transmission et l'émergence de nouveaux pathogènes, mais aussi dans la résistance toujours croissante aux antibiotiques. Elle permet de mesurer l'effet des facteurs environnementaux sur la santé : concentration urbaine et industrielle et nouveaux comportements induits en matière d'alimentation et d'activités physiques. Cet ouvrage rédigé par des spécialistes issus des laboratoires du CNRS ou associés fait le point sur les recherches en écologie de la santé. Il permet à chacun de comprendre pourquoi il est essentiel de remonter aux sources environnementales et comportementales de nos maux, et de ne pas se limiter aux symptômes.

International audience

National audience

International audience

International audience

Rice grassy stunt virus (RGSV, Tenuivirus) recently emerged on rice in Vietnam, causing high yield losses during 2006-2009. The genetic diversity of RGSV is poorly documented. In this study, the two genes encoded by each ambisense segment RNA3 and RNA5 of RGSV isolates from six provinces of South Vietnam were sequenced. P3 and Pc3 (RNA3) have unknown function, P5 (RNA5) encodes the putative silencing suppressor, and Pc5 (RNA5) encodes the nucleocapsid protein (N). The sequences of 17 Vietnamese isolates were compared with reference isolates from North and South Philippines. The average nucleotide diversity among the isolates was low. We confirmed a higher variability of RNA3 than RNA5 and Pc3 than P3. No relationships between the genetic diversity and the geographic distribution of RGSV isolates could be ascertained, likely because of the long-distance migration of the insect vector. This data will contribute to a better understanding on the RGSV epidemiology in South Vietnam, a prerequisite for further management of the disease and rice breeding for resistance.

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.

National audience