Search

Background: Antibodies play a crucial role in disease treatment, leveraging their ability to selectively interact with the specific antigen. However, screening antibody gene sequences for target antigens via biological experiments is extremely time-consuming and labor-intensive. Several computational methods have been developed to predict antibody-antigen interaction while suffering from the lack of characterizing the underlying structure of the antibody. Results: Beneficial from the recent breakthroughs in deep learning for antibody structure prediction, we propose a novel neural network architecture to predict antibody-antigen interaction. We first introduce AbAgIPA: an antibody structure prediction network to obtain the antibody backbone structure, where the structural features of antibodies and antigens are encoded into representation vectors according to the amino acid physicochemical features and Invariant Point Attention (IPA) computation methods. Finally, the antibody-antigen interaction is predicted by global max pooling, feature concatenation, and a fully connected layer. We evaluated our method on antigen diversity and antigen-specific antibody-antigen interaction datasets. Additionally, our model exhibits a commendable level of interpretability, essential for understanding underlying interaction mechanisms. Conclusions: Quantitative experimental results demonstrate that the new neural network architecture significantly outperforms the best sequence-based methods as well as the methods based on residue contact maps and graph convolution networks (GCNs). The source code is freely available on GitHub at https://github.com/gmthu66/AbAgIPA. [ABSTRACT FROM AUTHOR]

Here, we demonstrate that single strand annealing (SSA) can be co-opted for the precise autocatalytic excision of a drive element. We have termed this technology Repeat Mediated Excision of a Drive Element (ReMEDE). By engineering direct repeats flanking the drive allele and inducing a double-strand DNA break (DSB) at a second endonuclease target site within the allele, we increased the utilization of SSA repair. ReMEDE was incorporated into the mutagenic chain reaction (MCR) gene drive targeting the yellow gene of Drosophila melanogaster, successfully replacing drive alleles with wild-type alleles. Sequencing across the Cas9 target site confirmed transgene excision by SSA after pair-mated outcrosses with yReMEDE females, revealing ~4% inheritance of an engineered silent TcG marker sequence. However, phenotypically wild-type flies with alleles of indeterminate biogenesis also were observed, retaining the TGG sequence (~16%) or harboring a silent gGG mutation (~0.5%) at the PAM site. Additionally, ~14% of alleles in the F2 flies were intact or uncut paternally inherited alleles, indicating limited maternal deposition of Cas9 RNP. Although ReMEDE requires further research and development, the technology has some promising features as a gene drive mitigation strategy, notably its potential to restore wild-type populations without additional transgenic releases or large-scale environmental modifications. Author summary: CRISPR/Cas9-based autonomous homing gene drives have the potential to drastically reduce or eliminate vector-borne diseases, agricultural pests, and invasive species. However, their use raises significant regulatory, ethical, environmental, and sociopolitical concerns, particularly regarding unintended consequences. Responsible application of this powerful technology necessitates the development of control measures to halt or reverse any undesired outcomes. Several mitigation strategies have been proposed and, in some cases, demonstrated in laboratory settings, but their effectiveness in addressing concerns surrounding the use of gene drives in nature still remains uncertain. Therefore, ongoing investigation and consideration of additional control strategies is prudent. This manuscript describes proof-of-concept studies for a novel gene drive mitigation strategy, which we have termed Repeat Mediated Excision of a Drive Element (ReMEDE). While further research and development is required prior to any possible application of this strategy, the ReMEDE concept offers a theoretical potential to restore transgene-free populations with wild-type phenotypes after a well-defined period of efficient gene drive. [ABSTRACT FROM AUTHOR]

Purpose: The present study explored the molecular characterization of human Adenovirus (HAdV) and its strains among hospitalized SARI cases in the pediatric unit of a tertiary care hospital in North-East India. Methods: Nasal and throat swabs were collected from 70 patients of Pediatric Unit, of a tertiary hospital in NE India from April 2023-October 2023. The samples were screened for the presence of HAdV using an adenovirus-specific Real-Time PCR Kit. For molecular characterization, Next Generation Sequencing (NGS) was performed by targeting the hexon gene of HAdV followed by post-sequencing analysis. Results: Overall, 18.57% (13/70) of samples were positive for HAdV. In context of the severity of illness, 3/13 adenovirus-positive patients (23.07%) died after hospitalization, had severe pneumonia among which two were of less than one year of age. Molecular characterization using NGS indicated that 4/13 individuals were infected with HAdV-B type 3 and 5/13 patients were infected with HAdV type 7. Notably, 4/7 cases of severe pneumonia were under five years of age and associated with HAdV type 7 infection. The ratio of non-synonymous to synonymous mutation (dN/dS) was comparatively low in HAdV type 7 positive samples (dN/dS=0.31). No non-synonymous mutation was observed in HAdV-B type 3 positive samples. The higher neutrophil percentage among the death cases suggested an acute immune response. Conclusion: The study demonstrated HAdV type 7 and HAdV-B type 3 as strains associated with pediatric SARI cases from April 2023-October 2023. Further, HAdV type 7 infection was primarily linked with lower respiratory tract infections mainly severe pneumonia. [ABSTRACT FROM AUTHOR]

Since the onset of the COVID-19 pandemic, a variety of diagnostic approaches, including RT-qPCR, RAPID, and LFA, have been adopted, with RT-qPCR emerging as the gold standard. However, a significant challenge in COVID-19 diagnostics is the wide range of symptoms presented by patients, necessitating early and accurate diagnosis for effective management. Although RT-qPCR is a precise molecular technique, it is not immune to false-negative results. In contrast, CRISPR-based detection methods for SARS-CoV-2 offer several advantages: they are cost-effective, time-efficient, highly sensitive, and specific, and they do not require sophisticated instruments. These methods also show promise for scalability, enabling diagnostic tests. CRISPR technology can be customized to target any genomic region of interest, making it a versatile tool with applications beyond diagnostics, including therapeutic development. The CRISPR/Cas systems provide precise gene targeting with immense potential for creating next-generation diagnostics and therapeutics. One of the key advantages of CRISPR/Cas-based therapeutics is the ability to perform multiplexing, where different sgRNAs or crRNAs can target multiple sites within the same gene, reducing the likelihood of viral escape mutants. Among the various CRISPR systems, CRISPR/Cas13 and CARVER (Cas13-assisted restriction of viral expression and readout) are particularly promising. These systems can target a broad range of single-stranded RNA viruses, making them suitable for the diagnosis and treatment of various viral diseases, including SARS-CoV-2. However, the efficacy and safety of CRISPR-based therapeutics must be thoroughly evaluated in pre-clinical and clinical settings. While CRISPR biotechnologies have not yet been fully harnessed to control the current COVID-19 pandemic, there is an optimism that the limitations of the CRISPR/Cas system can be overcome soon. This review discusses how CRISPR-based strategies can revolutionize disease diagnosis and therapeutic development, better preparing us for future viral threats. [ABSTRACT FROM AUTHOR]

Both genetic and environmental factors can disturb the epigenome, influencing autism spectrum disorders (ASD) development and underlying the heterogenic complexity of autistic phenotypes. A U-shaped curve links the autistic phenotype with genetically and environmentally induced epigenomic imbalance. Analysis of DNA methylation in peripheral tissues can provide biomarkers valuable for diagnosing both idiopathic and syndromic ASD. Human iPSC-derived neurons and cerebral organoids (COs) replicate ASD epigenetic signatures and provide a platform for drug testing, personalized medicine, and regenerative therapies. Advances in our capacity to manipulate the neural epigenome using epidrugs and epi-editing approaches may yield novel therapeutic approaches to treat ASD. Autism spectrum disorders (ASD) comprise a range of neurodevelopmental pathologies characterized by deficits in social interaction and repetitive behaviors, collectively affecting almost 1% of the worldwide population. Deciphering the etiology of ASD has proven challenging due to the intricate interplay of genetic and environmental factors and the variety of molecular pathways affected. Epigenomic alterations have emerged as key players in ASD etiology. Their research has led to the identification of biomarkers for diagnosis and pinpointed specific gene targets for therapeutic interventions. This review examines the role of epigenetic alterations, resulting from both genetic and environmental influences, as a central causative factor in ASD, delving into its contribution to pathogenesis and treatment strategies. [ABSTRACT FROM AUTHOR]

Objectives(s): Adipose-derived Mesenchymal stem cells (ASCs) have garnered attention for their regenerative potential; therefore, their cellular senescence-related gene expression remains crucial in therapeutic contexts. Nowadays, combination therapies have shown promising results in reducing senescent cells. This study investigated the effects of vitamin C, doxycycline, and azithromycin co-treatment on the key cellular senescence-associated genes in ASCs. Materials and methods: Human ASCs were cultured and treated for 24 hr with vitamin C, doxycycline, azithromycin, and a combination of three drugs. Total RNAs were extracted, and the expression of p21, p16, Nanog, Oct4, and Sox2 genes was assessed using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Additionally, cell cycle alterations were analyzed via flow cytometry after treatment with these compounds. Results: Notably, vitamin C treatment resulted in a significant down-regulation of p21 gene expression (P<0.01), implicating the potential role of vitamin C in promoting cell cycle progression. Doxycycline treatment led to a significant up-regulation of p21 and p16 gene expression (P<0.05), as it has previously been shown to induce cell cycle arrest. Similarly, azithromycin treatment predominantly increased p21 expression (P<0.05). Besides, cell cycle analysis revealed that each compound had changed the distribution of cells across different phases of the cell cycle. Conclusion: The combined use of all three drugs yielded intricate interactions, suggesting a complex yet promising approach to future research. According to our findings, the major difference in the combination drug-treated group (VDA) can be explained by the neutralizing effect of these three components in the environment. [ABSTRACT FROM AUTHOR]

Background: Rapid and precise detection of Mycobacterium tuberculosis (MTB) is paramount for effective management and control of tuberculosis. Clustered regularly interspaced short palindromic repeats (CRISPR) technology has emerged as a promising tool for pathogenic diagnosis owing to its specificity and adaptability. This systematic review and meta-analysis aimed to appraise the diagnostic accuracy of CRISPR-based techniques in identifying MTB. Methods: A meticulous search was conducted in Medline, Scopus, Embase, and ISI Web of Science to retrieve relevant studies, adhering to Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. Quality was assessed using the Joanna Briggs Institute checklist. Data synthesis and analyses, including subgroup analyses, were performed with R v 4.3.1, examining variables like CRISPR variants, gene targets, pre-amplification techniques, and signal readout methods. Results: From 389 identified studies, 14 met the inclusion criteria, encompassing 2175 MTB strains. The pooled sensitivity and specificity of CRISPR-based techniques were 0.93 (95% CI 0.85–0.99) and 0.97 (95% CI 0.94–0.99), respectively. The pooled diagnostic odds ratio was 273.4379 (95% CI 103.3311–723.5794), with an area under the curve of 0.97 for the summary receiver operating characteristic (SROC) curve, denoting excellent diagnostic accuracy. Subgroup analyses illustrated variations in diagnostic metrics based on factors like CRISPR variant utilized, target gene, and pre-amplification methods. For instance, CRISPR-Cas12 exhibited a sensitivity and specificity of 0.93 (95% CI 0.78–0.98) and 0.98 (95% CI 0.93–1), respectively. Moreover, this technology showed a sensitivity of 96% and specificity of 100% in detecting resistant MTB. Conclusion: CRISPR-based methods exhibit substantial diagnostic sensitivity and specificity for detecting MTB, with notable variances across different CRISPR variants and methodological approaches. Further studies must be conducted to optimize CRISPR's potential as a diagnostic tool for MTB in a variety of clinical and research settings. [ABSTRACT FROM AUTHOR]

Adverse outcome pathways (AOPs) can aid with chemical risk assessment by providing plausible links between chemical activity at the molecular level and effect outcomes in intact organisms. Because AOPs can be used to infer causality between upstream and downstream events in toxicological pathways, the AOP framework can also facilitate increased uptake of alternative methods and new approach methodologies to help inform hazard identification. However, a prevailing challenge is the limited number of fully developed and endorsed AOPs, primarily due to the substantial amount of work required by AOP developers and reviewers. Consequently, a more pragmatic approach to AOP development has been proposed where smaller units of knowledge are developed and reviewed independent of full AOPs. In this context, we have developed an upstream network comprising key events (KEs) and KE relationships related to decreased androgen signaling, converging at a nodal KE that can branch out to numerous adverse outcomes (AOs) relevant to androgen‐sensitive toxicological pathways. Androgen signaling represents an extensively studied pathway for endocrine disruption. It is linked to numerous disease outcomes and can be affected by many different endocrine‐disrupting chemicals. Still, pathways related to disrupted androgen signaling remain underrepresented in the AOP‐wiki, and endorsed AOPs are lacking. Given the pivotal role of androgen signaling in development and function across vertebrate taxa and life stages of both sexes, this upstream AOP network serves as a foundational element for developing numerous AOPs. By connecting the upstream network with various downstream AOs, encompassing different species, it can also facilitate cross‐species extrapolations for hazard and risk assessment of chemicals. Environ Toxicol Chem 2024;43:2329–2337. © 2024 The Author(s). Environmental Toxicology and Chemistry published by Wiley Periodicals LLC on behalf of SETAC. [ABSTRACT FROM AUTHOR]

Lymphotoxin α and lymphotoxin β (LTs), TNF superfamily members, are expressed in either soluble (LTα3) or membrane‐bound (LTα1β2 or LTα2β1) forms. In the pathological context, LT‐mediated signaling is known to exacerbate autoimmunity by perpetuating inflammation and promoting the formation of tertiary lymphoid organs. Despite this understanding, the exact roles of LTα and LTβ in the pathogenesis of the murine model of multiple sclerosis, and experimental autoimmune encephalomyelitis (EAE), remain controversial. Here, we employed a panel of gene‐modified mice with cell‐type restricted ablation of LTα (targeting both membrane‐bound and soluble forms of LTs) to unravel the contributions of LTs from various lymphoid cells, namely T cells, type 3 innate lymphoid cells (ILC3) and B cells, in EAE. We found that the effects of LTα deletion were dependent on the cellular source. ILC3‐derived lymphotoxins exerted a protective role in EAE by regulating the accumulation of IFN‐ɣ‐ and GM‐CSF‐producing TH cells in the CNS. In contrast, T‐cell‐derived lymphotoxins promoted IL‐17A‐ and GM‐CSF‐mediated TH responses in the periphery, whereas B‐cell‐derived lymphotoxins were pathogenic only in the autoantibody‐mediated EAE model. Collectively, our findings unveil the multifaceted involvement of lymphotoxins in EAE pathogenesis and challenge the view that lymphotoxins play a solely pathogenic role in neuroinflammation. [ABSTRACT FROM AUTHOR]

Background: Chemotherapy including cisplatin is recommended for the treatment of advanced bladder cancer, but its effectiveness is limited due to the acquisition of drug resistance. Although several mechanisms of cisplatin resistance have been reported, there are still many unknowns, and treatment of cisplatin-resistant bladder cancer remains difficult. Accordingly, in this study, we aimed to identify and characterize microRNAs involved in cisplatin resistance. Methods: Small RNA sequencing analysis was performed to search for microRNAs related to cisplatin resistance. The identified microRNAs were then characterized using gain-of-function studies, sensitivity analysis, target gene analysis, and cellular assays. Results: We identified miR-424-5p as a candidate microRNA that was downregulated in cisplatin-resistant strains compared with parental strains. Notably, in gain-of-function studies, miR-424-5p suppressed the proliferative ability of cisplatin-resistant bladder cancer (CDDP-R BC). Furthermore, miR-424-5p restored sensitivity to cisplatin. RNA sequence analysis revealed seven candidate genes targeted by this microRNA. Among them, cyclin E1 (CCNE1) was chosen for subsequent analyses because its expression was upregulated in cisplatin-resistant cells compared with parental cells and because recent studies have shown that CCNE1 amplification is synthetic lethal with PKMYT1 kinase inhibition. Therefore, we performed functional analysis using the PKMYT1 inhibitor RP-6306 and demonstrated that RP-6306 inhibited cell growth through suppression of mitotic entry and restored cisplatin sensitivity in CDDP-R BC. Conclusions: Overall, our findings provided insights into the development of novel therapeutic strategies for CDDP-R BC. [ABSTRACT FROM AUTHOR]

In insects, tyrosine hydroxylase (TH) plays essential roles in cuticle tanning and cuticle pigmentation. Plagiodera versicolora (Coleoptera: Chrysomelidae) is a leaf‐eating forest pest in salicaceous trees worldwide. However, the function of PverTH in P. versicolora is still unknown. In this study, we obtained a PverTH gene from transcriptome analysis. The expression analysis of PverTH showed that the highest expression was found in epidermis of larvae. In this study, we used RNA interference (RNAi) technology to knockdown the PverTH gene. The results showed that ingestion of dsTH led to cuticle coloration became lighter in larvae, pupae and adults. Knockdown of PverTH gene inhibited larval growth, and consequently caused higher mortality. In addition, RNAi of TH disrupted the cuticle tanning, caused lower pupation rate, lower eclosion rate and higher deformity rate. This study indicates that PverTH is vital for the cuticular pigments and cuticle tanning. Moreover, this research suggested that the development of PverTH gene as a potential target gene to control P. versicolora. [ABSTRACT FROM AUTHOR]

RNA interference (RNAi) has emerged as an eco‐friendly alternative to classic pesticides for pest control. This review highlights the importance of identifying the best target genes for RNAi‐mediated pest control. We argue that the knowledge‐based approach to predicting effective targets is limited by our current gaps of knowledge, making unbiased screening a superior method for discovering the best target processes and genes. We emphasize the recent evidence that suggests targeting conserved basic cellular processes, such as protein degradation and translation, is more effective than targeting the classic pesticide target processes. We support these claims by comparing the efficacy of previously reported RNAi target genes and classic insecticide targets with data from our genome‐wide RNAi screen in the red flour beetle, Tribolium castaneum. Finally, we provide practical advice for identifying excellent target genes in other pests, where large‐scale RNAi screenings are typically challenging. [ABSTRACT FROM AUTHOR]

The transcription factor NRF2 plays an important role in many biological processes and is a promising therapeutic target for many disease states. NRF2 is highly expressed in the skin and is known to play a critical role in diabetic wound healing, a serious disease process for which treatment options are limited. However, many existing NRF2 activators display off-target effects due to their electrophilic mechanism, underscoring the need for alternative approaches. In this work, we investigated two recently described non-electrophilic NRF2 activators, ADJ-310 and PRL-295, and demonstrated their efficacy in vitro and in vivo in human keratinocytes and Leprdb/db diabetic mice. We also compared the downstream targets of PRL-295 to those of the widely used electrophilic NRF2 activator CDDO-Me by RNA sequencing. Both ADJ-310 and PRL-295 maintained human keratinocyte cell viability at increasing concentrations and maintained or improved cell proliferation over time. Both compounds also increased cell migration, improving in vitro wound closure. ADJ-310 and PRL-295 enhanced the oxidative stress response in vitro, and RNA-sequencing data showed that PRL-295 activated NRF2 with a narrower transcriptomic effect than CDDO-Me. In vivo, both ADJ-310 and PRL-295 improved wound healing in Leprdb/db diabetic mice and upregulated known downstream NRF2 target genes in treated tissue. These results highlight the non-electrophilic compounds ADJ-310 and PRL-295 as effective, innovative tools for investigating the function of NRF2. These compounds directly address the need for alternative NRF2 activators and offer a new approach to studying the role of NRF2 in human disease and its potential as a therapeutic across multiple disease states. [ABSTRACT FROM AUTHOR]

Background: Understanding genetic-metabolite associations has translational implications for informing cardiovascular risk assessment. Interrogating functional genetic variants enhances our understanding of disease pathogenesis and the development and optimization of targeted interventions. Methods: In this study, a total of 187 plasma metabolite levels were profiled in 4974 individuals of European ancestry of the GCAT| Genomes for Life cohort. Results of genetic analyses were meta-analysed with additional datasets, resulting in up to approximately 40,000 European individuals. Results of meta-analyses were integrated with reference gene expression panels from 58 tissues and cell types to identify predicted gene expression associated with metabolite levels. This approach was also performed for cardiovascular outcomes in three independent large European studies (N = 700,000) to identify predicted gene expression additionally associated with cardiovascular risk. Finally, genetically informed mediation analysis was performed to infer causal mediation in the relationship between gene expression, metabolite levels and cardiovascular risk. Results: A total of 44 genetic loci were associated with 124 metabolites. Lead genetic variants included 11 non-synonymous variants. Predicted expression of 53 fine-mapped genes was associated with 108 metabolite levels; while predicted expression of 6 of these genes was also associated with cardiovascular outcomes, highlighting a new role for regulatory gene HCG27. Additionally, we found that atherogenic metabolite levels mediate the associations between gene expression and cardiovascular risk. Some of these genes showed stronger associations in immune tissues, providing further evidence of the role of immune cells in increasing cardiovascular risk. Conclusions: These findings propose new gene targets that could be potential candidates for drug development aimed at lowering the risk of cardiovascular events through the modulation of blood atherogenic metabolite levels. [ABSTRACT FROM AUTHOR]

Background: Increasing evidence suggests a potential causal association between lipid levels and facial aging. The aim of this study was to investigate the relationship between levels of specific lipids and facial aging via Mendelian randomization methods. Additionally, this study aimed to identify mediators and explore relevant genes and drug targets. Methods: In this study, genome-wide association data on plasma lipids from 7,174 Finnish individuals in the UK Biobank were used. Two-sample Mendelian randomization was applied to assess the causal effects of specific lipids on facial aging. Sensitivity and pleiotropy analyses were conducted to ensure the robustness and reliability of the results. Multivariate Mendelian randomization was conducted to account for the potential impact of confounding factors. Furthermore, summary-data-based Mendelian randomization was used to identify relevant genes, which were validated through multiomics data. Finally, drug‒gene interactions were explored via molecular docking techniques. Results: Two-sample Mendelian randomization analysis revealed a causal relationship between lipid levels and facial aging. According to the multivariate Mendelian randomization results, smoking was found to mediate this association, and these lipids remained significantly associated with facial aging, even after accounting for environmental confounders. Using summary-data-based Mendelian randomization, CYP21A2, CCND1, PSMA4, and MED1 were identified as potential gene targets, with MED1 further validated through pQTL and mQTL data. Additionally, the MED1 protein was found to bind spontaneously with astragalin, fenofibrate, and ginsenoside. Conclusions: The results revealed a causal relationship between lipid levels and facial aging, revealing key gene targets that were still significantly associated with facial aging after controlling for environmental confounders. Additionally, the interactions between MED1 and certain drugs may indicate potential pathways for therapeutic interventions related to facial aging. [ABSTRACT FROM AUTHOR]

Introduction: The utilization of denosumab in treating osteoporosis highlights promising prospects for osteoporosis intervention guided by gene targets. While omics-based research into osteoporosis pathogenesis yields a plethora of potential gene targets for clinical transformation, identifying effective gene targets has posed challenges. Methods: We first queried the omics data of osteoporosis clinical samples on PubMed, used International Mouse Phenotyping Consortium (IMPC) to screen differentially expressed genes, and conducted preliminary functional verification of candidate genes in human Saos2 cells through osteogenic differentiation and mineralization experiments. We then selected the candidate genes with the most significant effects on osteogenic differentiation and further verified the osteogenic differentiation and mineralization functions in mouse 3T3-E1 and bone marrow mesenchymal stem cells (BMSC). Finally, we used RNA-seq to explore the regulation of osteogenesis by the target gene. Results: We identified PPP2R2A, RRBP1, HSPB6, SLC22A15, ADAMTS4, ATP8B1, CTNNB1, ROBO1, and EFR3B, which may contribute to osteoporosis. ROBO1 was the most significant regulator of osteogenesis in both human and mouse osteoblast. The inhibitory effect of Robo1 knockdown on osteogenic differentiation may be related to the activation of inflammatory signaling pathways. Conclusion: Our study provides several novel molecular mechanisms involved in the pathogenesis of osteoporosis. ROBO1 is a potential target for osteoporosis intervention. [ABSTRACT FROM AUTHOR]

This study explores the role and potential mechanisms of microRNA-125b-5p (miR-125b-5p) in pulmonary fibrosis (PF). PF is a typical outcome of many chronic lung diseases, with poor prognosis and the lack of appropriate medical treatment because PF's molecular mechanisms remain poorly understood. In this study, using in vitro and in vivo analyses, we find that miR-125b-5p is likely a potent regulator of lung fibrosis. The findings reveal that, on the one hand, miR-125b-5p not only specifically decreases in the epithelial-mesenchymal transition (EMT) of lung epithelial cells, but also shows a downregulation trend in the lung tissues of mice with PF. On the other hand, overexpression of miR-125b-5p on the cellular and animal levels downregulates EMT and fibrotic phenotypes, respectively. To clarify the molecular mechanism of the "therapeutic" effect of miR-125b-5p, we use the target prediction tool combined with a dual luciferase assay and complete a rescue experiment by constructing the overexpression vector of the target gene Bcl-2 homologous antagonist/ killer (BAK1), thus confirming that miR-125b-5p can effectively inhibit EMT and fibrosis process by targeting BAK1 gene. MiR-125b-5p inhibits the EMT in lung epithelial cells by negatively regulating BAK1, while overexpression of miR-125b-5p can alleviate lung fibrosis. The findings suggest that MiR-125b-5p/BAK1 can serve as a potential treatment target for PF. [ABSTRACT FROM AUTHOR]

The DNA-binding with one finger (Dof) gene family is a class of plant-specific transcription factors involved in diverse biological processes, including response to biotic and abiotic stresses. Members of this family have been reported in the cultivated potato Solanum tuberosum, but clues to the roles of several Dof genes are still lacking. Potato wild relatives represent a genetic reservoir for breeding as they could provide useful alleles for adaptation to the environment and tolerance to biotic and abiotic stresses. We performed an in silico analysis to identify genes belonging to the Dof family in the wild potato S. commersonii, confirming that the identified Dof genes can be grouped in four classes (A, B, C, D), as reported for cultivated potato. A special focus was dedicated to Cycling Dof Factors (CDFs), which play a crucial role in plant responses to abiotic stresses. Analysis of available RNA-seq data confirmed CDF genes as regulated by stresses and often in a tissue specific manner. To ascertain their involvement in the stress response, S. tuberosum and S. commersonii plantlets growing in vitro were subjected to salt stress (80mM NaCl) for short (2 days) and prolonged (7 days) times. Analysis of phenotypic traits and qRT-PCR expression profiles of target CDF genes in aerial and root tissues showed differences between the two species. In addition, after saline treatment, changes in total phenols, proline, and malondialdehyde suggested a diverse perception of saline stress in S. commersonii vs. S. tuberosum. Overall, this study provided useful clues to the involvement of CDF genes in salt response and promoted the identification of potential candidate genes for further functional studies. [ABSTRACT FROM AUTHOR]

Although combination therapy is known for its high efficacy, reduced side effects and drug resistance, toxicity remains a major drawback. Some of the genes are likely to induce hepatotoxicity through ROS-mediated mechanisms when a drug is metabolized alone or in combination in the liver. To address this, we have developed a scientific approach to predict the toxicity of different genotoxin combinations and validate their interactions with various targets. The current study is an extensive study of our previous set of in vivo rat liver microarray data processed using R studio for their functional analysis. About five combinations of genotoxins such as CPT/ETP, CPT/CPL, ETP/CPL, CP/CPT and EES/CP along with their differential gene expression targeting Chemical carcinogenesis—ROS are chosen for this study. We aim to examine the binding affinity of different genotoxin combinations using in silico multiple ligand simultaneous docking (MLSD) and are then bio-evaluated for cytotoxicity in vitro using human hepatocellular carcinoma cell lines (HepG2) with the MTT assay. As a result, dose–response cytotoxicity with its strength of interactions and a significant variance in ROS levels in the treated cells is observed compared to their IC50 values. Out of 5 combinations such as CPT/CPL, ETP/CPL and EES/CP are found not only to be significantly cytotoxic but also induce oxidative stress specifically above their IC50 values with good and moderate binding interactions ensuring their toxicity. On the contrary, the safe combinations are found to be CTP/ETP and CP/CPT possibly with no and tolerable adverse effects standing as preliminary information for researchers in drug design and development. [ABSTRACT FROM AUTHOR]

Understanding the genetic background behind fat-tail development in sheep can be useful to develop breeding programs for genetic improvement, while the genetic basis of fat-tail formation is still not well understood. Here, to identify genomic regions influencing fat-tail size in sheep, a comprehensive selection signature identification analysis was performed through comparison of fat- and thin-tailed sheep breeds. Furthermore, to gain the first insights into the potential use of RNA-Seq for selection signature identification analysis, SNP calling was performed using RNA-Seq datasets. In total, 45 RNA-Seq samples from seven cohort studies were analyzed, and the FST method was used to detect selection signatures. Our findings indicated that RNA-Seq could be of potential utility for selection signature identification analysis. In total, 877 SNPs related to 103 genes were found to be under selection in 92 genomic regions. Functional annotation analysis reinforced the hypothesis that genes involved in fatty acid oxidation May modulate fat accumulation in the tail of sheep and highlighted the potential regulatory role of angiogenesis process in the fat deposition. In agreement with most previous studies, our results re-emphasize that the BMP2 gene is targeted by selection during sheep evolution. Further gene annotation analysis of the regions targeted by the sheep evolution process revealed that a large number of genes included in these regions are directly associated with fat metabolism, including those previously reported as candidates involved in sheep fat-tail morphology, such as NID2, IKBKG, RGMA, IGFBP7, UBR5, VEGFD and WLS. Moreover, a number of genes, including BDH2, ECHS1, AUH, ERBIN and CYP4V2 were of particular interest because they are well-known fat metabolism-associated genes and are considered novel candidates involved in fat-tail size. Consistent with the selection signature identification analysis, principal component analysis clustered the samples into two completely separate groups according to fat- and thin-tailed breeds. Our results provide novel insights into the genomic basis of phenotypic diversity related to the fat-tail of sheep breeds and can be used to determine directions for improving breeding strategies in the future. [ABSTRACT FROM AUTHOR]

Fungus-farming ants cultivate multiple lineages of fungi for food, but, because fungal cultivar relationships are largely unresolved, the history of fungus-ant coevolution remains poorly known. We designed probes targeting >2000 gene regions to generate a dated evolutionary tree for 475 fungi and combined it with a similarly generated tree for 276 ants. We found that fungus-ant agriculture originated ~66 million years ago when the end-of-Cretaceous asteroid impact temporarily interrupted photosynthesis, causing global mass extinctions but favoring the proliferation of fungi. Subsequently, ~27 million years ago, one ancestral fungal cultivar population became domesticated, i.e., obligately mutualistic, when seasonally dry habitats expanded in South America, likely isolating the cultivar population from its free-living, wet forest-dwelling conspecifics. By revealing these and other major transitions in fungus-ant coevolution, our results clarify the historical processes that shaped a model system for nonhuman agriculture. [ABSTRACT FROM AUTHOR]

Actinidia chlorotic ringspot-associated virus (AcCRaV, Emaravirus actinidiae) is prevalent in Chinese kiwifruit, leading to substantial yield reduction. The intricate nature of symptoms presents diagnostic challenges, underscoring the necessity for a rapid and accurate detection method that facilitates effective control. In this investigation, AcCRaV isolates from key kiwi-producing regions in Sichuan province were collected and analyzed, with representative strains chosen as experimental materials. Primers targeting the nucleoprotein gene of AcCRaV were designed, and their codon usage was optimized to enhance performance. Various serological methods utilizing polyclonal antibodies were developed, including ELISA, dot immunobinding assay, and AcCRaV-specific gold immunochromatographic bands (AcCRaV-GICS). Field samples exhibited high specificity and sensitivity when tested using these methods. Furthermore, the results obtained from a large number of field samples are consistent with those derived from RT-PCR analysis, further validating the applicability of our approach. A detection method capable of handling a large volume of field samples infected with AcCRaV is currently lacking; thus, our system construction provides an important reference for addressing this gap. [ABSTRACT FROM AUTHOR]

In nature, the number of genome or chromosome copies within cells (ploidy) can vary between species and environmental conditions, potentially influencing how organisms adapt to changing environments. Although ploidy levels cannot be easily determined by standard genome sequencing, understanding ploidy is crucial for the quantitative interpretation of molecular data. Cyanobacteria are known to contain haploid, oligoploid, and polyploid species. The smallest cyanobacteria, picocyanobacteria (less than 2 μm in diameter), have a widespread distribution ranging from marine to freshwater environments, contributing significantly to global primary production. In this study, we determined the ploidy level of genetically and physiologically diverse brackish picocyanobacteria isolated from the Baltic Sea using a qPCR assay targeting the rbcL gene. The strains contained one to four genome copies per cell. The ploidy level was not linked with phylogeny based on the identity of the 16S rRNA gene. The variation of ploidy among the brackish strains was lower compared to what has been reported for freshwater strains and was more similar to what has been reported for marine strains. The potential ecological advantage of polyploidy among picocyanobacteria has yet to be described. Our study highlights the importance of considering ploidy to interpret the abundance and adaptation of brackish picocyanobacteria. [ABSTRACT FROM AUTHOR]

Seaweed farming is the single largest aquaculture commodity with >30 million tonnes produced each year. Furthermore, the restoration of lost seaweed forests is gaining significant momentum, particularly for kelps in warming temperate areas. Whether in aquaculture settings, following restoration practices, or in the wild, all seaweeds undergo biotic interactions with a diverse range of co‐occurring or cocultured organisms. To date, most research assessing such biotic interactions has focused on the response of the organism interacting with seaweeds, rather than on the seaweeds themselves. However, understanding how seaweeds respond to other organisms, particularly on a molecular scale, is crucial for optimizing outcomes of seaweed farming or restoration efforts and, potentially, also for the conservation of natural populations. In this systematic review, we assessed the molecular processes that seaweeds undergo during biotic interactions and propose priority areas for future research. Despite some insights into the response of seaweeds to biotic interactions, this review specifically highlights a lack of characterization of biomolecules involved in the response to chemical cues derived from interacting organisms (four studies in the last 20 years) and a predominant use of laboratory‐based experiments conducted under controlled conditions. Additionally, this review reveals that studies targeting metabolites (70%) are more common than those examining the role of genes (22%) and proteins (8%). To effectively inform seaweed aquaculture efforts, it will be crucial to conduct larger scale experiments simulating natural environments. Also, employing a holistic approach targeting genes and proteins would be beneficial to complement the relatively well‐established role of metabolites. [ABSTRACT FROM AUTHOR]

Expression of major histocompatibility complex I (MHC-I) on tumor cells is extremely important for the antitumor immune response for its essential role in activating various immune cells, including tumor-specific CD8+ T cells. Cancers of lower MHC-I expression commonly exhibit less immune cell infiltration and worse prognosis in clinic. In this study, we conducted bioinformatic-experimental screening to identify potential gene targets to enhance MHC-I expression in breast cancer (BRCA). Through a combination of MHC-I scoring, gene expression correlation analysis, survival prognostication, and Cibersort tumor-infiltrated lymphocytes (TILs) scoring, we identify 144 genes negatively correlated with both MHC-I expression and TILs in breast cancer. Furthermore, we verified partially according to KEGG functional enrichment or gene-dependency analysis and figured out multiple genes, including PIP5K1A, NCKAP1, CYFIP1, DIS3, TBP, and EXOC1, as effective gene targets for increasing MHC-I expression in breast cancer. Mechanistically, knockout of each of these genes activated the intrinsic interferon response in breast cancer cells, which not only promoted MHC-I expression but also caused immunogenic cell death of breast cancer. Finally, the scRNA-seq confirmed the negative correlation of PIP5K1A et al. with TILs in breast cancer patients. Collectively, we identified multiple gene targets for an increase in MHC-I expression in breast cancer in this study. [ABSTRACT FROM AUTHOR]

The occurrence of type 2 diabetes mellitus (T2DM), a worldwide chronic disease, is mainly caused by insufficient insulin production and places a huge burden on the health system. Gastrodia elata Blume (GE), a food of medicine–food homology, has been reported to have the ability to inhibit glycosidase activity, indicating its potential in the treatment of diabetes. However, the main pharmacological components of GE for the treatment of T2DM have not been fully clarified. Therefore, this study aims to clarify the pharmacological components changes of GE with different drying methods and the treatment of T2DM using HPLC, network pharmacology, molecular docking and experimental evaluations. The results showed that the GE samples processed by the steam-lyophilized method possessed the highest total content of the six marker components and the strongest antioxidant and α-glucosidase inhibitory abilities. Meanwhile, the six marker compounds had a total of 238 T2DM-related gene targets. Notably, these active compounds have good affinity for key gene targets associated with T2DM signaling pathways. In conclusion, this study revealed that different drying methods of GE affect the content of its major active compounds, antioxidant capacity, α-glucosidase inhibitory capacity and potential pharmacological effects on T2DM, indicating that it is a potential treatment of T2DM. [ABSTRACT FROM AUTHOR]

Pain sensitivity is a significant factor in knee osteoarthritis (KOA), influencing patient outcomes and complicating treatment. Genetic differences, particularly in pain-sensing genes (PSRGs), are known to contribute to the variability in pain experiences among KOA patients. This study aims to systematically analyze PSRGs in KOA to better understand their role and potential as therapeutic targets. We utilized bulk RNA-seq data from the GSE114007 and GSE169077 datasets to identify differentially expressed genes, with 20 genes found to be significantly altered. Key PSRGs, including PENK, NGF, HOXD1, and TRPA1, were identified using LASSO, SVM, and random forest algorithms. Further, KEGG and GO enrichment analyses revealed pathways such as "Neuroactive ligand-receptor interaction" and "ECM-receptor interaction," which were validated through external datasets. Single-cell RNA-seq analysis from GSE152805, GSE133449, and GSE104782 datasets demonstrated the heterogeneity and dynamic expression of PSRGs across different cell subpopulations in synovium, meniscus, and cartilage samples. UMAP and pseudotime analyses were used to visualize spatial distribution and developmental trajectories of these genes. The findings emphasize the critical roles of PSRGs in KOA, highlighting their potential as therapeutic targets and suggesting that integrating genetic information into clinical practice could significantly improve pain management and treatment strategies for KOA. [ABSTRACT FROM AUTHOR]

The six most common missense mutations in the DNA binding domain of p53 are known as "hot spots" and include two of the most frequently occurring p53 mutations (p53-R175H and p53-R273H). p53 stability and function are regulated by various post-translational modifications such as phosphorylation, acetylation, sumoylation, methylation, and interactions with other proteins including plakoglobin. Previously, using various carcinoma cell lines we showed that plakoglobin interacted with wild-type and several endogenous p53 mutants (e.g., R280K, R273H, S241F, S215R, R175H) and restored their tumor suppressor activities in vitro. Since mutant p53 function is both mutant-specific and cell context-dependent, we sought herein, to determine if plakoglobin tumor suppressive effects on exogenously expressed p53-R273H and p53-R175H mutants are similarly maintained under the same genetic background using the p53-null and plakoglobin-deficient H1299 cell line. Functional assays were performed to assess colony formation, migration, and invasion while immunoblotting and qPCR were used to examine the subcellular distribution and expression of specific proteins and genes that are typically regulated by or regulate p53 function and are altered in mutant p53-expressing cell lines and tumors. We show that though, plakoglobin interacted with both p53-R273H and p53-R175H mutants, it had a differential effect on the transcription and subcellular distribution of their gene targets and their overall oncogenic properties in vitro. Notably, we found that plakoglobin's tumor suppressive effects were significantly stronger in p53-R175H expressing cells compared to p53-R273H cells. Together, our results indicate that exploring plakoglobin interactions with p53-R175H may be useful for the development of cancer therapeutics focused on the restoration of p53 function. [ABSTRACT FROM AUTHOR]

Purpose: Over 550 loci have been associated with human pulmonary function in genome-wide association studies (GWAS); however, the causal role of most remains uncertain. Single nucleotide polymorphisms in a disintegrin and metalloprotease domain 19 (ADAM19) are consistently related to pulmonary function in GWAS. Thus, we used a mouse model to investigate the causal link between Adam19 and pulmonary function. Methods: We created an Adam19 knockout (KO) mouse model and validated the gene targeting using RNA-Seq and RT-qPCR. Mouse body composition was assessed using dual-energy X-ray absorptiometry. Mouse lung function was measured using flexiVent. Results: Contrary to prior publications, the KO was not neonatal lethal. KO mice had lower body weight and shorter tibial length than wild-type (WT) mice. Their body composition revealed lower soft weight, fat weight, and bone mineral content. Adam19 KO had decreased baseline respiratory system elastance, minute work of breathing, tissue damping, tissue elastance, and forced expiratory flow at 50% forced vital capacity but higher FEV0.1 and FVC. Adam19 KO had attenuated tissue damping and tissue elastance in response to methacholine following LPS exposure. Adam19 KO also exhibited attenuated neutrophil extravasation into the airway after LPS administration compared to WT. RNA-Seq analysis of KO and WT lungs identified several differentially expressed genes (Cd300lg, Kpna2, and Pttg1) implicated in lung biology and pathogenesis. Gene set enrichment analysis identified negative enrichment for TNF pathways. Conclusion: Our murine findings support a causal role of ADAM19, implicated in human GWAS, in regulating pulmonary function. [ABSTRACT FROM AUTHOR]

Summary: Diurnal floret opening time (DFOT) is a pivotal trait for successful fertilization and hybrid breeding in rice. However, the molecular mechanism underlying this trait is poorly understood in rice.In this study, we combined the cytological, genetic and molecular studies to demonstrate that jasmonic acid (JA) regulates DFOT in rice through modulating the turgor and osmotic pressure of the lodicules.We show that lodicules undergo dramatic morphologic changes, accompanied by changes in water and sugar contents during the process of floret opening. Consistently, a large set of genes associated with cell osmolality and cell wall remodeling exhibits distinct expression profiles at different time points in our time‐course transcriptomes of lodicules. Notably, a group of JA biosynthesis and signaling genes is continuously upregulated, accompanied by a gradual increase in JA accumulation as floret opening approaching. Furthermore, we demonstrate that the JA biosynthesis gene OsAOS1 is required for endogenous JA biosynthesis in lodicules and promoting rice DFOT. Moreover, OsMYC2, a master regulator of JA signaling, regulates rice DFOT by directly activating OsAOS1, OsSWEET4, OsPIP2;2 and OsXTH9.Collectively, our findings establish a core regulatory network mediated by JA for modulating rice DFOT and provide effective gene targets for the genetic improvement of DFOT in rice. [ABSTRACT FROM AUTHOR]

Background: Hibiscus mutabilis L. is a popular regional characteristic plant in China, cultivated for its attractive flower colors, extended bloom time, and medicinal properties. To enhance molecular breeding and gene function studies, we conducted transcriptome analysis and identified valuable genes in previous research. Nonetheless, the current inefficient and labor-intensive transformation techniques have hindered their applications. Virus-induced gene silencing (VIGS) provides a precise and effective strategy for post-transcriptional down-regulation of endogenous gene expression. Methods: We investigated the performance of tobacco rattle virus (TRV) as a tool for targeting and silencing the gene encoding the protein involved in chloroplast development, cloroplastos alterados 1 (altered chloroplast; CLA1), of H. mutabilis through Agrobacterium tumefaciens-mediated infiltration. Results: By effectively suppressing the CLA1 gene associated with chloroplast development in H. mutabilis via the TRV-VIGS system, we have illustrated the inaugural implementation of VIGS in this species. Quantitative RT-PCR proved that HmCLA1 expression in agro-infiltrated plants was lower than in the mock-infiltrated (mock) and the control (CK) plants. Phenotypic observations corroborated the albino phenotype in leaves following successful HmCLA1 silencing. Conclusions: Our study showcases TRV-VIGS as a potential gene silencing tool for H. mutabilis, facilitating functional genomics studies and molecular breeding efforts in this species. [ABSTRACT FROM AUTHOR]

A recent study published in Cell by Liu et al. introduced a new dual homologous recombinase‐mediated genetic profiling tracer technique to track lung epithelial cells accurately, shedding light on the regenerative origin and regulatory mechanism of adult alveolar epithelial stem cells. The research highlights the importance of alveolar regeneration for maintaining lung homeostasis and facilitating post‐injury healing, emphasizing the role of club cells and bronchioalveolar stem cells in promoting alveolar regeneration after lung injury. By developing a novel dual homologous recombination tool, the authors were able to identify club cells as the primary source of alveolar stem cell regeneration, offering new insights for lung stem cell therapy and potential treatment approaches for lung damage healing. [Extracted from the article]

Background: Atrioventricular block (AVB) is a heterogeneous group of arrhythmias. AVB can lead to sudden arrest of the heart and subsequent syncope or sudden cardiac death. Few scholars have investigated the underlying molecular mechanisms of AVB. Finding molecular markers can facilitate understanding of AVB and exploration of therapeutic targets. Methods: Two-sample Mendelian randomization (MR) analysis was undertaken with inverse variance weighted (IVW) model and Wald ratio as the primary approach. Reverse MR analysis was undertaken to identify the associated protein targets and gene targets. Expression quantitative trait loci (eQTL) data from the eQTLGen database and protein quantitative trait loci (pQTL) data from three previous large-scale proteomic studies on plasma were retrieved as exposure data. Genome-wide association study (GWAS) summary data (586 cases and 379,215 controls) for AVB were retrieved from the UK Biobank database. Colocalization analyses were undertaken to identify the effect of filtered markers on outcome data. Databases (DrugBank, Therapeutic Target, PubChem) were used to identify drugs that interacted with targets. Results: We discovered that 692 genes and 42 proteins showed a significant correlation with the AVB phenotype. Proteins (cadherin-5, sTie-1, Notch 1) and genes (DNAJC30, ABO) were putative molecules to AVB. Drug–interaction analyses revealed anticancer drugs such as tyrosine-kinase inhibitors and TIMD3 inhibitors could cause AVB. Other substances (e.g. toxins, neurological drugs) could also cause AVB. Conclusions: We identified the proteins (cadherin-5, sTie-1, Notch 1) and gene (DNAJC30, ABO) targets associated with AVB pathogenesis. Anticancer drugs (tyrosine-kinase inhibitors, TIMD3 inhibitors), toxins, or neurological drugs could also cause AVB. [ABSTRACT FROM AUTHOR]

The global poultry industry, as a leading producer of animal protein, faces significant challenges related to animal health and production due to high bird density and disease risks. A major concern is the Avian Respiratory Complex (ARC), a multifactorial health issue involving pathogens such as avian metapneumovirus (aMPV), an often-underdiagnosed component of the ARC. Wild birds are seen as reservoirs and spreaders of the virus. This study aimed to detect the presence and subtypes of aMPV in samples from breeders, broilers, laying hens, and wild birds in Colombia. A total of 273 samples, including swabs from the upper respiratory and reproductive tracts, were collected from commercial poultry and wild birds. Using nested RT-PCR targeting the G gene, aMPV subtype B was identified in 23 samples (8.42%). Sequencing revealed high genetic similarity to vaccine strains, classifying all viruses as vaccine-like. In the commercial birds, aMPV-B appeared in 21 samples, regardless of symptoms, often in tests for other ARC agents, indicating diagnostic bias. In the wild birds, two samples tested positive, suggesting potential transmission between wild and domestic birds. These findings highlight the need for broader diagnostics and further research into aMPV's impact on avian health. [ABSTRACT FROM AUTHOR]

Q fever is a zoonosis caused by Coxiella burnetii, primarily affecting those in close contact with domestic ruminants, the main source of human infection. Coxiella burnetii has also been detected in various wildlife species globally. In Australia, serological and molecular studies have shown exposure to and infection by C. burnetii in macropods, bandicoots, and koalas. However, the extent to which these species contribute to human infection remains unclear. An unpublished public health investigation into a Q fever case in a person involved in koala care could not conclusively link the infection to koalas due to the patient's broad animal exposure. This study aimed to explore the potential role of koalas in transmitting C. burnetii to humans by investigating the presence of C. burnetii DNA in urogenital tract (UGT) swabs from koalas. DNA was extracted from UGT swabs from koalas in three regions in New South Wales, Australia. An optimised multiplex qPCR assay detected C. burnetii DNA in 2 out of 225 samples (0.89%) at approximately 10 genome equivalents per reaction. Both positive samples amplified all three gene targets. MLVA genotyping identified two distinct C. burnetii genotypes previously isolated from Australian Q fever cases. These findings highlight the need for vaccination against Q fever for those in close contact with koalas. [ABSTRACT FROM AUTHOR]

CRISPR/Cas9-mediated gene editing requires high efficiency to be routinely implemented, especially in species which are laborious and slow to transform. This requirement intensifies further when targeting multiple genes simultaneously, which is required for genetic screening or more complex genome engineering. Species in the Citrus genus fall into this category. Here we describe a series of experiments with the collective aim of improving multiplex gene editing in the Carrizo citrange cultivar using tRNA-based sgRNA arrays. We evaluate a range of promoters for their efficacy in such experiments and achieve significant improvements by optimizing the expression of both the Cas9 endonuclease and the sgRNA array. In the case of the former we find the UBQ10 or RPS5a promoters from Arabidopsis driving the zCas9i endonuclease variant useful for achieving high levels of editing. The choice of promoter expressing the sgRNA array also had a large impact on gene editing efficiency across multiple targets. In this respect Pol III promoters perform especially well, but we also demonstrate that the UBQ10 and ES8Z promoters from Arabidopsis are robust alternatives. Ultimately, this study provides a quantitative insight into CRISPR/Cas9 vector design that has practical application in the simultaneous editing of multiple genes in Citrus, and potentially other eudicot plant species. [ABSTRACT FROM AUTHOR]

Background: Trichomonas vaginalis (TV) accounts for the highest burden of curable, non-viral sexually transmitted infections worldwide. Prevalence in India ranges from 0.4 to 27.4% in women and 0.0-5.6% in men. In 2015, the prevalence of TV among pregnant women of rural Vellore was 3.11% using Sekisui OSOM® Trichomonas test and culture methods. Molecular methods are the most sensitive, rapid diagnostic tool for Sexually Transmitted Infection's (STI) albeit cost hinders implementation of commercial platforms. To determine a sensitive, sustainable molecular method, we compared three targets (Adhesin AP65, cytoskeleton Beta-tubulin BTUB 9/2 and TVK 3/7) with the highest published diagnostic accuracy against microscopy, culture and Real Time PCR (RT- PCR). Materials & methods: Six-hundred adult, sexually active women attending the Obstetrics-Gynaecology rural out-patient clinic the Rural Unit for Health and Social Affairs (RUHSA) from July 2020 - February 2021 were enrolled. A vaginal lateral and posterior fornix specimen was inoculated, onsite, into Biomed InPouch® TV culture and smeared onto a slide for fluorescence microscopy using Acridine orange. A flocked nylon swab specimen for PCR was used to determine the sensitivities of the Adhesin AP65, cytoskeleton Beta-tubulin BTUB 9/2 and TVK 3/7 gene targets. Seegene Allplex™ STI Essential Assay, S.Korea was used to confirm TV positives. Results: Nine specimens (9/600, 1.5%) were positive for TV. There was a 100% correlation between Biomed InPouch TV® culture, PCR with TVK 3/7 and RT-PCR while a correlation of 66.6% with BTUB 9/2 and AP65 gene targets. Clinically, 77.7% (n = 7) presented with white-greenish discharge per vagina, 11% (n = 1) with infertility, 22.2% (n = 2) were asymptomatic. Eight of nine patients (88.9%) had co-infections with other bacterial STIs. Prevalence of TV coinfection with Neisseria gonorrhoea was 1.1%. Conclusion: Current hospital-based prevalence of TV in rural Vellore was 1.5%. Repetitive DNA target TVK 3/7 was more sensitive than AP65 and BTUB 9/2 primers. [ABSTRACT FROM AUTHOR]

Amplifying small subunit (SSU) rRNA genes with universal primers in assessing microbial populations diversity, but target microorganisms are sometimes omitted due to inadequate primer coverage. Adding degenerate bases to primers can help, but existing methods are complex and time-consuming. This study introduces a user-friendly tool called "Degenerate primer 111" for adding degenerate bases to existing universal primers. By aligning one universal primer with one uncovered target microorganism's SSU rRNA gene, this tool iteratively generates a new primer, maximizing coverage for the target microorganisms. The tool was used to modify eight pairs of universal primers (515F Parada-806R Apprill, S-D-Bact-0341-b-S-17/S-D-Bact-0785-a-A-21, OP_F114-KP_R013, 27F-1492R, 341F-806R, OP_F066-KP_R013, 515F Parada-926R Quince, 616*F-1132R), and generated 29 new universal primers with increased coverage of specific target microorganisms without increasing coverage of non-target microorganisms. To verify the effectiveness of the improved primers, one set of original and improved primers (BA-515F-806R and BA-515F-806R-M1) was used to amplify DNA from the same sample, and high-throughput sequencing of the amplicons confirmed that the improved primers detected more microbial species compared to the original primers. Future researchers can use this tool to develop more personalized primers to meet their diverse microorganism detection needs. [ABSTRACT FROM AUTHOR]

Treating diabetic wounds effectively remains a significant clinical challenge. Emerging studies suggest that microRNAs (miRNAs) play crucial roles in various physiological and pathological processes and hold promise as therapeutic tools. This study investigates the miRNA expression profile in keratinocytes using a cell model of diabetic wounds. Microarray analysis revealed that 43 miRNAs from wounded keratinocytes incubated under diabetic conditions (high glucose/hypoxia) exhibited a two-fold change in expression compared to those incubated under normal conditions (low glucose/normoxia). Quantitative RT-PCR confirmed significant differences in the expression of eight miRNAs, with miR-3138 and miR-3679-5p being further analyzed for their roles in keratinocyte migration. Transfection with a miR-3138 mimic and a miR-3679-5p inhibitor indicated that upregulation of miR-3138 and downregulation of miR-3679-5p enhance keratinocyte migration in both normal and diabetic wounds. Pathway and gene ontology (GO) analyses identified potential pathways and functional annotations associated with miR-3138 and miR-3679-5p in diabetic wound healing. Potential human gene targets of miR-3138 and miR-3679-5p were predicted using a three-way comparison of the TargetScan, miRDB, and DIANA databases. This study elucidates the miRNA expression signature of human keratinocytes in a diabetes-like environment, providing deeper insights into the pathogenesis of diabetic wounds. [ABSTRACT FROM AUTHOR]

Copyright of Food Research & Development is the property of Food Research & Development Editorial Department and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

The "Mlx" and "Myc" transcription factor networks cross‐communicate and share many common gene targets. Myc's activity depends upon its heterodimerization with Max, whereas the Mlx Network requires that the Max‐like factor Mlx associate with the Myc‐like factors MondoA or ChREBP. The current work demonstrates that body‐wide Mlx inactivation, like that of Myc, accelerates numerous aging‐related phenotypes pertaining to body habitus and metabolism. The deregulation of numerous aging‐related Myc target gene sets is also accelerated. Among other functions, these gene sets often regulate ribosomal and mitochondrial structure and function, genomic stability, and aging. Whereas "MycKO" mice have an extended lifespan because of a lower cancer incidence, "MlxKO" mice have normal lifespans and a higher cancer incidence. Like Myc, the expression of Mlx, MondoA, and ChREBP and their control over their target genes deteriorate with age in both mice and humans. Collectively, these findings underscore the importance of lifelong and balanced cross‐talk between the two networks to maintain proper function and regulation of the many factors that can affect normal aging. [ABSTRACT FROM AUTHOR]

GeoMx Digital Spatial Profiling (Nanostring) is a commercial spatial transcriptomics method to selectively analyze regions of interest within intact tissue sections. We show that decalcification with ethylene-diamine-tetra-acetic (EDTA) variably attenuates probe counts, while probes that are more resistant to this effect consequently appear overexpressed after quantile normalization. By determining the undisclosed full-length target sequences of probes used in the human whole transcriptome panel, hereby updating target transcripts and genes, we find that the gene-promiscuity of probes is an important factor that determines sensitivity to EDTA incubation. [ABSTRACT FROM AUTHOR]

Kawakawa (Piper excelsum) is an endemic medicinal plant widely consumed by Māori in New Zealand. Presence of diverse biologically active phytochemicals in kawakawa may underpin its putative therapeutic anti‐inflammatory properties. However, no human studies on its anti‐inflammatory effects are yet undertaken. Blood samples from a randomized controlled dietary intervention exploring the impact of kawakawa compared to control on postprandial microRNAs (miRNA) abundances and their respective gene and protein targets in a cohort of healthy human volunteers (n = 26; Age; 33.6 ± 1.9 year and BMI; 22.5 ± 0.4 kg/m2) were analyzed. Postprandial levels of nine miRNAs showed differential abundances; hsa‐miR‐17‐5p, ‐21‐5p, ‐320a‐5p, let‐7g‐5p, ‐16‐5p, ‐122‐5p, and ‐144‐3p was upregulated while as hsa‐miR‐221‐3p and ‐223‐3p was downregulated in response to kawakawa compared to control. In silico analysis indicated enrichment of miRNAs in multiple inflammation‐related pathways, including apoptosis, cytokine signaling, MAPK signaling, and MTOR pathways. Furthermore, gene expression of IL‐8 (p = .03), IL‐6 (p = .01), and PPAR‐γ were significantly reduced following kawakawa intake compared to control. While as plasma IL‐6 showed a significant increase over 120 min in the kawakawa arm. These results highlight kawakawa to exert anti‐inflammatory effects by modulating the expression of miRNAs and their target genes and proteins in the inflammatory signaling pathways. [ABSTRACT FROM AUTHOR]

Background: The spread of antimalarial drug resistance parasites is a major obstacle in eliminating malaria in endemic areas. This increases the urgency for developing novel antimalarial drugs with improved profiles to eliminate both sensitive and resistant parasites in populations. The invention of the drug candidates needs a model for sensitive and resistant parasites on a laboratory scale. Methods: Repeated Incomplete Treatment (RIcT) method was followed in raising the rodent malaria parasite, Plasmodium berghei, resistant to sulfadoxine. Plasmodium berghei were exposed to an adequate therapeutic dose of sulfadoxine without finishing the treatment to let the parasite recover. Cycles of drug treatment and parasite recovery were repeated until phenotypic resistance appeared. Results: After undergoing 3–4 cycles, phenotypic resistance was not yet found in mice treated with sulfadoxine. Nevertheless, the molecular biology of dhps gene (the target of sulfadoxine) was analyzed at the end of the RIcT cycle. There was no mutations found in the gene target. Interestingly, the appearance of gametocytes at the end of every cycle of drug treatment and parasite recovery was observed. These gametocytes later on would no longer extend their life in the RBC stage, unless mosquitoes bite the infected host. This phenomenon is similar to the case in human malaria infections treated with sulfadoxine-pyrimethamine (SP). Conclusions: In this study, the antimalarial drug sulfadoxine induced gametocytogenesis in P. berghei, which could raise the risk factor for malaria transmission. [ABSTRACT FROM AUTHOR]

Background: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM). Aim: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. Methods: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. Results: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples. Conclusion: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs. [ABSTRACT FROM AUTHOR]

OBJECTIVE: To probe into the mechanism of Fufang Yizhihuanghua spray in the treatment of upper respiratory tract infection. METHODS: Components of Fufang Yizhihuanghua spray were selected by using Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform. The targets were predicted in Swiss Target Prediction database. Combined with the upper respiratory tract infection-related targets obtained from GeneCards and other databases, the intersection targets and active components were imported into Cytoscape 3. 9. 0 software to obtain the interaction network of component-potential target-disease. Protein-protein interaction (PPI) analysis of intersection targets was performed by using STRING database. Key targets were selected for gene ontology functional enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. AutoDockTools 1. 5. 7 software was used to predict the binding activity of core components and core targets with high degree ranking. RESULTS: Totally 235 gene targets were obtained after the intersection of the relevant component targets and disease targets of FufangYizhihuanghua spray as potential targets for the treatment of upper respiratory tract infection. PPI and Topology analysis identified 95 key targets. KEGG enrichment analysis showed that the pathway was mainly concentrated in the PI3K-Akt signaling pathway. Molecular docking results showed that the core components such as quercetin and luteolin, can stably bind to the core targets such as PTGS2, Akt1, and CASP3. CONCLUSIONS: The results predicts and verifies the mechanism of Fufang Yizhihuanghua spray in the treatment of upper respiratory tract infection, and lays foundation for further research. [ABSTRACT FROM AUTHOR]

Background: RT-qPCR is a powerful strategy for recognizing the most appropriate reference genes, which can successfully minimize experimental mistakes through accurate normalization. Ludisia discolor, recognized for its ornamental value, features little, distinctive blossoms with twisted lips and gynostemium showing chiral asymmetry, together with striking blood-red fallen leaves periodically marked with golden blood vessels. Methods and Results: To ensure the accuracy of qRT-PCR, selecting appropriate reference genes for quantifying target gene expression levels is essential. This study aims to identify stable reference genes during the development of L. discolor. In this study, the entire floral buds, including the lips and gynostemium from different development stages, were taken as materials. Based upon the transcriptome information of L. discolor, nine housekeeping genes, ACT, HIS, EF1-α1, EF1-α2, PP2A, UBQ1, UBQ2, UBQ3, and TUB, were selected in this research study as prospect interior referral genes. The expression of these nine genes were found by RT-qPCR and afterwards comprehensively examined by four software options: geNorm, NormFinder, BestKeeper, and ΔCt. The outcomes of the analysis showed that ACT was the most steady gene, which could be the most effective inner referral gene for the expression evaluation of flower advancement in L. discolor. Conclusions: The results of this study will contribute to the molecular biology research of flower development in L. discolor and closely related species. [ABSTRACT FROM AUTHOR]

This study focuses on the detection and differentiation of Canine Parvovirus 2 (CPV-2) strains in India using High Resolution Melt (HRM) curve analysis. CPV-2 is a highly contagious virus causing acute haemorrhagic enteritis and myocarditis in dogs, with a high mortality rate. A total of 45 faecal swab samples were collected from suspected CPV cases, out of which 20 tested samples were positive for CPV using PCR targeting the VP2 gene. These positive samples were further analyzed using HRM, which predicted them to belong to the CPV2a strain based on their melting temperature (71.4° or less). Two CPV2a positive samples were sequenced, they were found to belong to CPV2b strains, indicating a discrepancy between HRM prediction and sequencing results. Single nucleotide polymorphic variations were observed at positions 4062 and 4064, confirming their classification as CPV2b strains. Phylogenetic analysis of VP2 capsid gene showed that these field samples were closely related to CPV2c strains, suggesting potential genetic diversity among circulating CPV strains in India. The study highlights the importance of developing geographically specific CPV strain primers for accurate detection and differentiation using HRM. It raises concerns about potential co-infections or the emergence of new strains, indicated by varying melting temperatures in field samples. [ABSTRACT FROM AUTHOR]

Breeders need to mine the underlying genes of target traits for their improvement before the inception of the breeding program. We conducted this research to decipher the number of genes along with their interactions and linkage for seed color, flower color, and anther color, and to show the reflection of genetic divergence on phenotypic variations in segregating populations by crossing diverse flax (Linum usitatissimum L.) genotypes. Seed color showed maternal effect and appeared to be controlled by two and three independent genes having dominant, duplicate, and dominant epistatic interactions varying according to cross combinations. The flower and anther color were controlled by one and two independent genes showing dominant and duplicate interactions. We observed a strong genetic linkage among seed, flower, and anther color genes. We also found that the incorporation of diverse parents in crossing resulted in more phenotypic variation, which included new phenotypic classes other than parents in the segregating population for seed color. This research will facilitate indirect selection and help in developing markers for marker‐assisted selection in flax breeding program. Core Ideas: This research examined the number of genes controlling seed color, flower color, and anther color in oilseed flax, as well as their genetic interactions.To reach conclusions, 16 crosses were made among different parents.This research will facilitate indirect selection and help in developing markers for marker‐assisted selection in flax breeding program. [ABSTRACT FROM AUTHOR]