Search

IntroductionCuring is a critical process that determines the sensory quality of cigars. The impact of oxygen on cigar curing and the mechanisms by which it regulates microbial changes affecting cigar quality are not well understood.MethodsIn this study, we selected handmade cigars from the same batch and conducted curing experiments in environments with varying oxygen concentrations (equivalent to 0.1%, 6–12, and 15% of atmospheric oxygen concentration). We collected samples over 60 days and analyzed the distribution of microbial communities using high-throughput sequencing. Combined with the analysis of total sugars, proteins, flavor substances, and other chemical compounds, we elucidated how different oxygen concentrations affect the cigar curing process, influence microbial community succession, and ultimately impact cigar quality.ResultsOur results revealed significant differences in bacterial community composition under different oxygen conditions. Under aerobic conditions, Cyanobacteria were the dominant bacteria, while under oxygen-limited conditions, Staphylococcus and Corynebacterium predominated. As oxygen concentration decreased, so did the richness and diversity of the bacterial community. Conversely, oxygen concentration had a lesser impact on fungi; Aspergillus was the dominant genus in all samples. We also found that Enterococcus showed a positive correlation with aspartic acid, alanine, and 4-aminobutyric acid and a negative correlation with cysteine. Cigars cured at 15% oxygen concentration for 60 days exhibited optimal quality, particularly in terms of flavor richness and sweetness.DiscussionThese findings suggest that oxygen concentration can alter cigar quality by regulating aerobic and anaerobic microbial community succession. The relationship between specific microbial communities and flavor compounds also provides a theoretical reference for developing artificial control technologies in the cigar curing process.

Transcription factors play an indispensable role in maintaining cellular viability and finely regulating complex internal metabolic networks. These crucial bioactive functions rely on their ability to respond to effectors and concurrently interact with binding sites. Recent advancements have brought innovative insights into the understanding of transcription factors. In this review, we comprehensively summarize the mechanisms by which transcription factors carry out their functions, along with calculation and experimental-based methods employed in their identification. Additionally, we highlight recent achievements in the application of transcription factors in various biotechnological fields, including cell engineering, human health, and biomanufacturing. Finally, the current limitations of research and provide prospects for future investigations are discussed. This review will provide enlightening theoretical guidance for transcription factors engineering.

Bacillus licheniformis is recognised as an exceptional expression platform in biomanufacturing due to its ability to produce high-value products. Consequently, metabolic engineering of B. licheniformis is increasingly pursued to enhance its utility as a biomanufacturing vehicle. Effective B. licheniformis cell factories require promoters that enable regulated expression of target genes. This review discusses recent advancements in the characterisation, synthesis, and engineering of B. licheniformis promoters. We highlight the application of constitutive promoters, quorum sensing promoters, and inducible promoters in protein and chemical synthesis. Additionally, we summarise efforts to expand the promoter toolbox through hybrid promoter engineering, transcription factor-based inducible promoter engineering, and ribosome binding site (RBS) engineering.

Bacillus licheniformis is a significant industrial microorganism. Traditional gene editing techniques relying on homologous recombination often exhibit low efficiency due to their reliance on resistance genes. Additionally, the established CRISPR gene editing technology, utilizing Cas9 endonuclease, faces challenges in achieving simultaneous knockout of multiple genes. To address this limitation, the CRISPR-Cpf1 system has been developed, enabling multiplexed gene editing across various microorganisms. Key to the efficient gene editing capability of this system is the rigorous screening of highly effective expression elements to achieve conditional expression of protein Cpf1. In this study, we employed mCherry as a reporter gene and harnessed Pmal for regulating the expression of Cpf1 to establish the CRISPR-Cpf1 gene editing system in Bacillus licheniformis. Our system achieved a 100 % knockout efficiency for the single gene vpr and up to 80 % for simultaneous knockout of the double genes epr and mpr. Furthermore, the culture of a series of protease-deficient strains revealed that the protease encoded by aprE contributed significantly to extracellular enzyme activity (approximately 80 %), whereas proteases encoded by vpr, epr, and mpr genes contributed to a smaller proportion of extracellular enzyme activity. These findings provide support for effective molecular modification and metabolic regulation in industrial organisms.

Abstract Bacillus licheniformis and its related strains have found extensive applications in diverse industries, agriculture, and medicine. However, the current breeding methods for this strain primarily rely on natural screening and traditional mutagenesis. The limited availability of efficient genetic engineering tools, particularly recombination techniques, has hindered further advancements in its applications. In this study, we conducted a comprehensive investigation to identify and characterize a recombinase, RecT, derived from a Bacillus phage. Remarkably, the recombinase exhibited a 105-fold enhancement in the recombination efficiency of the strain. To facilitate genome editing, we developed a system based on the conditional expression of RecT using a rhamnose-inducible promoter (Prha). The efficacy of this system was evaluated by deleting the amyL gene, which encodes an α-amylase. Our findings revealed that the induction time and concentration of rhamnose, along with the generation time of the strain, significantly influenced the editing efficiency. Optimal conditions for genome editing were determined as follows: the wild-type strain was initially transformed with the genome editing plasmid, followed by cultivation and induction with 1.5% rhamnose for 8 h. Subsequently, the strain was further cultured for an additional 24 h, equivalent to approximately three generations. Consequently, the recombination efficiency reached an impressive 16.67%. This study represents a significant advancement in enhancing the recombination efficiency of B. licheniformis through the utilization of a RecT-based recombination system. Moreover, it provides a highly effective genome editing tool for genetic engineering applications in this strain.

Abstract A significant distinction between cigar production and tobacco lies in the necessary aging process, where intricate microbial growth, metabolic activities, enzymatic catalysis, and chemical reactions interact. Despite its crucial role in determining the final quality of cigars, our comprehension of the underlying chemical and biological mechanisms within this process remains insufficient. Biomass and alkaloids are the primary constituents that influence the flavor of cigars. Consequently, investigating the entire aging process could begin by exploring the involvement of microbes and enzymes in their biodegradation. In this study, handmade cigars were aged under different conditions. Metagenomic sequencing was employed to identify the microbes and enzymes responsible for the degradation of biomass and alkaloids derived from tobacco leaves. The results revealed that various environmental factors, including temperature, humidity, duration time, and turning frequency, yielded varying contents of total sugar and alkaloids in the cigars. Significant correlations were observed between microbial communities and starch, reducing sugars, total sugars, and alkaloids. Key species involved in the breakdown of biomass constituents, such as starch (Bacillus pumilus, Pseudomonas sp. 286, and Aspergillus cristatus), reducing sugars and total sugars (Aspergillus cristatus and Nitrolancea hollandica), were identified. Furthermore, Corynespora cassiicola and Pseudomonas fulva were found to potentially contribute to the degradation of alkaloid compounds, specifically nornicotine and neonicotinoid. Our work contributes to a deeper understanding of the microbial roles in the aging of cigars. Moreover, the selection of specific microbial strains or starter cultures can be employed to control and manipulate the aging process, thereby further refining the flavor development in cigar products. Graphical Abstract

Background: Nitrogen sources play an essential role in maintaining the physiological and biochemical activity of bacteria. Nitrogen metabolism, which is the core of microorganism metabolism, makes bacteria able to autonomously respond to different external nitrogen environments by exercising complex internal regulatory networks to help them stay in an ideal state. Although various studies have been put forth to better understand this regulation in Bacillus, and many valuable viewpoints have been obtained, these views need to be presented systematically and their possible applications need to be specified. Aim of review: The intention is to provide a deep and comprehensive understanding of nitrogen metabolism in Bacillus, an important industrial microorganism, and thereby apply this regulatory logic to synthetic biology to improve biosynthesis competitiveness. In addition, the potential researches in the future are also discussed. Key scientific concept of review: Understanding the meticulous regulation process of nitrogen metabolism in Bacillus not only could facilitate research on metabolic engineering but also could provide constructive insights and inspiration for studies of other microorganisms.

Background: Selenium (Se) pollution poses serious threats to terrestrial ecosystems. Mushrooms are important sources of Se with the potential for bioremediation. Pre-eminent Se resources must possess the ability to tolerate high levels of Se. To obtain Se-accumulating fungi, we isolated selenite-tolerance-enhanced Ganoderma lucidum JNUSE-200 through adaptive evolution. Methods: The molecular mechanism responsible for selenite tolerance and accumulation was explored in G. lucidum JNUSE-200 by comparing it with the original strain, G. lucidum CGMCC 5.26, using a combination of physiological and transcriptomic approaches. Results: G. lucidum JNUSE-200 demonstrated tolerance to 200 mg/kg selenite in liquid culture and exhibited normal growth, whereas G. lucidum CGMCC 5.26 experienced reduced growth, red coloration, and an unpleasant odor as a result of exposure to selenite at the same concentration. In this study, G. lucidum JNUSE-200 developed a triple defense mechanism against high-level selenite toxicity, and the key genes responsible for improved selenite tolerance were identified. Conclusions: The present study offers novel insights into the molecular responses of fungi towards selenite, providing theoretical guidance for the breeding and cultivation of Se-accumulating varieties. Moreover, it significantly enhances the capacity of the bio-manufacturing industry and contributes to the development of beneficial applications in environmental biotechnology through fungal selenite transformation bioprocesses.

Bacillus licheniformis is one of the most characteristic Gram-positive bacteria. Its unique genetic background and safety characteristics make it have important biologic applications in the food industry, including, the biosynthesis of high value-added bioproducts, probiotic functions, biological treatment of wastes derived from food production, etc. In this review, these recent advances are summarized and presented systematically for the first time. In addition, we highlight synthetic biology strategies as a potential driver of developing this strain for wider and more efficient application in the food industry. Finally, we present the current challenges faced and provide our unique perspective on relevant future research directions. In summary, this review will provide an illuminating and comprehensive perspective that will allow an in-depth understanding of B. licheniformis and promote its more effective development in the food industry.

Abstract Synthetic biology has rapidly advanced from the setup of native genetic devices to the design of artificial elements able to provide organisms with highly controllable functions. In particular, genetic switches are crucial for deploying new layers of regulation into the engineered organisms. While the assembly and mutagenesis of native elements have been extensively studied, limited progress has been made in rational design of genetic switches due to a lack of understanding of the molecular mechanism by which a specific transcription factor interacts with its target gene. Here, a reliable workflow is presented for designing two categories of genetic elements, one is the switch element-MtlR box and the other is the transcriptional regulatory element- catabolite control protein A (CcpA) box. The MtlR box was designed for ON/OFF-state selection and is controlled by mannitol. The rational design of MtlR box-based molecular structures can flexibly tuned the selection of both ON and OFF states with different output switchability in response to varied kind effectors. Different types of CcpA boxes made the switches with more markedly inducer sensitivities. Ultimately, the OFF-state value was reduced by 90.69%, and the maximum change range in the presence of two boxes was 15.31-fold. This study presents a specific design of the switch, in a plug-and-play manner, which has great potential for controlling the flow of the metabolic pathway in synthetic biology. Graphical Abstract

Washing machines are one of the tools that bring great convenience to people’s daily lives. However, washing machines that have been used for a long time often develop issues such as odor and mold, which can pose health hazards to consumers. There exists a conspicuous gap in our understanding of the microorganisms that inhabit the inner workings of washing machines. In this study, samples were collected from 22 washing machines in Shanghai, China, including both water eluted from different parts of washing machines and biofilms. Quantitative qualitative analysis was performed using fluorescence PCR quantification, and microbial communities were characterized by high-throughput sequencing (HTS). This showed that the microbial communities in all samples were predominantly composed of bacteria. HTS results showed that in the eluted water samples, the bacteria mainly included Pseudomonas, Enhydrobacter, Brevibacterium, and Acinetobacter. Conversely, in the biofilm samples, Enhydrobacter and Brevibacterium were the predominant bacterial microorganisms. Correlation analysis results revealed that microbial colonies in washing machines were significantly correlated with years of use and the type of detergent used to clean the washing machine. As numerous pathogenic microorganisms can be observed in the results, effective preventive measures and future research are essential to mitigate these health problems and ensure the continued safe use of these household appliances.

TrLipE is a thermophilic lipase that has potential commercial applications because of its catalytic ability under extreme conditions. Consistent with most lipases, the lid of TrLipE is located over the catalytic pocket, controls the substrate channel to the active center, and regulates the substrate specificity, activity, and stability of the enzyme through conformational changes. TrLipE from Thermomicrobium roseum has potential industrial applications, which is hindered by its weak enzymatic activity. Here, 18 chimeras (TrL1-TrL18) were reconstructed by N-terminal lid swapping between TrLipE and structurally similar enzymes. The results showed that the chimeras had a similar pH range and optimum pH as wild TrLipE but a narrower temperature range of 40–80°C, and TrL17 and the other chimeras showed lower optimum temperatures of 70°C and 60°C, respectively. In addition, the half-lives of the chimeras were lower than those of TrLipE under optimum temperature conditions. Molecular dynamics simulations indicated that chimeras had high RMSD, RMSF, and B-factor values. When p-nitrophenol esters with different chains were used as substrates, compared with TrLipE, most of the chimeras had a low Km and high kcat value. The chimeras TrL2, TrL3, TrL17, and TrL18 could specifically catalyze the substrate 4-nitrophenyl benzoate, with TrL17 showing the highest kcat/Km value of 363.88 ± 15.83 L⋅min–1⋅mmol–1. Mutants were then designed by investigating the binding free energies of TrL17 and 4-nitrophenyl benzoate. The results indicated that single, double, and triple substitution variants (M89W and I206N; E33W/I206M and M89W/I206M; and M89W/I206M/L21I and M89W/I206N/L21I, respectively) presented approximately 2- to 3-fold faster catalysis of 4-nitrophenyl benzoate than the wild TrL17. Our observations will facilitate the development of the properties and industrial applications of TrLipE.

Catabolite control protein A (CcpA) is a critical regulator in Gram-positive bacteria that orchestrates carbon metabolism by coordinating the utilization of different carbon sources. Although it has been widely proved that CcpA helps prioritize the utilization of glucose over other carbon sources, this global regulator’s precise mechanism of action remains unclear. In this study, a mutant Bacillus licheniformis deleted for CcpA was constructed. Cell growth, carbon utilization, metabolites and the transcription of key enzymes of the mutant strain were compared with that of the wild-type one. It was found that CcpA is involved in the regulation of glucose concentration metabolism in Bacillus. At the same time, CcpA regulates glucose metabolism by inhibiting acetic acid synthesis and pentose phosphate pathway key gene zwF. The conversion rate of acetic acid is increased by about 3.5 times after ccpA is deleted. The present study provides a new mechanism of carbon metabolism and acetic acid balance regulated by CcpA. On the one hand, this work deepens the understanding of the regulatory function of CcpA and provides a new view on the regulation of glucose metabolism. On the other hand, it is helpful to the transformation of B. licheniformis chassis microorganisms.

Summary Small peptides are a group of natural products with low molecular weights and complex structures. The diverse structures of small peptides endow them with broad bioactivities and suggest their potential therapeutic use in the medical field. The remaining challenge is methods to address the main limitations, namely (i) the low amount of available small peptides from natural sources, and (ii) complex processes required for traditional chemical synthesis. Therefore, harnessing microbial cells as workhorse appears to be a promising approach to synthesize these bioactive peptides. As an emerging engineering technology, synthetic biology aims to create standard, well‐characterized and controllable synthetic systems for the biosynthesis of natural products. In this review, we describe the recent developments in the microbial production of small peptides. More importantly, synthetic biology approaches are considered for the production of small peptides, with an emphasis on chassis cells, the evolution of biosynthetic pathways, strain improvements and fermentation.

Carbon-based nanoprobes, with excellent physicochemical performance and biocompatibility, are a kind of ideal nanomaterial for biosensing. Herein, we designed and prepared novel oxygen-doped nitrogen-enrichment carbon nanoribbons (ONCNs) with an excellent optical performance and uniform morphology, which could be used as a dual-mode fluorescence probe for the detection of Ag+ ion and captopril (Ctl) based on the synergism of photo-induced electron transfer and aggregation-induced quenching mechanisms. By recording the changes in fluorescent intensities of ONCNs, the Ag+ ion and Ctl concentrations can be easily tested in real samples. The results displayed that two good linear relationships existed between the change in fluorescent intensity of ONCNs and the concentrations of Ag+ ion and Ctl in the ranges of 3 μM to 30 μM and 1 μM to 30 μM, with the detection limit of 0.78 µM and 74 nM, respectively. The proposed sensing platform has also been successfully applied for the Ctl analysis in commercial tablet samples based on its high selectivity, proving its value in practical applications.

Summary Ganoderic acid (GA), an important secondary metabolite of Ganoderma lucidum, exhibited many significant pharmacological activities. In this study, the biosynthetic mechanism of GAs was investigated by comparing metabolites and transcriptome dynamics during liquid superficial‐static culture (LSSC) and submerged culture (SC). LSSC was a better method to produce GA because thirteen GAs were identified from mycelia by UPLC‐QTOF‐MS, and the content of all GAs was higher in LSSC than in SC. Ergosterol was accumulated during the SC process in G. lucidum. Transcriptome dynamics analysis revealed CYP5150L8 was the key gene regulating lanosterol flux into GA biosynthesis. Other sixteen CYP450 genes were significantly higher expressed during the culture time in LSSC and could be potential candidate genes associated with the biosynthesis of different GAs. In addition, six of the ten expressed genes in ergosterol biosynthetic pathway shown upregulated at some time points in SC. These results not only provide a fundamental information of the key genes in ergosterol and GA biosynthetic pathway, but also provide directions for future elucidating the regulatory mechanisms of GAs in G. lucidum and enabling us to promote the development and utilization of LSSC at the industrial level.

Bacillus genetics need more versatile promoters for gene circuit engineering. UP elements are widely distributed in noncoding regions and interact with the α-subunit of RNA polymerase (RNAP). They can be applied as a standard element for synthetic biology. Characterization of the binding motif between UP elements and RNAP may assist with rational and effective engineering. In this study, 11 Bacillus constitutive promoters were screened for strength in Bacillus licheniformis. The motif in UP elements from a strong native promoter, PLan, was characterized. The influence of specific sequences on RNAP binding and expression strength was investigated both in vitro and in vivo. It was found that sequences up to 50 base pairs upstream of the consensus motif significantly contributed to α-CTD (the alpha subunit carboxy-terminal domain) association. Meanwhile, two repeats of a proximal subsite were able to more strongly activate the expression (by 8.2-fold) through strengthening interactions between UP elements and RNAP. Based the above molecular basis, a synthetic UP element, UP5-2P, was constructed and applied to nine wild-type promoters. Fluorescence polarization results demonstrated that it had an apparent effect on promoter–α-CTD interactions, and elevated expression strength was observed for all the engineered promoters. The highest improved core promoter, Pacpp, was more strongly activated by 7.4-fold. This work thus develops a novel strategy for Bacillus promoter engineering.

Angiogenetic inhibitors are crucial in tumor therapy, and endogenous angiogenesis inhibitors have attracted considerable attention due to their effectiveness, safety, and multi-targeting ability. Arresten and canstatin, which have anti-angiogenesis effects, are the c-terminal fragments of the α1 and α2 chains of type IV collagen, respectively. In this study, human arresten and canstatin were recombinantly expressed in Escherichia coli (E. coli), and their effects on the proliferation, migration and tube formation of human umbilical vein endothelial cells (HUVECs) were evaluated. Regarding the cell cycle distribution test and 5-ethynyl-2′-deoxyuridine (EdU) assays, arresten and canstatin could repress the proliferation of HUVECs at a range of concentrations. Transwell assay indicated that the migration of HUVECs was significantly decreased in the presence of arresten and canstatin, while tube formation assays suggested that the total tube length and junction number of HUVECs were significantly inhibited by these two proteins; moreover, they could also reduce the expression of vascular endothelial growth factor (VEGF) and the phosphorylation levels of PI3K and Akt, which indicated that the activation of the 3-kinase/serine/threonine-kinase (PI3K/Akt) signaling pathway was inhibited. These findings may have important implications for the soluble recombinant expression of human arresten and canstatin, and for the related therapy of cancer.

Summary: Bacillus licheniformis is widely used to produce various valuable products, such as food enzymes, industrial chemicals, and biocides. The carbon catabolite regulation process in the utilization of raw materials is crucial to maximizing the efficiency of this microbial cell factory. The current understanding of the molecular mechanism of this regulation is based on limited motif patterns in protein-DNA recognition, where the typical catabolite-responsive element (CRE) motif is “TGWNANCGNTNWCA”. Here, CRETre is identified and characterized as a new CRE. It consists of two palindrome arms of 6 nucleotides (AGCTTT/AAAGCT) and an intermediate spacer. CRETre is involved in bidirectional regulation in a glucose stress environment. When AGCTTT appears in the 5′ end, the regulatory element exhibits a carbon catabolite activation effect, while AAAGCT in the 5′ end corresponds to carbon catabolite repression. Further investigation indicated a wide occurrence of CRETre in the genome of B. licheniformis.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

2-Phenylethanol (2-PE) is a valuable aromatic compound with favorable flavors and good properties, resulting in its widespread application in the cosmetic, food and medical industries. In this study, a mutant strain, AD032, was first obtained by adaptive evolution under 2-PE stress. Then, a fusion protein from the Ehrlich pathway, composed of tyrB from Escherichia coli, kdcA from Lactococcus lactis and ADH2 from Saccharomyces cerevisiae, was constructed and expressed. As a result, 3.14 g/L 2-PE was achieved using L-phenylalanine as a precursor. To further increase 2-PE production, L-glutamate oxidase from Streptomyces overexpression was applied for the first time in our research to improve the supply of α-ketoglutarate in the transamination of 2-PE synthesis. Furthermore, we found that the disruption of the pyruvate decarboxylase encoding gene PDC5 caused an increase in 2-PE production, which has not yet been reported. Finally, assembly of the efficient metabolic modules and process optimization resulted in the strain RM27, which reached 4.02 g/L 2-PE production from 6.7 g/L L-phenylalanine without in situ product recovery. The strain RM27 produced 2-PE (0.8 mol/mol) with L-phenylalanine as a precursor, which was considerably high, and displayed manufacturing potential regarding food safety and process simplification aspects. This study suggests that innovative strategies regarding metabolic modularization provide improved prospects for 2-PE production in food exploitation.

Pleurotus eryngii var. ferulae, a fungus of the genus Pleurotus, efficiently degrades lignin, especially during co-cultivation with other fungi. However, low transformation efficiency and heterologous gene expression restrict systematic studies of the molecular mechanisms and metabolic control of natural products in this mushroom. In this study, the homologous resistance marker carboxin (cbx) was used to establish a polyethylene glycol-mediated transformation (PMT) system in P. eryngii var. ferulae. Optimization of the transformation process greatly improved the number of positive transformants. In particular, we optimized: (i) protoplast preparation and regeneration; (ii) screening methods; and (iii) transformation-promoting factors. The optimized transformation efficiency reached 72.7 CFU/μg, which is higher than the average level of Pleurotus sp. (10–40 CFU/μg). Moreover, three endogenous promoters (Ppfgpd1, Ppfgpd2, and Ppfsar1) were screened and evaluated for different transcription initiation characteristics. A controllable overexpression system was established using these three promoters that satisfied various heterologous gene expression requirements, such as strong or weak, varied, or stable expression levels. This study lays the foundation for recombinant protein expression in P. eryngii var. ferulae and provides a method to investigate the underlying molecular mechanisms and secondary metabolic pathway modifications.

Amino acid efflux and influx transport systems play vital roles in industrial microorganisms’ cell growth and metabolism. However, although biochemically characterized, most of them remain unknown at the molecular level in Bacillus licheniformis. In this study, three proteins, namely, YdgF, YvbW, and YveA, were predicted to be involved in the active transport of L-aspartate (L-Asp). This was verified by manipulating their encoding genes. When growing in the minimal medium with L-Asp as the only carbon and nitrogen source, the growth of strains lacking proteins YdgF, YvbW, and YveA was significantly inhibited compared with the wild-type strains, while supplementing the expression of the corresponding proteins in the single-gene knockout strains could alleviate the inhibition. Upon overexpression, the recombinant proteins mediated the accumulation of L-aspartate to varying degrees. Compared with the wild-type strains, the single knockout strains of the three protein genes exhibited reduced absorption of L-aspartate. In addition, this study focused on the effects of these three proteins on the absorption of β-alanine, L-glutamate, D-serine, D-alanine, and glycine.

Ganoderma lucidum has been a well-known species of basidiomycetes for a long time, and has been widely applied in the fields of food and medicine. Based on the simulation results of model iZBM1060 in our previous research, the effect of L-phenylalanine on G. lucidum extracellular polysaccharides (EPSs) was investigated in this study. EPS production reached 0.91 g/L at 0.4 g/L L-phenylalanine after a 24 h culture, which was 62.5% higher than that of control (0.56 g/L). Transcriptome and genome analysis showed that L-phenylalanine deaminase and benzoate 4-hydroxylase (related to L-phenylalanine metabolism) were significantly up-regulated, while the cell wall mannoprotein gene was down-regulated. Transmission electronic microscopy (TEM) and atomic force microscopy results showed that the cell wall thickness decreased by 58.58%, and cell wall porosity increased in cells treated with L-phenylalanine, which probably contribute to the increasing EPS production. This study provides an efficient strategy for fungal polysaccharide production with high output and low cost.

Selenium biofortification of edible and medicinal mushrooms is an effective way to produce selenium-enriched food supplements. Ganoderma lucidum is the typical one with excellent biological activity. This study investigated G. lucidum growth and bioactive metabolites alterations during liquid culture with different concentrations of selenite. Low selenium levels did not affect growth and mycelia morphology, whereas high selenium levels negatively influenced growth, dramatically decreased biomass, caused nucleic acid and protein leakage, damaged cell walls and membranes, and resulted in indicators such as degraded cells, a red color, and an unpleasant odor. Through headspace-solid phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS) analysis, ten volatile Se compounds were identified in G. lucidum with 200 ppm selenite, which led to an odor change, whereas only three with 50 ppm selenite. SeMet was the major selenoamino acid in the 50 ppm selenite group by high-performance liquid chromatography-inductively coupled plasma mass spectrometry (HPLC-ICP-MS), but more MeSeCys was produced with 200 ppm selenite. Polysaccharide yields were promoted and inhibited with 50 and 200 ppm selenite, respectively. These results provide comprehensive insights into the effects of selenite on G. lucidum in liquid culture and are beneficial for functional selenium-enriched mushroom production and improving nutritive values.

In this study, we reconstructed for the first time a genome-scale metabolic model (GSMM) of Ganoderma lucidum strain CGMCC5.26, termed model iZBM1060, containing 1060 genes, 1202 metabolites, and 1404 reactions. Important findings based on model iZBM1060 and its predictions are as follows: (i) The extracellular polysaccharide (EPS) biosynthetic pathway was elucidated completely. (ii) A new fermentation strategy is proposed: addition of phenylalanine increased EPS production by 32.80% in simulations and by 38.00% in experiments. (iii) Eight genes for key enzymes were proposed for EPS overproduction. Model iZBM1060 provides a useful platform for regulating EPS production in terms of system metabolic engineering for G. lucidum, as well as a guide for future metabolic pathway construction of other high value-added edible/ medicinal mushroom species.

Bacillus licheniformis is widely used to produce multiple enzymes and chemicals in industrial fermentation. It is also an organism that is hard to genetically manipulate, which is mainly attributed to its extremely low transformation efficiency. The lack of genetic modification technology severely limits its further application. In this study, an all-in-one conditional clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 plasmid was developed for B. licheniformis with the cas9 gene under the control of a xylose-inducible promoter. By means of this design, the expression of the cas9 gene could be repressed without xylose, which significantly improved the transformation ratio from less than 0.1 cfu/μg to 2.42 cfu/μg DNA. Compared with this conditional system, a constitutive overexpression system led to significant growth retardation in bacterial cells. Both the biomass and specific growth rate decreased greatly. After transformation, successful genome editing could be triggered by 0.5% xylose. When the α-amylase gene amyL was used as a genomic target, the efficiencies of its disruption using three different protospacer-adjacent motif (PAM) sequences were 64.3%, 70.9%, and 47.1%, respectively. Moreover, temperature plays a pivotal role in the function of the constructed CRISPR system. The maximum success rate reached 97% at 20 °C, while higher temperatures negatively impacted the function of the system. These results suggested that the design with a cas9 gene under the strict control of a xylose-inducible promoter significantly improved the success rate of genome editing in this host. This work contributes to the development of genetic manipulation and furthers the use of B. licheniformis as an efficient industrial workhorse.

Laccase is widely used in several industrial applications and co-culture is a common method for enhancing laccase production in submerged fermentation. In this study, the co-culture of four yeasts with Pleurotus eryngii var. ferulae was found to enhance laccase production. An analysis of sterilization temperatures and extraction conditions revealed that the stimulatory compound in yeasts was temperature-sensitive, and that it was fat-soluble. An LC-MS analysis revealed that the possible stimulatory compound for laccase production in the four yeast extracts was β-carotene. Moreover, the addition of 4 mg β-carotene to 150 mL of P. eryngii var. ferulae culture broth improved laccase production by 2.2-fold compared with the control (i.e., a monoculture), and was similar to laccase production in co-culture. In addition, the enhanced laccase production was accompanied by an increase of lac gene transcription, which was 6.2-time higher than the control on the fifth day. Therefore, it was concluded that β-carotene from the co-cultured yeasts enhanced laccase production in P. eryngii var. ferulae, and strains that produce β-carotene could be selected to enhance fungal laccase production in a co-culture. Alternatively, β-carotene or crude extracts of β-carotene could be used to induce high laccase production in large scale.

The xylose operon is an efficient biological element used for the regulation of gene expression in Bacillus licheniformis. Although the mechanism underlying the xylose-mediated regulation of this operon has been elucidated, the transcriptional changes that occur under various fermentation conditions remain unclear. In this study, the effects of different conditions on xylose operon expression were investigated. Significant upregulation was observed during the transition from the logarithmic phase to the stationary phase (2.5-fold, n = 3, p < 0.01). Glucose suppressed transcription over 168-fold (n = 3, p < 0.01). Meanwhile, the inhibitory effect of glucose hardly strengthened at concentrations from 20 to 180 g/L. Furthermore, the transcription of the xylose operon increased at elevated temperatures (25−42 °C) and was optimal at a neutral pH (pH 6.5−7.0). Based on these findings, relevant fermentation strategies (delaying the induction time, using dextrin as a carbon source, increasing the fermentation temperature, and maintaining a neutral pH) were proposed. Subsequently, these strategies were validated through the use of maltogenic amylase as a reporter protein, as an 8-fold (n = 3, p < 0.01) increase in recombinant enzyme activity compared to that under unoptimized conditions was observed. This work contributes to the development of fermentation optimization and furthers the use of the xylose operon as an efficient expression element.