Search

Pathogen introductions into novel areas can lead to the emergence of new fungal diseases of plants. Understanding the origin, introduction pathways, possible changes in reproductive system and population size of fungal pathogens is essential in devising an integrated strategy for the control of these diseases. We used minisatellite markers to infer the worldwide invasion history of the fungal plant pathogen Leptosphaeria maculans, which causes stem canker (blackleg) of oilseed and vegetable brassicas. Clustering analyses partitioned genotypes into distinct populations corresponding to major geographic regions, along with two differentiated populations in Western Canada. Comparison of invasion scenarios using Approximate Bayesian Computation suggested an origin of the pathogen in the USA, the region where epidemics were first recorded, and independent introductions from there over the last few decades into Eastern Canada (Ontario), Europe and Australia. The population in Western Canada appeared to be founded from a source in Ontario and the population in Chile resulted from an admixture between multiple sources. A bottleneck was inferred for the introduction into Western Canada but not into Europe, Ontario or Australia. Clonality appeared high in Western Canada, possibly because environmental conditions there were less conducive to sexual reproduction. Leptosphaeria maculans is a model invasive pathogen with contrasting features in different regions: shallow population structure, high genetic variability and regular sexual recombination in some regions, by comparison with reduced genetic variability, high rates of asexual multiplication, strong population structure or admixture in others. [ABSTRACT FROM AUTHOR]

Les composantes (Tox+ et Tox0) du complexe impliqué dans la nécrose du collet du colza ont été suivies au cours du temps et dans la plante, à l’aide d’outils moléculaires (ITS, ISSR), afin de clarifier leurs rôles respectifs dans les dégâts de nécrose, de préciser les relations entre les symptômes foliaires précoces et les nécroses du collet tardives et d’évaluer l’étendue de la colonisation de la plante, en conditions naturelles, pendant deux cycles culturaux successifs. Les deux composantes, présentes en permanence, varient en proportion selon la période de culture et l’organe considérés. La composante Tox+, qui prédomine aux deux extrêmes du cycle cultural, sur feuille en automne et au collet en fin de végétation, est responsable des dégâts de nécrose. L’analyse topographique de la région du collet indique que tous les tissus, fortement colonisés par de nombreuses souches Tox+ distinctes, constituent un site privilégié de confrontation entre souches différentes, favorable à la reproduction sexuée du champignon.

Medical informatics is a multidisciplinary field combining clinical and technical expertise. Addressing the challenge of aligning software design with clinicians' real-world needs, Dedalus established the Medical Office, a dedicated department designed to integrate clinical expertise directly into the software development process, in 2022. This paper details the approach and impact of the Medical Office. An international team of 15 healthcare professionals with experience in medical informatics was assembled. The team employed a multifaceted approach, incorporating global communication sessions and a ticketing system to track and analyze service requests. Over two years, 398 tickets were received, categorized into nine areas: clinical content curation, medical terminologies, clinical safety, clinical evaluation, design support, clinical UX, research & publication, real-world medical cases, and pre-sales support. The average duration of ticket resolution decreased over time, attributed to process fine-tuning and the formation of a relevant expert group. A preliminary satisfaction survey indicated positive feedback from technical teams. The collaborative model improved software design, usability, and clinical safety, demonstrating the value of clinician involvement. While preliminary results are promising, ongoing evaluation and adaptation are essential. The study emphasizes the importance of interdisciplinary collaboration in medical informatics and the benefits of clinician involvement in healthcare technology development. Future studies should explore this model's long-term impacts and scalability in other organizations and healthcare systems.

The integration of Electronic Medical Records (EMRs) revolutionized healthcare but often retained limitations from paper-based structures. This study proposes a framework for developing dynamic medical content specifically adapted to the clinical context including medical specialty and diseases. Tailoring content to this dynamic context offers several benefits, including improved access to relevant information, streamlined workflows, and potentially better patient outcomes. We applied our framework to develop neurosurgical content, focusing on brain tumors. The method involves defining the medical specialty, outlining user journeys, and iteratively developing artifacts like assessment forms, dashboards, and order sets. Standardized terminologies ensure consistency and interoperability. Our results demonstrate a successful development of content meeting user needs and clinical relevance. While initial implementation focused on neurosurgery, exploring scalability and AI integration offers promising avenues for further advancement. Future studies could quantitatively evaluate the impact of this method on user satisfaction and patient outcomes.

Human activity impacts the evolutionary trajectories of many species worldwide. Global trade of agricultural goods contributes to the dispersal of pathogens reshaping their genetic makeup and providing opportunities for virulence gains. Understanding how pathogens surmount control strategies and cope with new climates is crucial to predicting the future impact of crop pathogens. Here, we address this by assembling a global thousand-genome panel of Zymoseptoria tritici, a major fungal pathogen of wheat reported in all production areas worldwide. We identify the global invasion routes and ongoing genetic exchange of the pathogen among wheat-growing regions. We find that the global expansion was accompanied by increased activity of transposable elements and weakened genomic defenses. Finally, we find significant standing variation for adaptation to new climates encountered during the global spread. Our work shows how large population genomic panels enable deep insights into the evolutionary trajectory of a major crop pathogen., (© 2023. The Author(s).)

Fungal genus Septoria causes diseases in a wide range of plants. Here, we report the first genome sequences of two strains of Septoria linicola , the causal agent of the pasmo disease of flax ( Linum usitatissimum ). The genome of the first strain, SE15195, was fully assembled in 16 chromosomes, while 35 unitigs were obtained for a second strain, SE14017. Structural annotations predicted 13,096 and 13,085 protein-encoding genes and transposable elements content of 19.0 and 18.1% of the genome for SE15195 and SE14017, respectively. The four smaller chromosomes 13 to 16 show genomics features of potential accessory chromosomes. The assembly of these two genomes is a new resource for studying S. linicola and improving management of pasmo. [Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Introduction: Disasters are high-acuity, low-frequency events which require medical providers to respond in often chaotic settings. Due to this infrequency, skills can atrophy, so providers must train and drill to maintain them. Historically, drilling for disaster response has been costly, and thus infrequent. Virtual Reality Environments (VREs) have been demonstrated to be acceptable to trainees, and useful for training Disaster Medicine skills. The improved cost of virtual reality training can allow for increased frequency of simulation and training., Problem: The problem addressed was to create a novel Disaster Medicine VRE for training and drilling., Methods: A VRE was created using SecondLife (Linden Lab; San Francisco, California USA) and adapted for use in Disaster Medicine training and drilling. It is easily accessible for the end-users (trainees), and is adaptable for multiple scenario types due to the presence of varying architecture and objects. Victim models were created which can be role played by educators, or can be virtual dummies, and can be adapted for wide ranging scenarios. Finally, a unique physiologic simulator was created which allows for dummies to mimic disease processes, wounds, and treatment outcomes., Results: The VRE was created and has been used extensively in an academic setting to train medical students, as well as to train and drill disaster responders., Conclusions: This manuscript presents a new VRE for the training and drilling of Disaster Medicine scenarios in an immersive, interactive experience for trainees.

Introduction: Septoria nodorum blotch (SNB) is a complex fungal disease of wheat caused by the Dothideomycete fungal pathogen Parastagonospora nodorum . The fungus infects through the use of necrotrophic effectors (NEs) that cause necrosis on hosts carrying matching dominant susceptibility genes. The Western Australia (WA) wheatbelt is a SNB "hot spot" and experiences significant under favorable conditions. Consequently, SNB has been a major target for breeders in WA for many years., Materials and Methods: In this study, we assembled a panel of 155 WA P. nodorum isolates collected over a 44-year period and compared them to 23 isolates from France and the USA using 28 SSR loci., Results: The WA P. nodorum population was clustered into five groups with contrasting properties. 80% of the studied isolates were assigned to two core groups found throughout the collection location and time. The other three non-core groups that encompassed transient and emergent populations were found in restricted locations and time. Changes in group genotypes occurred during periods that coincided with the mass adoption of a single or a small group of widely planted wheat cultivars. When introduced, these cultivars had high scores for SNB resistance. However, the field resistance of these new cultivars often declined over subsequent seasons prompting their replacement with new, more resistant varieties. Pathogenicity assays showed that newly emerged isolates non-core are more pathogenic than old isolates. It is likely that the non-core groups were repeatedly selected for increased virulence on the contemporary popular cultivars., Discussion: The low level of genetic diversity within the non-core groups, difference in virulence, low abundance, and restriction to limited locations suggest that these populations more vulnerable to a population crash when the cultivar was replaced by one that was genetically different and more resistant. We characterize the observed pattern as a low-amplitude boom-and-bust cycle in contrast with the classical high amplitude boom-and-bust cycles seen for biotrophic pathogens where the contrast between resistance and susceptibility is typically much greater. Implications of the results are discussed relating to breeding strategies for more sustainable SNB resistance and more generally for pathogens with NEs., (Copyright © 2020 Phan, Jones, Rybak, Dodhia, Lopez-Ruiz, Valade, Gout, Lebrun, Brunner, Oliver and Tan.)

Background: Despite a wide range of literature on emergency department (ED) overcrowding, scientific knowledge on emergency physicians' cognitive processes coping with overcrowding is limited., Objective: This study aimed to develop and evaluate a virtual research environment that will allow us to study the effect of physicians' strategies and behaviors on quality of care in the context of ED overcrowding., Methods: A simulation-based observational study was conducted over two stages: the development of a simulation model and its evaluation. A research environment in emergency medicine combining virtual reality and simulated patients was designed and developed. Afterwards, 12 emergency physicians took part in simulation scenarios and had to manage 13 patients during a 2-hour period. The study outcome was the authenticity of the environment through realism, consistency, and mastering. The realism was the resemblance perceived by the participants between virtual and real ED. The consistency of the scenario and the participants' mastering of the environment was expected for 90% (12/13) of the participants., Results: The virtual ED was considered realistic with no significant difference from the real world with respect to facilities and resources, except for the length of time of procedures that was perceived to be shorter. A total of 100% (13/13) of participants deemed that patient information, decision making, and managing patient flow were similar to real clinical practice. The virtual environment was well-mastered by all participants over the course of the scenarios., Conclusions: The new simulation tool, Virtual Research Environment in Emergency Medicine, has been successfully designed and developed. It has been assessed as perfectly authentic by emergency physicians compared with real EDs and thus offers another way to study human factors, quality of care, and patient safety in the context of ED overcrowding., (©Charles-Henri Houze-Cerfon, Christine Vaissié, Laurent Gout, Bruno Bastiani, Sandrine Charpentier, Dominique Lauque. Originally published in JMIR Serious Games (http://games.jmir.org), 08.08.2019.)

Aims: Titin-based myofilament stiffness is defined by the expression levels of the cardiac titin-isoforms, N2B and N2BA, and by phosphorylation of the elastic titin domains N2-B unique sequence (N2-Bus) and PEVK. Phosphorylation of the N2-Bus by cGMP-dependent protein kinase (PKG) or cAMP-dependent protein kinase (PKA) decreases titin stiffness, whereas phosphorylation of the PEVK-domain by PKC increases it. We aimed to identify specific sites within the N2-Bus phosphorylated by PKA and PKG and to determine whether differential changes in titin domain phosphorylation could affect passive stiffness in human failing hearts., Methods and Results: Using mass spectrometry, we identified seven partly conserved PKA/PKG-targeted phosphorylation motifs in human and rat N2-Bus. Polyclonal antibodies to pSer4185, pSer4010, and pSer4099 in the N2-Bus, and to pSer11878 in the PEVK-region were used to quantify titin-domain phosphorylation by western blot analyses of a set of human donor and failing hearts with similar titin-isoform composition. Passive tension determined in skinned human myocardial fibre preparations was significantly increased in failing compared with donor hearts, notably at shorter sarcomere lengths where titin contributes most to total passive tension. Phosphorylation of Ser4185, Ser4010, and Ser4099 in the N2-Bus was significantly reduced in failing hearts, whereas phosphorylation of Ser11878 in the PEVK-region was increased compared with donor hearts., Conclusion: We conclude that hypo-phosphorylation of the N2-Bus and hyper-phosphorylation of the PEVK domain can act complementary to elevate passive tension in failing human hearts. Differential changes in titin-domain phosphorylation may be important to fine-tune passive myocardial stiffness and diastolic function of the heart.

The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions., (Copyright © 2012 Elsevier B.V. All rights reserved.)

Modern agriculture favours the selection and spread of novel plant diseases. Furthermore, crop genetic resistance against pathogens is often rendered ineffective within a few years of its commercial deployment. Leptosphaeria maculans, the cause of phoma stem canker of oilseed rape, develops gene-for-gene interactions with its host plant, and has a high evolutionary potential to render ineffective novel sources of resistance in crops. Here, we established a four-year field experiment to monitor the evolution of populations confronted with the newly released Rlm7 resistance and to investigate the nature of the mutations responsible for virulence against Rlm7. A total of 2551 fungal isolates were collected from experimental crops of a Rlm7 cultivar or a cultivar without Rlm7. All isolates were phenotyped for virulence and a subset was genotyped with neutral genetic markers. Virulent isolates were investigated for molecular events at the AvrLm4-7 locus. Whilst virulent isolates were not found in neighbouring crops, their frequency had reached 36% in the experimental field after four years. An extreme diversity of independent molecular events leading to virulence was identified in populations, with large-scale Repeat Induced Point mutations or complete deletion of AvrLm4-7 being the most frequent. Our data suggest that increased mutability of fungal genes involved in the interactions with plants is directly related to their genomic environment and reproductive system. Thus, rapid allelic diversification of avirulence genes can be generated in L. maculans populations in a single field provided that large population sizes and sexual reproduction are favoured by agricultural practices.

Sclerotinia sclerotiorum and Botrytis cinerea are closely related necrotrophic plant pathogenic fungi notable for their wide host ranges and environmental persistence. These attributes have made these species models for understanding the complexity of necrotrophic, broad host-range pathogenicity. Despite their similarities, the two species differ in mating behaviour and the ability to produce asexual spores. We have sequenced the genomes of one strain of S. sclerotiorum and two strains of B. cinerea. The comparative analysis of these genomes relative to one another and to other sequenced fungal genomes is provided here. Their 38-39 Mb genomes include 11,860-14,270 predicted genes, which share 83% amino acid identity on average between the two species. We have mapped the S. sclerotiorum assembly to 16 chromosomes and found large-scale co-linearity with the B. cinerea genomes. Seven percent of the S. sclerotiorum genome comprises transposable elements compared to <1% of B. cinerea. The arsenal of genes associated with necrotrophic processes is similar between the species, including genes involved in plant cell wall degradation and oxalic acid production. Analysis of secondary metabolism gene clusters revealed an expansion in number and diversity of B. cinerea-specific secondary metabolites relative to S. sclerotiorum. The potential diversity in secondary metabolism might be involved in adaptation to specific ecological niches. Comparative genome analysis revealed the basis of differing sexual mating compatibility systems between S. sclerotiorum and B. cinerea. The organization of the mating-type loci differs, and their structures provide evidence for the evolution of heterothallism from homothallism. These data shed light on the evolutionary and mechanistic bases of the genetically complex traits of necrotrophic pathogenicity and sexual mating. This resource should facilitate the functional studies designed to better understand what makes these fungi such successful and persistent pathogens of agronomic crops., Competing Interests: I have read the journal's policy and have the following conflicts: author Chinnappa Kodira currently works at 454 Life Sciences, Roche. All of the work reported in this manuscript was completed when he was in residence at the Broad Institute. None of the other authors have declared any competing interests.

Fungi are of primary ecological, biotechnological and economic importance. Many fundamental biological processes that are shared by animals and fungi are studied in fungi due to their experimental tractability. Many fungi are pathogens or mutualists and are model systems to analyse effector genes and their mechanisms of diversification. In this study, we report the genome sequence of the phytopathogenic ascomycete Leptosphaeria maculans and characterize its repertoire of protein effectors. The L. maculans genome has an unusual bipartite structure with alternating distinct guanine and cytosine-equilibrated and adenine and thymine (AT)-rich blocks of homogenous nucleotide composition. The AT-rich blocks comprise one-third of the genome and contain effector genes and families of transposable elements, both of which are affected by repeat-induced point mutation, a fungal-specific genome defence mechanism. This genomic environment for effectors promotes rapid sequence diversification and underpins the evolutionary potential of the fungus to adapt rapidly to novel host-derived constraints.

Leptosphaeria maculans, a dothideomycete fungus causing stem canker on oilseed rape, develops gene-for-gene interactions with its host plants. It has the ability to rapidly adapt to selection pressure exerted by cultivars harbouring novel resistance genes as exemplified recently by the 3-year evolution towards virulence at the AvrLm1 locus in French populations. The AvrLm1 avirulence gene was recently cloned and shown to be a solo gene within a 269 kb non-coding, heterochromatin-like region. Here we describe the sequencing of the AvrLm1 genomic region in one avirulent and two virulent isolates to investigate the molecular basis of evolution towards virulence at the AvrLm1 locus. For these virulent isolates, the gain of virulence was linked to a 260 kb deletion of a chromosomal segment spanning AvrLm1 and deletion breakpoints were identical or similar. Among the 460 isolates analysed from France, Australia and Mexico, a similar large deletion was apparent in > 90% of the virulent isolates. Deletion breakpoints were also strongly conserved in most of the virulent isolates, which led to the hypothesis that a unique deletion event leading to the avrLm1 virulence has diffused in pathogen populations. These data finally suggest that retrotransposons are key drivers in genome evolution and adaptation to novel selection pressure in L. maculans.

Leptosphaeria maculans, a Dothideomycete causing stem canker on oilseed rape (Brassica napus), develops gene-for-gene interactions with its host plants. To date, nine resistance genes (Rlm1-9) have been identified in Brassica spp. The corresponding nine avirulence genes (AvrLm1-9) in L. maculans have been mapped at four independent loci, thereby revealing two clusters of three and four linked avirulence genes. Here, we report the completion of map-based cloning of AvrLm1. AvrLm1 was genetically delineated within a 7.3 centimorgan interval corresponding to a 439 kb BAC contig. AvrLm1 is a single copy gene isolated within a 269 kb non-coding, heterochromatin-like region. The region comprised a number of degenerated, nested copies of four long-terminal repeat (LTR) retrotransposons, including Pholy and three novel Gypsy-like retrotransposons. AvrLm1 restored the avirulent phenotype on Rlm1 cultivars following functional complementation of virulent isolates. AvrLm1 homologues were not detected in other Leptosphaeria species or in known fungal genomes including the closely related species Stagonospora nodorum. The predicted AvrLm1 protein is composed of 205 amino acids, of which only one is a cysteine residue. It contains a peptide signal suggesting extracellular localization. Unlike most other fungal avirulence genes, AvrLm1 is constitutively expressed, with a probable increased level of expression upon plant infection, suggesting the absence of tight regulation of AvrLm1 expression.

Leptosphaeria maculans is the most ubiquitous fungal pathogen of Brassica crops and causes the devastating stem canker disease of oilseed rape worldwide. We used minisatellite markers to determine the genetic structure of L. maculans in four field populations from France. Isolates were collected at three different spatial scales (leaf, 2-m2 field plot, and field) enabling the evaluation of spatial distribution of the mating type alleles and of genetic variability within and among field populations. Within each field population, no gametic disequilibrium between the minisatellite loci was detected and the mating type alleles were present at equal frequencies. Both sexual and asexual reproduction occur in the field, but the genetic structure of these populations is consistent with annual cycles of randomly mating sexual reproduction. All L. maculans field populations had a high level of gene diversity (H = 0.68 to 0.75) and genotypic diversity. Within each field population, the number of genotypes often was very close to the number of isolates. Analysis of molecular variance indicated that >99.5% of the total genetic variability was distributed at a small spatial scale, i.e., within 2-m2 field plots. Population differentiation among the four field populations was low (GST < 0.02), suggesting a high degree of gene exchange between these populations. The high gene flow evidenced here in French populations of L. maculans suggests a rapid countrywide diffusion of novel virulence alleles whenever novel resistance sources are used.

Leptosphaeria maculans causes phoma stem canker, the most serious disease of oilseed rape world-wide. Sexual recombination is important in the pathogen life cycle and increases the risk of plant resistance genes being overcome rapidly. Thus, there is a need to develop easy-to-use molecular markers suitable for large-scale population genetic studies. The minisatellite MinLm1, showing six alleles in natural populations, has previously been used as a marker to survey populations. Here, we report the characterization of five new minisatellites (MinLm2-MinLm6), of which four were identified by a systematic search for tandemly repeated polymorphic regions in BAC-end sequencing data from L. maculans. Of 782 BAC-end sequences analysed, 43 possessed putative minisatellite-type repeats and four of these (MinLm3-MinLm6) displayed both consistent PCR amplification and size polymorphism in a collection of L. maculans isolates of diverse origins. Cloning and sequencing of each allele confirmed that polymorphism was due to variation in the repeat number of a core motif ranging from 11 bp (MinLm3) to 51 bp (MinLm4). The number of alleles found for each minisatellite ranged from three (MinLm4) to nine (MinLm2), with eight, five and six for MinLm3, MinLm5 and MinLm6, respectively. MinLm2-MinLm6 are all single locus markers specific to L. maculans and share some common features, such as conservation of core motifs and incomplete direct repeats in the flanking regions. To our knowledge, L. maculans is the first fungal species for which six polymorphic single locus minisatellite markers have been reported.

The LMR1 5.2 kb interspersed repeat of Leptosphaeria maculans was described by Taylor and Borgmann [Mol. Plant Microbe Interact. 7 (1994) 181] as an uncharacterized repeated element sharing homologies with both LINEs and SINEs. Here, we used the LMR1 sequence as a template to identify the full-length element within a 184-kb genomic sequence corresponding to the pericentromeric region of the 2.80 Mb chromosome of isolate v23.1.3. This region comprises (i) one 6980-bp full-sized Pholy element bordered by two 275- to 280-bp long terminal repeats (LTRs), (ii) five Pholy-related sequences, usually truncated at their 3' ends, and (iii) five solo-LTRs. Structural features strongly suggested that Pholy corresponds to an ancient copia-like retrotransposon, sharing strong homologies with the Elsa retrotransposon of Stagonospora nodorum. Pholy was also suggested to be specific to pericentromeric regions. Comparative analysis of the structure of the Pholy-like sequences occurring in the 184-kb contig and in other parts of the genome showed that this family of repeats is highly degenerated following extensive repeat induced point mutation (RIP).

Map-based cloning of the avirulence gene AvrLm1 of Leptosphaeria maculans was initiated utilizing a genetic map of the fungus and a BAC library constructed from an AvrLm1 isolate. Seven polymorphic DNA markers closely linked to AvrLm1 were identified. Of these, two were shown to border the locus on its 5' end and were present, with size polymorphism, in both the virulent and the avirulent isolates. In contrast, three markers, J19-1.1, J53-1.3 (in coupling phase with avirulence), and Vir1 (in repulsion phase with avirulence), cosegregated with AvrLm1 in 312 progeny from five in vitro crosses. J19-1.1 and J53-1.3 were never amplified in the virulent parents or progeny, whereas Vir1 was never amplified in the avirulent parents or progeny. J19-1.1 and J53-1.3 were shown to be separated by 40 kb within a 184-kb BAC contig. In addition, the 1.6-cM genetic distance between J53-1.3 and the nearest recombinant marker corresponded to a 121-kb physical distance. When analyzing a European Union-wide collection of 192 isolates, J53-1.3, J19-1.1, and Vir1 were found to be closely associated with the AvrLm1 locus. The results of polymerase chain reaction amplification with primers for the three markers were in accordance with the interaction phenotype for 92.2% (J53-1.3), 90.6% (J19-1.1), and 88.0% (Vir1) of the isolates. In addition, genome organization of the AvrLm1 region was highly conserved in field isolates, because 89.1% of the avirulent isolates and 79.0% of the virulent isolates showed the same association of markers as that of the parents of in vitro crosses. The large-scale analysis of field isolates with markers originating from the genetic map therefore confirms (i) the physical proximity between the markers and the target locus and (ii) that AvrLm1 is located in (or close to) a recombination-deficient genome region. As a consequence, map-based markers provided us with high-quality markers for an overview of the occurrence of race "AvrLm1" at the field scale. These data were used to propose hypotheses on evolution towards virulence in field isolates.

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.