Search

242 p. [EN] This thesis was written and is framed in a context of educational change and global challenge marked by historic events such as the Covid-19 pandemic, the conflict in Ukraine and the environmental crisis among others. As asserted in the 2022 UN’s annual ‘Progress towards the Sustainable Development Goals (SDGs) Report’: “Today, we stand on the precipice of a critical moment. Either we fail to deliver on our commitments to support the world’s most vulnerable or together we turbo-charge our efforts to rescue the SDGs and deliver meaningful progress for people and the planet by 2030” (UN, 2022, p. 4). For this reason, the pedagogical activities proposed here take on special relevance due to their suitability for the development of intercultural (Byram, 2008), global (OECD, 2018), and ecological (Dobson, 2000, 2003, 2007) citizenship competences that favour sustainable and peaceful coexistence. As stated by the OECD (2018): “Developing a global and intercultural outlook is a process -a lifelong process- that education can shape” (p.5). It is following this idea of using education as a shaping power for preparing students to seize the opportunities and face the challenges that the present context poses that this doctoral thesis is born. The spread of access to technology and the internet has made it possible to implement innovative educational approaches such as Virtual Exchange (VE) for such an endeavour . VE is an umbrella term used to refer to the engagement of groups of learners in online language and intercultural interaction and collaboration with partners from other cultural contexts or geographical locations as an integrated part of course work, and under the guidance of educators and/or expert facilitators (O’Dowd, 2018). Given that the number of students who spend a period of their university studies abroad is very low, such educational experience is key to the democratisation of access to intercultural learning as it offers students the possibility to interact and learn in an intercultural environment through the mediation of technology, without the need to travel abroad (De Wit, 2016). Consequently, in recent decades, the implementation and recognition of VE has grown progressively and exponentially. Numerous studies and research projects have been carried out by educators that have explored and acknowledged the value of involving students in VE. These have been implemented from multiple approaches with well-documented success in developing numerous skill sets such as Foreign Language (FL) proficiency, Intercultural Competence (IC), cultural awareness or global citizenship which are key to live and thrive in the present context (Furstenberg et al., 2001; O'Dowd, 2003; Belz, 2004; Brammerts, 2006; Müller-Hartmann, 2007; Guth and Helm, 2010; Chun, 2015; Lindner, 2016; O’Dowd, 2019). However, the potential of VE for the development of ecological citizenship, has not yet been exploited as it could, despite the urgency of training students to meet the eminent challenges posed by the environmental crisis. In response to this gap, this research has explored the knowledge, skills, attitudes and values students develop as a result of being exposed to an authentic experience of intercultural interaction and collaboration that enables them to better understand the local and global dimensions of environmental challenges as well as the possibilities for sustainable development. At the same time, this study aims to introduce this theme into the debate on VE with a view to promoting a global and ecological culture in university FL education. The aims of this research were: (1) to determine how the objectives of global and ecological citizenship can be integrated into the field of FL education through VE (proposal of a VE model), (2) to identify the observed learning outcomes, (3) to compare and contrast the possibilities of bilingual and lingua franca approaches, and (4) to explore how teachers can support students in their learning all within the framework of the VE model developed. To this end, an Action Research (AR) methodology was adopted. This methodology consisted of the design and implementation of two iterative cycles in which the VE model was tested and refined following the phases of planning, action taking, evaluation and refinement or reconceptualisation. Each VE intervention was designed on the basis of a literature review and the systematic collection of qualitative self-reporting and interactional data. Learning was measured through triangulation of these various sources of qualitative information over a two-year period in which two iterative cycles were implemented with 3 cohorts of students. In the first iteration, a telecollaborative bilingual-bicultural approach was adopted (see Dooly, 2017 and O’Dowd, 2016 for overviews) in which two groups of learners from Spain and Ireland studying each other's languaculture (Agar, 1994) communicated and collaborated using both languages. During the second iteration, a lingua franca approach was adopted (Kohn & Hoffstaedter, 2017) and students from Spain participated in a VE with a German partner class using English for communication and collaboration around issues of global relevance that go beyond explicit bicultural comparison (O'Dowd, 2019). The adoption of both approaches offers the opportunity to compare and contrast the possibilities of each telecollaborative learning configuration in order to reach reliable conclusions about their effectiveness for the implementation of the VE model developed. It also contributes to the need for further replication studies that aim to confirm the learning outcomes of specific VE approaches due to the heterogeneous nature of this pedagogical approach (O’Dowd, 2021b). Examples of such studies can be found in European Erasmus+ projects such as EVALUATE (EVALUATE group, 2019) or EVOLVE (EVOLVE Project Team, 2020) which examine the impact of the class-to-class VE model on large cohorts of students or the recent study by O'Dowd (2021b) in which the differences between these two approaches are analysed. The multiple iterations combined with the systematic collection and triangulation of varied data sources, allowed for the identification of the answers to the research questions and contributed in turn to the conceptualisation and evolution of the VE model designed in this study. Key reference works such as the Common European Framework of Reference for Languages (CEFR) (Council of Europe, 2001, 2018b, 2020) for the development of language skills in English, the Global Competences Framework (OECD, 2018) and Dobson's (2000, 2003, 2007) notions of the virtues of the ecological citizen were used for the interpretation and analysis of the data collected. The main outcome of this study is an evidence-based understanding of the possibilities of VEs to develop FL, global and ecological competences through both bilingual and lingua franca approaches. The VEs implemented and the final model developed were efforts to create opportunities to guide learners in building their intercultural, global and ecological profile to successfully cope with the present context made possible by the opportunities that technological mediation offers educators today. Furthermore, the study also identifies key aspects to be considered by teachers when designing and implementing VEs for the development of these competences. In addition, the study provides a VE model comprising specific tasks and materials ready to be used and/or adapted by other FL teachers who wish to introduce the global and ecological perspective into their classrooms.

Background Internet-based Cognitive Behaviour Therapy (iCBT) for depression have been implemented in routine care across Europe in varying ways, at various scales and with varying success. This study aimed to advance our understanding of organisational implementation climate from the perspectives of implementers and mental health service deliverers. Methods Qualitative and quantitative methods were combined to study the concept of organisational implementation climate in mental health care settings. Based on concept mapping, a qualitative workshop with implementers was used to conceptualise organisational implementation climate for optimizing iCBT use in routine practice. Service deliverers involved in the provision of iCBT were invited to participate in an explorative cross-sectional survey assessing levels of satisfaction and usability of iCBT, and organisational implementation climate in implementing iCBT. The two methods were applied independently to study viewpoints of implementers as well as service deliverers. Corresponding to the explorative nature of the study, inductive reasoning was applied to identify patterns and develop a reasonable explanation of the observations made. Correlative associations between satisfaction, usability and implementation climate were explored. Results Sixteen implementers representing fourteen service delivery organisations across Europe participated in the workshop. The top-three characteristics of a supportive organisational implementation climate included: (1) clear roles and skills of implementers, (2) feasible implementation targets, and (3) a dedicated implementation team. The top-three tools for creating a supportive implementation climate included: (1) feedback on job performance, (2) progress monitoring in achieving implementation targets, and (3) guidelines for assessing the impact of iCBT. The survey (n=111) indicated that service providers generally regarded their organisational implementation climate as supportive in implementing iCBT services. Organisational implementation climate was weakly associated with perceived usability and moderately with satisfaction with iCBT services. Conclusions Organisational implementation climate is a relevant factor to implementers and service deliverers in implementing iCBT in routine care. It is not only an inherent characteristic of the context in which implementation takes place, it can also be shaped to improve implementation of iCBT services. Future research should further theorise organisational implementation climate and empirically validate the measurement instruments such as used in this study.

This paper examines a Virtual Exchange (VE) amongst 42 participants which took place with University of Limerick business students and Universidad of León tourism students. The primary aims of the VE were the development of disciplinary, language and intercultural skills. As part of the VE, students had to carry out a series of telecollaborative tasks over 10 weeks. For both groups, the final product of this project was a promotional video exhibiting places within Ireland and Spain. The main objective here was to attract tourism based on sustainable practices while learning and promoting their own heritage and local communities. This paper presents the project design, the tasks that the students carried out, together with some of the learning outcomes. This VE between students of the same age, sharing similar modules and personal interests, and with a strong curiosity for each other’s language and culture was highly motivational. The VE achieved the objectives of developing intercultural awareness and professional skills while covering curricula contents and objectives.

This report presents the findings of one of the studies carried out by the Erasmus+ KA3 project EVOLVE (www.evolve-erasmus.eu). Situated in the project’s wider context of mainstreaming VE as innovative practice in HE in Europe and beyond, the focus of the current study is on the impact of Virtual Exchange (VE) on student learning in Higher Education (HE). Based on student data collected from 16 exchange projects between 34 partners from HEIs in Europe and other parts of the globe, it looks into students’ general perceptions and appreciation of VE and the development of intercultural competences, critical digital literacy, language skills and disciplinary learning.

Lo que hemos llamado el “Equipo B” de defensa bibliotecaria es un pequeño grupo de valientes profesionales que luchan por dignificar la profesión, mejorar cada día en su trabajo y dar visibilidad a la figura del bibliotecario. Todos los que formamos parte de este peculiar equipo somos bibliotecarios municipales, que llevamos ya unos cuantos lustros trabajando en bibliotecas y que, más allá de nuestras diferentes experiencias y nuestras propias y personales historias, somos unos apasionados de las bibliotecas, amamos nuestro trabajo y luchamos cada día por mejorar y dignificar nuestra profesión

En el siglo XXI se lee poco, rápido y de manera superficial. Se comenta la necesidad, por parte de las instituciones públicas y privadas, de fomentar y promover la lectura. Para ello, se propone la consolidación de las redes bibliotecarias en España, con servicios de calidad, profesionales suficientes y buenas colecciones. Castilla La Mancha Consejería de Educación y Ciencia. Dirección General de Coordinación y Política Educativa; Bulevar del Río Alberche, s. n. - 2 Planta; 45071 Toledo; Tel. +34925247481; Fax +34925247482 ESP

In vivo el tratamiento con la 1,25-(OH)2D3 a ratas no diabéticas no causó ninguna modificación de los parámetros estudiados en orina y sangre, pero sí un aumento del peso corporal de estos animales. El hígado y el riñón podrían haber sufrido una hipertrofia. La expresión del gen del IR fue inhibida en el tejido adiposo perirrenal y no se alteró en el hígado, riñón, ni en el tejido adiposo epididimal. En este último tejido, ni el número de IRs, ni el transporte de glucosa estimulado por insulina ni la oxidación de glucosa estimulada por insulina resultaron modificados por el tratamiento con la 1,25-(OH)2D3. Por otro lado, hemos observado que el tratamiento con 1,25-(OH)2D3 a ratas diabéticas por estreptozotocina revirtió la perdida de peso ocasionada por la diabetes, contrarrestando en parte la presencia de leucocitos en orina, pero acidificando aún más su pH. En el plasma no fue capaz de revertir ni la hiperglucemia ni la hipoinsulinemia producida por la diabetes, mientras que incrementó los niveles de fósforo. El tratamiento con 1,25-(OH)2D3 no revirtió ninguno de los parámetros tisulares alterados por la diabetes, con la excepción de disminuir el contenido en proteínas del tejido adiposo perirrenal. Tampoco modificó el incremento del ARNm del IR causado por la diabetes en el hígado, ni en el riñón, pero si en el tejido adiposo epididimal. En este último tejido no alteró ni el número de Irs, ni la afinidad de estos receptores. El tratamiento con 1,25-(OH)2D3 a ratas diabéticas no modificó la inhibición inducida por la diabetes del transporte ni la oxidación de glucosa basal, tampoco las modificó cuando ambas actividades fueron estimuladas por la insulina. In vitro el tratamiento con la 1,25-(OH)2D3 al concentración 10-8 M durante 24 h, a través de su receptor VDR, es capaz de incrementar la expresión del gen del IR y la proteína por él codificada, dando lugar a un incremento de ciertas actividades biológicas de la insulina como el transporte y la oxidación de glucosa. La regulación primaria tiene lugar a nivel trancripcional a través de un VDRE (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), localizado en el promotor del gen del IR, concretamente entre -758 y -774 pb y solapado con un sitio AP-2

Se publica la relación de documentos histórico-educativos guardados en la Biblioteca del Museo Pedagógico Nacional, creado en 1882 y extinguido en 1941. El material incluye fondos bibliográficos españoles y de otros países europeos publicados en el siglo XIX y su abundancia ha obligado a realizar el proceso de ordenación y sistematización en varias etapas. En primer lugar, se ha catalogado el fondo español, que ha sido dividido en dos períodos: el primero, abarca hasta el año de promulgación de la primera ley de educación en España, la llamada Ley Moyano en 1857, y el segundo comprende la otra mitad del siglo. En este número, se da a conocer la relación de las obras, ordenadas por las notaciones de la Clasificación Decimal Universal, correspondientes a la segunda mitad del siglo. Ministerio Educación CIDE Biblioteca de Educación del Ministerio de Educación, Cultura y Deporte; Calle San Agustín, 5 - 3 Planta; 28014 Madrid; Tel. +34917748000; biblioteca@mecd.es ESP

Se publica la relación de documentos histórico-educativos guardados en la Biblioteca del Museo Pedagógico Nacional, creado en 1882 y extinguido en 1941. El material incluye fondos bibliográficos españoles y de otros países europeos publicados en el siglo XIX y su abundancia ha obligado a realizar el proceso de ordenación y sistematización en varias etapas. En primer lugar, se ha catalogado el fondo español, que ha sido dividido en dos períodos: el primero, abarca hasta el año de promulgación de la primera ley de educación en España, la llamada Ley Moyano en 1857, y el segundo comprende la otra mitad del siglo. En este número, se da a conocer la relación de las obras, ordenadas por las notaciones de la Clasificación Decimal Universal, correspondientes a la segunda mitad del siglo. Ministerio Educación CIDE Biblioteca de Educación del Ministerio de Educación, Cultura y Deporte; Calle San Agustín, 5 - 3 Planta; 28014 Madrid; Tel. +34917748000; biblioteca@mecd.es ESP

Se publica la relación de documentos histórico-educativos guardados en la Biblioteca del Museo Pedagógico Nacional, creado en 1882 y extinguido en 1941. El material incluye fondos bibliográficos españoles y de otros países europeos publicados en el siglo XIX y su abundancia ha obligado a realizar el proceso de ordenación y sistematización en varias etapas. En primer lugar, se ha catalogado el fondo español, que ha sido dividido en dos períodos: el primero, abarca hasta el año de promulgación de la primera ley de educación en España, la llamada Ley Moyano en 1857, y el segundo, comprende la otra mitad del siglo. En este número, se da a conocer la relación de las obras, organizadas conforme a las notaciones de la Clasificación Decimal Universal, correspondientes a la primera mitad del siglo, quedando el resto para próximas entregas. Ministerio Educación CIDE Biblioteca de Educación del Ministerio de Educación, Cultura y Deporte; Calle San Agustín, 5 - 3 Planta; 28014 Madrid; Tel. +34917748000; biblioteca@mecd.es ESP

Se ponen de manifiesto ciertos aspectos que hacen de la Formación Profesional una enseñanza de aprecio muy limitado por parte de la sociedad. Dentro de la Ley General de Educación de 1970, la Formación Profesional no constituye ningún nivel educativo ni forma parte de ningún otro, además, el tratamiento que se le da está lleno de contradicciones y prejuicios. Se presentan una serie de datos estadísticos sobre los aspectos más significativos de la Formación Profesional con el fin de obtener una valoración más exacta del espacio ocupado por estas enseñanzas y del peso real que adquiere dentro del sistema educativo. Los indicadores que se exponen para obtener esta valoración son: el número de puestos escolares, la evolución de la matrícula, medios didácticos y el fracaso escolar. Ministerio Educación CIDE Biblioteca de Educación del Ministerio de Educación, Cultura y Deporte; Calle San Agustín, 5 - 3 Planta; 28014 Madrid; Tel. +34917748000; biblioteca@mecd.es ESP

Estudiar la evolución de la Formación Profesional en España durante el periodo de 1970 a 1989. Durante la segunda mitad del siglo XIX y el primer cuarto del siglo XX el desarrollo de las enseñanzas técnico-profesionales en España está marcado por las innumerables reformas que se han ido sucediendo sin que llegue a consolidarse ninguna hasta las reformas de 1928, 1955 y la de 1970. La reforma de 1970 se caracteriza por el intento de conjugar la continuación de la formación integral con la capacitación para el ejercicio de una profesión y la posibilidad de continuar siempre estudios a un nivel superior. La normativa legal que regula la FP está llena de contradicciones. Se establece un sistema mixto en el que, al lado de prácticas en las empresas en alternancia con los estudios en los centros docentes, sin embargo, estas previsiones sólo empiezan a desarrollarse tímidamente a partir de 1983. La Formación Profesional de primer grado, a pesar de un incremento progresivo de alumnos, no ha conseguido mejorar la imagen de enseñanza de segunda categoría que tuvo, principalmente porque no ha llegado a cumplir nunca los objetivos que teóricamente se le asignaron. El fracaso de la Formación Profesional de primer grado representa el fracaso de una política educativa que nunca ha dedicado la atención requerida a los alumnos que, en un alto porcentaje, el sistema educativo había marginado en el momento más delicado de su educación. Madrid ESP