Search

The objective of this study was to determine the prevalence ofTritrichomonas foetusinfection and to evaluate risk factors associated with this infection among cattle in the state of Paraíba in northeastern Brazil. Samples of cervicovaginal mucus from 290 females and smegma from 59 males [beef, 31; mixed aptitude (beef and dairy), 10; and dairy, 18] from 31 farms were collected. Modified Diamond’s medium and polymerase chain reaction (PCR) were used for the laboratory diagnosis ofT. foetusinfection. Univariate analysis and logistic regression were performed to test for potential risk factors in addition to prevalence mapping. No sample was positive forT. foetusin culture, and the prevalence ofT. foetusinfection using PCR was 3.7% (13/349) [confidence interval (CI) 95%, 2.1%–6.4%]. In total, 19.3% (6/31) of the farms had at least one animal positive forT. foetus. The contact of females with males from other farms [Odds ratio, 5.9; 95% CI, 1.5–22.4;p= 0.009] was identified as a risk factor forT. foetusinfection. This study demonstrates thatT. foetusinfection is prevalent among dairy cows in the state of Paraíba, Brazil. Sexual resting, removal of positive females, and avoiding contact of females with males from other farms are recommended to reduce the risk of infection.

The aim of the present study is to diagnose the occurrence of infections caused by Campylobacter fetus subsp. venerealis and Tritrichomonas foetus in reproducer bulls from Alagoas State breeders, Brazil. The total of 162 preputial smegma samples were collected from nelore bulls from ten rural properties in the East, Agreste and Sertão mesoregions. The samples were subjected to the Polymerase Chain Reaction (PCR) technique in order to assess C. fetus subsp. venerealis and Tritrichomonas foetus DNA and cultivated in Modified Diamond Medium (DMM) for Tritrichomonas foetus isolation. Four point nine percent (4.9% - 8/162) of the evaluated bulls were infected with C. fetus subsp. venerealis and 3.0% (5/162) of the sample were infected with T. foetus, which was not isolated in any of the assessed animals. Based on our results, there was C. fetus subsp. venerealis and T. foetus DNA in bulls from Alagoas State, Brazil. Accordingly, it is necessary performing laboratory examinations in animals living in properties breeding animals for reproduction purpose in order to monitor and control such infections.

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems.