Search

PURPOSE: The purpose of this study was to evaluate RB1 expression and survival across ovarian carcinoma histotypes and how co-occurrence of BRCA1 or BRCA2 (BRCA) alterations and RB1 loss influences survival in tubo-ovarian high-grade serous carcinoma (HGSC). EXPERIMENTAL DESIGN: RB1 protein expression was classified by immunohistochemistry in ovarian carcinomas of 7,436 patients from the Ovarian Tumor Tissue Analysis consortium. We examined RB1 expression and germline BRCA status in a subset of 1,134 HGSC, and related genotype to overall survival (OS), tumor-infiltrating CD8+ lymphocytes, and transcriptomic subtypes. Using CRISPR-Cas9, we deleted RB1 in HGSC cells with and without BRCA1 alterations to model co-loss with treatment response. We performed whole-genome and transcriptome data analyses on 126 patients with primary HGSC to characterize tumors with concurrent BRCA deficiency and RB1 loss. RESULTS: RB1 loss was associated with longer OS in HGSC but with poorer prognosis in endometrioid ovarian carcinoma. Patients with HGSC harboring both RB1 loss and pathogenic germline BRCA variants had superior OS compared with patients with either alteration alone, and their median OS was three times longer than those without pathogenic BRCA variants and retained RB1 expression (9.3 vs. 3.1 years). Enhanced sensitivity to cisplatin and paclitaxel was seen in BRCA1-altered cells with RB1 knockout. Combined RB1 loss and BRCA deficiency correlated with transcriptional markers of enhanced IFN response, cell-cycle deregulation, and reduced epithelial-mesenchymal transition. CD8+ lymphocytes were most prevalent in BRCA-deficient HGSC with co-loss of RB1. CONCLUSIONS: Co-occurrence of RB1 loss and BRCA deficiency was associated with exceptionally long survival in patients with HGSC, potentially due to better treatment response and immune stimulation.

The development of the retina is under tight temporal and spatial control. To gain insights into the molecular basis of this process, we generate a single-nuclei dual-omic atlas of the human developing retina with approximately 220,000 nuclei from 14 human embryos and fetuses aged between 8 and 23-weeks post-conception with matched macular and peripheral tissues. This atlas captures all major cell classes in the retina, along with a large proportion of progenitors and cell-type-specific precursors. Cell trajectory analysis reveals a transition from continuous progression in early progenitors to a hierarchical development during the later stages of cell type specification. Both known and unrecorded candidate transcription factors, along with gene regulatory networks that drive the transitions of various cell fates, are identified. Comparisons between the macular and peripheral retinae indicate a largely consistent yet distinct developmental pattern. This atlas offers unparalleled resolution into the transcriptional and chromatin accessibility landscapes during development, providing an invaluable resource for deeper insights into retinal development and associated diseases.

A mechanistic understanding of host-microbe interactions in the gut microbiome is hindered by poorly annotated bacterial genomes. While functional genomics can generate large gene-to-phenotype datasets to accelerate functional discovery, their applications to study gut anaerobes have been limited. For instance, most gain-of-function screens of gut-derived genes have been performed in Escherichia coli and assayed in a small number of conditions. To address these challenges, we develop Barcoded Overexpression BActerial shotgun library sequencing (Boba-seq). We demonstrate the power of this approach by assaying genes from diverse gut Bacteroidales overexpressed in Bacteroides thetaiotaomicron. From hundreds of experiments, we identify new functions and phenotypes for 29 genes important for carbohydrate metabolism or tolerance to antibiotics or bile salts. Highlights include the discovery of a D-glucosamine kinase, a raffinose transporter, and several routes that increase tolerance to ceftriaxone and bile salts through lipid biosynthesis. This approach can be readily applied to develop screens in other strains and additional phenotypic assays.

HER2, encoded by the ERBB2 gene, is an important druggable driver of human cancer gaining increasing importance as a therapeutic target in urothelial carcinoma (UC). The genomic underpinnings of HER2 overexpression in ERBB2 nonamplified UC are poorly defined. To address this knowledge gap, we investigated 172 UC tumors from patients treated at the University of California San Francisco, using immunohistochemistry and next-generation sequencing. We found that GATA3 and PPARG copy number gains individually predicted HER2 protein expression independently of ERBB2 amplification. To validate these findings, we interrogated the Memorial Sloan Kettering/The Cancer Genome Atlas (MSK/TCGA) dataset and found that GATA3 and PPARG copy number gains individually predicted ERBB2 mRNA expression independently of ERBB2 amplification. Our findings reveal a potential link between the luminal marker HER2 and the key transcription factors GATA3 and PPARG in UC and highlight the utility of examining GATA3 and PPARG copy number states to identify UC tumors that overexpress HER2 in the absence of ERBB2 amplification. In summary, we found that an increase in copy number of GATA3 and PPARG was independently associated with higher ERBB2 expression in patient samples of UC. This finding provides a potential explanation for HER2 overexpression in UC tumors without ERBB2 amplification and a way to identify these tumors for HER2-targeted therapies.

Macrophages sense pathogens and orchestrate specific immune responses. Stimulus specificity is thought to be achieved through combinatorial and dynamical coding by signaling pathways. While NFκB dynamics are known to encode stimulus information, dynamical coding in other signaling pathways and their combinatorial coordination remain unclear. Here, we established live-cell microscopy to investigate how NFκB and p38 dynamics interface in stimulated macrophages. Information theory and machine learning revealed that p38 dynamics distinguish cytokine TNF from pathogen-associated molecular patterns and high doses from low, but contributed little to information-rich NFκB dynamics when both pathways are considered. This suggests that immune response genes benefit from decoding immune signaling dynamics or combinatorics, but not both. We found that the heterogeneity of the two pathways is surprisingly uncorrelated. Mathematical modeling revealed potential sources of uncorrelated heterogeneity in the branched pathway network topology and predicted it to drive gene expression variability. Indeed, genes dependent on both p38 and NFκB showed high scRNAseq variability and bimodality. These results identify combinatorial signaling as a mechanism to restrict NFκB-AND-p38-responsive inflammatory cytokine expression to few cells.

The impact of variations in the three-dimensional structure of the genome has been recognized, but solid cancer tissue studies are limited. Here, we performed integrated deep Hi-C sequencing with matched whole-genome sequencing, whole-genome bisulfite sequencing, 5-hydroxymethylcytosine (5hmC) sequencing and RNA sequencing across a cohort of 80 biopsy samples from patients with metastatic castration-resistant prostate cancer. Dramatic differences were present in gene expression, 5-methylcytosine/5hmC methylation and in structural variation versus mutation rate between A and B (open and closed) chromatin compartments. A subset of tumors exhibited depleted regional chromatin contacts at the AR locus, linked to extrachromosomal circular DNA (ecDNA) and worse response to AR signaling inhibitors. We also identified topological subtypes associated with stark differences in methylation structure, gene expression and prognosis. Our data suggested that DNA interactions may predispose to structural variant formation, exemplified by the recurrent TMPRSS2-ERG fusion. This comprehensive integrated sequencing effort represents a unique clinical tumor resource.

The androgen receptor (AR) is the main driver in the development of castration-resistant prostate cancer, where the emergence of AR splice variants leads to treatment-resistant disease. Through detailed molecular studies of the marine alkaloid manzamine A (MA), we identified transcription factor E2F8 as a previously unknown regulator of AR transcription that prevents AR synthesis in prostate cancer cells. MA significantly inhibited the growth of various prostate cancer cell lines and was highly effective in inhibiting xenograft tumor growth in mice without any pathophysiological perturbations in major organs. MA suppressed the full-length AR (AR-FL), its spliced variant AR-V7, and the AR-regulated prostate-specific antigen (PSA; also known as KLK3) and human kallikrein 2 (hK2; also known as KLK2) genes. RNA sequencing (RNA-seq) analysis and protein modeling studies revealed E2F8 interactions with DNA as a potential novel target of MA, suppressing AR transcription and its synthesis. This novel mechanism of blocking AR biogenesis via E2F8 may provide an opportunity to control therapy-resistant prostate cancer over the currently used AR antagonists designed to target different parts of the AR gene.

BACKGROUND: Deeper insights into ERBB2-driven cancers are essential to develop new treatment approaches for ERBB2+ breast cancers (BCs). We employed the Collaborative Cross (CC) mouse model to unearth genetic factors underpinning Erbb2-driven mammary tumour development and metastasis. METHODS: 732 F1 hybrid female mice between FVB/N MMTV-Erbb2 and 30 CC strains were monitored for mammary tumour phenotypes. GWAS pinpointed SNPs that influence various tumour phenotypes. Multivariate analyses and models were used to construct the polygenic score and to develop a mouse tumour susceptibility gene signature (mTSGS), where the corresponding human ortholog was identified and designated as hTSGS. The importance and clinical value of hTSGS in human BC was evaluated using public datasets, encompassing TCGA, METABRIC, GSE96058, and I-SPY2 cohorts. The predictive power of mTSGS for response to chemotherapy was validated in vivo using genetically diverse MMTV-Erbb2 mice. FINDINGS: Distinct variances in tumour onset, multiplicity, and metastatic patterns were observed in F1-hybrid female mice between FVB/N MMTV-Erbb2 and 30 CC strains. Besides lung metastasis, liver and kidney metastases emerged in specific CC strains. GWAS identified specific SNPs significantly associated with tumour onset, multiplicity, lung metastasis, and liver metastasis. Multivariate analyses flagged SNPs in 20 genes (Stx6, Ramp1, Traf3ip1, Nckap5, Pfkfb2, Trmt1l, Rprd1b, Rer1, Sepsecs, Rhobtb1, Tsen15, Abcc3, Arid5b, Tnr, Dock2, Tti1, Fam81a, Oxr1, Plxna2, and Tbc1d31) independently tied to various tumour characteristics, designated as a mTSGS. hTSGS scores (hTSGSS) based on their transcriptional level showed prognostic values, superseding clinical factors and PAM50 subtype across multiple human BC cohorts, and predicted pathological complete response independent of and superior to MammaPrint score in I-SPY2 study. The power of mTSGS score for predicting chemotherapy response was further validated in an in vivo mouse MMTV-Erbb2 model, showing that, like findings in human patients, mouse tumours with low mTSGS scores were most likely to respond to treatment. INTERPRETATION: Our investigation has unveiled many new genes predisposing individuals to ERBB2-driven cancer. Translational findings indicate that hTSGS holds promise as a biomarker for refining treatment strategies for patients with BC. FUNDING: The U.S. Department of Defense (DoD) Breast Cancer Research Program (BCRP) (BC190820), United States; MCIN/AEI/10.13039/501100011039 (PID2020-118527RB-I00, PDC2021-121735-I00), the European Union Next Generation EU/PRTR, the Regional Government of Castile and León (CSI144P20), European Union.

The contrast between the disruption of genome topology after cohesin loss and the lack of downstream gene expression changes instigates intense debates regarding the structure-function relationship between genome and gene regulation. Here, by analyzing transcriptome and chromatin accessibility at the single-cell level, we discover that, instead of dictating population-wide gene expression levels, cohesin supplies a general function to neutralize stochastic coexpression tendencies of cis-linked genes in single cells. Notably, cohesin loss induces widespread gene coactivation and chromatin co-opening tens of million bases apart in cis. Spatial genome and protein imaging reveals that cohesin prevents gene co-bursting along the chromosome and blocks spatial mixing of transcriptional hubs. Single-molecule imaging shows that cohesin confines the exploration of diverse enhancer and core promoter binding transcriptional regulators. Together, these results support that cohesin arranges nuclear topology to control gene coexpression in single cells.

IGHMBP2 is a nonessential, superfamily 1 DNA/RNA helicase that is mutated in patients with rare neuromuscular diseases SMARD1 and CMT2S. IGHMBP2 is implicated in translational and transcriptional regulation via biochemical association with ribosomal proteins, pre-rRNA processing factors, and tRNA-related species. To uncover the cellular consequences of perturbing IGHMBP2, we generated full and partial IGHMBP2 deletion K562 cell lines. Using polysome profiling and a nascent protein synthesis assay, we found that IGHMBP2 deletion modestly reduces global translation. We performed Ribo-seq and RNA-seq and identified diverse gene expression changes due to IGHMBP2 deletion, including ATF4 up-regulation. With recent studies showing the integrated stress response (ISR) can contribute to tRNA metabolism-linked neuropathies, we asked whether perturbing IGHMBP2 promotes ISR activation. We generated ATF4 reporter cell lines and found IGHMBP2 knockout cells demonstrate basal, chronic ISR activation. Our work expands upon the impact of IGHMBP2 in translation and elucidates molecular mechanisms that may link mutant IGHMBP2 to severe clinical phenotypes.

The red and far-red light photoreceptor phytochrome B (phyB) transmits light signals following cytosol-to-nuclear translocation to regulate transcriptional networks therein. This necessitates changes in protein-protein interactions of phyB in the cytosol, about which little is presently known. Via introduction of a nucleus-excluding G767R mutation into the dominant, constitutively active phyBY276H (YHB) allele, we explore the functional consequences of expressing a cytosol-localized YHBG767R variant in transgenic Arabidopsis seedlings. We show that YHBG767R elicits selective constitutive photomorphogenic phenotypes in dark-grown phyABCDE null mutants, wild type and other phy-deficient genotypes. These responses include light-independent apical hook opening, cotyledon unfolding, seed germination and agravitropic hypocotyl growth with minimal suppression of hypocotyl elongation. Such phenotypes correlate with reduced PIF3 levels, which implicates cytosolic targeting of PIF3 turnover or PIF3 translational inhibition by YHBG767R. However, as expected for a cytoplasm-tethered phyB, YHBG767R elicits reduced light-mediated signaling activity compared with similarly expressed wild-type phyB in phyABCDE mutant backgrounds. YHBG767R also interferes with wild-type phyB light signaling, presumably by formation of cytosol-retained and/or otherwise inactivated heterodimers. Our results suggest that cytosolic interactions with PIFs play an important role in phyB signaling even under physiological conditions.

Saponins are plant secondary metabolites comprising glycosylated triterpenoids, steroids or steroidal alkaloids with a broad spectrum of toxicity to microbial pathogens and pest organisms that contribute to basal plant defense to biotic attack. Secretion of glycosyl hydrolases that enzymatically convert saponins into less toxic products was thus far the only mechanism reported to enable fungal pathogens to colonize their saponin-containing host plant(s). We studied the mechanisms that the fungus Botrytis cinerea utilizes to be tolerant to well-characterized, structurally related saponins from tomato and Digitalis purpurea. By gene expression studies, comparative genomics, enzyme assays and testing a large panel of fungal (knockout and complemented) mutants, we unraveled four distinct cellular mechanisms that participate in the mitigation of the toxic activity of these saponins and in virulence on saponin-producing host plants. The enzymatic deglycosylation that we identified is novel and unique to this fungus-saponin combination. The other three tolerance mechanisms operate in the fungal membrane and are mediated by protein families that are widely distributed in the fungal kingdom. We present a spatial and temporal model on how these mechanisms jointly confer tolerance to saponins and discuss the repercussions of these findings for other plant pathogenic fungi, as well as human pathogens.

UNLABELLED: Vibrio cholerae, the causative agent of the diarrheal disease cholera, poses an ongoing health threat due to its wide repertoire of horizontally acquired elements (HAEs) and virulence factors. New clinical isolates of the bacterium with improved fitness abilities, often associated with HAEs, frequently emerge. The appropriate control and expression of such genetic elements is critical for the bacteria to thrive in the different environmental niches they occupy. H-NS, the histone-like nucleoid structuring protein, is the best-studied xenogeneic silencer of HAEs in gamma-proteobacteria. Although H-NS and other highly abundant nucleoid-associated proteins (NAPs) have been shown to play important roles in regulating HAEs and virulence in model bacteria, we still lack a comprehensive understanding of how different NAPs modulate transcription in V. cholerae. By obtaining genome-wide measurements of protein occupancy and active transcription in a clinical isolate of V. cholerae, harboring recently discovered HAEs encoding for phage defense systems, we show that a lack of H-NS causes a robust increase in the expression of genes found in many HAEs. We further found that TsrA, a protein with partial homology to H-NS, regulates virulence genes primarily through modulation of H-NS activity. We also identified few sites that are affected by TsrA independently of H-NS, suggesting TsrA may act with diverse regulatory mechanisms. Our results demonstrate how the combinatorial activity of NAPs is employed by a clinical isolate of an important pathogen to regulate recently discovered HAEs. IMPORTANCE: New strains of the bacterial pathogen Vibrio cholerae, bearing novel horizontally acquired elements (HAEs), frequently emerge. HAEs provide beneficial traits to the bacterium, such as antibiotic resistance and defense against invading bacteriophages. Xenogeneic silencers are proteins that help bacteria harness new HAEs and silence those HAEs until they are needed. H-NS is the best-studied xenogeneic silencer; it is one of the nucleoid-associated proteins (NAPs) in gamma-proteobacteria and is responsible for the proper regulation of HAEs within the bacterial transcriptional network. We studied the effects of H-NS and other NAPs on the HAEs of a clinical isolate of V. cholerae. Importantly, we found that H-NS partners with a small and poorly characterized protein, TsrA, to help domesticate new HAEs involved in bacterial survival and in causing disease. A proper understanding of the regulatory state in emerging isolates of V. cholerae will provide improved therapies against new isolates of the pathogen.

Engineering metabolism to efficiently produce chemicals from multi-step pathways requires optimizing multi-gene expression programs to achieve enzyme balance. CRISPR-Cas transcriptional control systems are emerging as important tools for programming multi-gene expression, but poor predictability of guide RNA folding can disrupt expression control. Here, we correlate efficacy of modified guide RNAs (scRNAs) for CRISPR activation (CRISPRa) in E. coli with a computational kinetic parameter describing scRNA folding rate into the active structure (rS = 0.8). This parameter also enables forward design of scRNAs, allowing us to design a system of three synthetic CRISPRa promoters that can orthogonally activate (>35-fold) expression of chosen outputs. Through combinatorial activation tuning, we profile a three-dimensional design space expressing two different biosynthetic pathways, demonstrating variable production of pteridine and human milk oligosaccharide products. This RNA design approach aids combinatorial optimization of metabolic pathways and may accelerate routine design of effective multi-gene regulation programs in bacterial hosts.

Patterns of transcriptional activity are encoded in our genome through regulatory elements such as promoters or enhancers that, paradoxically, contain similar assortments of sequence-specific transcription factor (TF) binding sites1-3. Knowledge of how these sequence motifs encode multiple, often overlapping, gene expression programs is central to understanding gene regulation and how mutations in non-coding DNA manifest in disease4,5. Here, by studying gene regulation from the perspective of individual transcription start sites (TSSs), using natural genetic variation, perturbation of endogenous TF protein levels and massively parallel analysis of natural and synthetic regulatory elements, we show that the effect of TF binding on transcription initiation is position dependent. Analysing TF-binding-site occurrences relative to the TSS, we identified several motifs with highly preferential positioning. We show that these patterns are a combination of a TF's distinct functional profiles-many TFs, including canonical activators such as NRF1, NFY and Sp1, activate or repress transcription initiation depending on their precise position relative to the TSS. As such, TFs and their spacing collectively guide the site and frequency of transcription initiation. More broadly, these findings reveal how similar assortments of TF binding sites can generate distinct gene regulatory outcomes depending on their spatial configuration and how DNA sequence polymorphisms may contribute to transcription variation and disease and underscore a critical role for TSS data in decoding the regulatory information of our genome.

UNLABELLED: Methyl-coenzyme M reductase (MCR) catalyzes the final step of methanogenesis, the microbial metabolism responsible for nearly all biological methane emissions to the atmosphere. Decades of biochemical and structural research studies have generated detailed insights into MCR function in vitro, yet very little is known about the interplay between MCR and methanogen physiology. For instance, while it is routinely stated that MCR catalyzes the rate-limiting step of methanogenesis, this has not been categorically tested. In this study, to gain a more direct understanding of MCRs control on the growth of Methanosarcina acetivorans, we generate a strain with an inducible mcr operon on the chromosome, allowing for careful control of MCR expression. We show that MCR is not growth rate-limiting in substrate-replete batch cultures. However, through careful titration of MCR expression, growth-limiting state(s) can be obtained. Transcriptomic analysis of M. acetivorans experiencing MCR limitation reveals a global response with hundreds of differentially expressed genes across diverse functional categories. Notably, MCR limitation leads to strong induction of methylsulfide methyltransferases, likely due to insufficient recycling of metabolic intermediates. In addition, the mcr operon is not transcriptionally regulated, i.e., it is constitutively expressed, suggesting that the overabundance of MCR might be beneficial when cells experience nutrient limitation or stressful conditions. Altogether, we show that there is a wide range of cellular MCR concentrations that can sustain optimal growth, suggesting that other factors such as anabolic reactions might be rate-limiting for methanogenic growth. IMPORTANCE: Methane is a potent greenhouse gas that has contributed to ca. 25% of global warming in the post-industrial era. Atmospheric methane is primarily of biogenic origin, mostly produced by microorganisms called methanogens. Methyl-coenzyme M reductase (MCR) catalyzes methane formatio in methanogens. Even though MCR comprises ca. 10% of the cellular proteome, it is hypothesized to be growth-limiting during methanogenesis. In this study, we show that Methanosarcina acetivorans cells grown in substrate-replicate batch cultures produce more MCR than its cellular demand for optimal growth. The tools outlined in this study can be used to refine metabolic models of methanogenesis and assay lesions in MCR in a higher-throughput manner than isolation and biochemical characterization of pure protein.

Fast growth phenotypes are achieved through optimal transcriptomic allocation, in which cells must balance tradeoffs in resource allocation between diverse functions. One such balance between stress readiness and unbridled growth in E. coli has been termed the fear versus greed (f/g) tradeoff. Two specific RNA polymerase (RNAP) mutations observed in adaptation to fast growth have been previously shown to affect the f/g tradeoff, suggesting that genetic adaptations may be primed to control f/g resource allocation. Here, we conduct a greatly expanded study of the genetic control of the f/g tradeoff across diverse conditions. We introduced 12 RNA polymerase (RNAP) mutations commonly acquired during adaptive laboratory evolution (ALE) and obtained expression profiles of each. We found that these single RNAP mutation strains resulted in large shifts in the f/g tradeoff primarily in the RpoS regulon and ribosomal genes, likely through modifying RNAP-DNA interactions. Two of these mutations additionally caused condition-specific transcriptional adaptations. While this tradeoff was previously characterized by the RpoS regulon and ribosomal expression, we find that the GAD regulon plays an important role in stress readiness and ppGpp in translation activity, expanding the scope of the tradeoff. A phylogenetic analysis found the greed-related genes of the tradeoff present in numerous bacterial species. The results suggest that the f/g tradeoff represents a general principle of transcriptome allocation in bacteria where small genetic changes can result in large phenotypic adaptations to growth conditions.IMPORTANCETo increase growth, E. coli must raise ribosomal content at the expense of non-growth functions. Previous studies have linked RNAP mutations to this transcriptional shift and increased growth but were focused on only two mutations found in the proteins central region. RNAP mutations, however, commonly occur over a large structural range. To explore RNAP mutations impact, we have introduced 12 RNAP mutations found in laboratory evolution experiments and obtained expression profiles of each. The mutations nearly universally increased growth rates by adjusting said tradeoff away from non-growth functions. In addition to this shift, a few caused condition-specific adaptations. We explored the prevalence of this tradeoff across phylogeny and found it to be a widespread and conserved trend among bacteria.

Fluctuations in the initiation rate of transcription, the first step in gene expression, ensue from the stochastic behavior of the molecular process that controls transcription. In steady state, the regulatory process is often assumed to operate reversibly, i.e., in equilibrium. However, reversibility imposes fundamental limits to information processing. For instance, the assumption of equilibrium is difficult to square with the precision with which the regulatory process executes its task in eukaryotes. Here we provide evidence - from microscopic analyses of the transcription dynamics at a single gene copy of yeast - that the regulatory process for transcription is cyclic and irreversible (out of equilibrium). The necessary coupling to reservoirs of free energy occurs via sequence-specific transcriptional activators and the recruitment, in part, of ATP-dependent chromatin remodelers. Our findings may help explain how eukaryotic cells reconcile the dual but opposing requirements for fast regulatory kinetics and high regulatory specificity.

Treatment-induced neuroendocrine prostate cancer (t-NEPC) often arises from adenocarcinoma via lineage plasticity in response to androgen receptor signaling inhibitors, such as enzalutamide. However, the specific regulators and targets involved in the transition to NEPC are not well understood. Plexin D1 (PLXND1) is a cellular receptor of the semaphorin (SEMA) family that plays important roles in modulating the cytoskeleton and cell adhesion. Here, we found that PLXND1 was highly expressed and positively correlated with neuroendocrine markers in patients with NEPC. High PLXND1 expression was associated with poorer prognosis in prostate cancer patients. Additionally, PLXND1 was upregulated and negatively regulated by androgen receptor signaling in enzalutamide-resistant cells. Knockdown or knockout of PLXND1 inhibited neural lineage pathways, thereby suppressing NEPC cell proliferation, patient derived xenograft (PDX) tumor organoid viability, and xenograft tumor growth. Mechanistically, the heat shock protein 70 (HSP70) regulated PLXND1 protein stability through degradation, and inhibition of HSP70 decreased PLXND1 expression and NEPC organoid growth. In summary, our findings indicate that PLXND1 could serve as a promising therapeutic target and molecular marker for NEPC.

The five NF-κB family members and three nuclear IκB proteins play important biological roles, but the mechanisms by which distinct members of these protein families contribute to selective gene transcription remain poorly understood, especially at a genome-wide scale. Using nascent transcript RNA-seq, we observed considerable overlap between p50-dependent and IκBζ-dependent genes in Toll-like receptor 4 (TLR4)-activated macrophages. Key immunoregulatory genes, including Il6, Il1b, Nos2, Lcn2, and Batf, are among the p50-IκBζ-codependent genes. IκBζ-bound genomic sites are occupied at earlier time points by NF-κB dimers. However, p50-IκBζ codependence does not coincide with preferential binding of either p50 or IκBζ, as RelA co-occupies hundreds of genomic sites with the two proteins. A common feature of p50-IκBζ-codependent genes is a nearby p50/RelA/IκBζ-cobound site exhibiting p50-dependent binding of both RelA and IκBζ. This and other results suggest that IκBζ acts in concert with RelA:p50 heterodimers. Notably, p50-IκBζ-codependent genes comprise a high percentage of genes exhibiting the greatest differential expression between TLR4-stimulated and tumor necrosis factor receptor (TNFR)-stimulated macrophages. Thus, our genome-centric analysis reveals a defined p50-IκBζ pathway that selectively activates a set of key immunoregulatory genes and serves as an important contributor to differential TNFR and TLR4 responses.

DNA N6-adenine methylation (6mA) has recently gained importance as an epigenetic modification in eukaryotes. Its function in lineages with high levels, such as early-diverging fungi (EDF), is of particular interest. Here, we investigated the biological significance and evolutionary implications of 6mA in EDF, which exhibit divergent evolutionary patterns in 6mA usage. The analysis of two Mucorales species displaying extreme 6mA usage reveals that species with high 6mA levels show symmetric methylation enriched in highly expressed genes. In contrast, species with low 6mA levels show mostly asymmetric 6mA. Interestingly, transcriptomic regulation throughout development and in response to environmental cues is associated with changes in the 6mA landscape. Furthermore, we identify an EDF-specific methyltransferase, likely originated from endosymbiotic bacteria, as responsible for asymmetric methylation, while an MTA-70 methylation complex performs symmetric methylation. The distinct phenotypes observed in the corresponding mutants reinforced the critical role of both types of 6mA in EDF.

Maintenance of water homeostasis is a fundamental cellular process required by all living organisms. Here, we use the single-celled green alga Chlamydomonas reinhardtii to establish a foundational understanding of osmotic-stress signaling pathways through transcriptomics, phosphoproteomics, and functional genomics approaches. Comparison of pathways identified through these analyses with yeast and Arabidopsis allows us to infer their evolutionary conservation and divergence across these lineages. 76 genes, acting across diverse cellular compartments, were found to be important for osmotic-stress tolerance in Chlamydomonas through their functions in cytoskeletal organization, potassium transport, vesicle trafficking, mitogen-activated protein kinase and chloroplast signaling. We show that homologs for five of these genes have conserved functions in stress tolerance in Arabidopsis and reveal a novel PROFILIN-dependent stage of acclimation affecting the actin cytoskeleton that ensures tissue integrity upon osmotic stress. This study highlights the conservation of the stress response in algae and land plants, and establishes Chlamydomonas as a unicellular plant model system to dissect the osmotic stress signaling pathway.

Melanoma clinical outcomes emerge from incompletely understood genetic mechanisms operating within the tumor and its microenvironment. Here, we used single-cell RNA-based spatial molecular imaging (RNA-SMI) in patient-derived archival tumors to reveal clinically relevant markers of malignancy progression and prognosis. We examined spatial gene expression of 203,472 cells inside benign and malignant melanocytic neoplasms, including melanocytic nevi and primary invasive and metastatic melanomas. Algorithmic cell clustering paired with intratumoral comparative two-dimensional analyses visualized synergistic, spatial gene signatures linking cellular proliferation, metabolism, and malignancy, validated by protein expression. Metastatic niches included up-regulation of CDK2 and FABP5, which independently predicted poor clinical outcome in 473 patients with melanoma via Cox regression analysis. More generally, our work demonstrates a framework for applying single-cell RNA-SMI technology toward identifying gene regulatory landscapes pertinent to cancer progression and patient survival.

We studied the D3-type cyclin function during gynoecium development in Arabidopsis and how they are related to the hormone cytokinin and the transcription factor SPATULA. Growth throughout the life of plants is sustained by cell division and differentiation processes in meristematic tissues. In Arabidopsis, gynoecium development implies a multiphasic process where the tissues required for pollination, fertilization, and seed development form. The Carpel Margin Meristem (CMM) is a mass of undifferentiated cells that gives rise to the gynoecium internal tissues, such as septum, ovules, placenta, funiculus, transmitting tract, style, and stigma. Different genetic and hormonal factors, including cytokinin, control the CMM function. Cytokinin regulates the cell cycle transitions through the activation of cell cycle regulators as cyclin genes. D3-type cyclins are expressed in proliferative tissues, favoring the mitotic cell cycle over the endoreduplication. Though the role of cytokinin in CMM and gynoecium development is highly studied, its specific role in regulating the cell cycle in this tissue remains unclear. Additionally, despite extensive research on the relationship between CYCD3 genes and cytokinin, the regulatory mechanism that connects them remains elusive. Here, we found that D3-type cyclins are expressed in proliferative medial and lateral tissues. Conversely, the depletion of the three CYCD3 genes showed that they are not essential for gynoecium development. However, the addition of exogenous cytokinin showed that they could control the division/differentiation balance in gynoecium internal tissues and outgrowths. Finally, we found that SPATULA can be a mechanistic link between cytokinin and the D3-type cyclins. The data suggest that the role of D3-type cyclins in gynoecium development is related to the cytokinin response, and they might be activated by the transcription factor SPATULA.

Xenopus embryos provide a favorable material to dissect the sequential steps that lead to dorsal-ventral (D-V) and anterior-posterior (A-P) cell differentiation. Here, we analyze the signaling pathways involved in this process using loss-of-function and gain-of-function approaches. The initial step was provided by Hwa, a transmembrane protein that robustly activates early β-catenin signaling when microinjected into the ventral side of the embryo leading to complete twinned axes. The following step was the activation of Xenopus Nodal-related growth factors, which could rescue the depletion of β-catenin and were themselves blocked by the extracellular Nodal antagonists Cerberus-Short and Lefty. During gastrulation, the Spemann-Mangold organizer secretes a cocktail of growth factor antagonists, of which the BMP antagonists Chordin and Noggin could rescue simultaneously D-V and A-P tissues in β-catenin-depleted embryos. Surprisingly, this rescue occurred in the absence of any β-catenin transcriptional activity as measured by β-catenin activated Luciferase reporters. The Wnt antagonist Dickkopf (Dkk1) strongly synergized with the early Hwa signal by inhibiting late Wnt signals. Depletion of Sizzled (Szl), an antagonist of the Tolloid chordinase, was epistatic over the Hwa and Dkk1 synergy. BMP4 mRNA injection blocked Hwa-induced ectopic axes, and Dkk1 inhibited BMP signaling late, but not early, during gastrulation. Several unexpected findings were made, e.g., well-patterned complete embryonic axes are induced by Chordin or Nodal in β-catenin knockdown embryos, dorsalization by Lithium chloride (LiCl) is mediated by Nodals, Dkk1 exerts its anteriorizing and dorsalizing effects by regulating late BMP signaling, and the Dkk1 phenotype requires Szl.

The prevalence and progression of cancer differ in males and females, and thus, sexual dimorphism in tumor development directly impacts clinical research and medicine. Long non-coding RNAs (lncRNAs) are increasingly recognized as important players in gene expression and various cellular processes, including cancer development and progression. In recent years, lncRNAs have been implicated in the differences observed in cancer incidence, progression, and treatment responses between men and women. Here, we present a brief overview of the current knowledge regarding the role of lncRNAs in cancer sex dimorphism, focusing on how they affect epigenetic processes in male and female mammalian cells. We discuss the potential mechanisms by which lncRNAs may contribute to sex differences in cancer, including transcriptional control of sex chromosomes, hormonal signaling pathways, and immune responses. We also propose strategies for studying lncRNA functions in cancer sex dimorphism. Furthermore, we emphasize the importance of considering sex as a biological variable in cancer research and the need to investigate the role lncRNAs play in mediating these sex differences. In summary, we highlight the emerging link between lncRNAs and cancer sex dimorphism and their potential as therapeutic targets.

During postnatal cardiac hypertrophy, cardiomyocytes undergo mitotic exit, relying on DNA replication-independent mechanisms of histone turnover to maintain chromatin organization and gene transcription. In other tissues, circadian oscillations in nucleosome occupancy influence clock-controlled gene expression, suggesting a role for the circadian clock in temporal control of histone turnover and coordinated cardiomyocyte gene expression. We sought to elucidate roles for the master circadian transcription factor, Bmal1, in histone turnover, chromatin organization, and myocyte-specific gene expression and cell growth in the neonatal period. Bmal1 knockdown in neonatal rat ventricular myocytes decreased myocyte size, total cellular protein synthesis, and transcription of the fetal hypertrophic gene Nppb after treatment with serum or the α-adrenergic agonist phenylephrine. Depletion of Bmal1 decreased the expression of clock-controlled genes Per2 and Tcap, as well as Sik1, a Bmal1 target upregulated in adult versus embryonic hearts. Bmal1 knockdown impaired Per2 and Sik1 promoter accessibility as measured by micrococcal nuclease-quantitative PCR and impaired histone turnover as measured by metabolic labeling of acid-soluble chromatin fractions. Sik1 knockdown in turn decreased myocyte size, while simultaneously inhibiting natriuretic peptide B transcription and activating Per2 transcription. Linking these changes to chromatin remodeling, depletion of the replication-independent histone variant H3.3a inhibited myocyte hypertrophy and prevented phenylephrine-induced changes in clock-controlled gene transcription. Bmal1 is required for neonatal myocyte growth, replication-independent histone turnover, and chromatin organization at the Sik1 promoter. Sik1 represents a novel clock-controlled gene that coordinates myocyte growth with hypertrophic and clock-controlled gene transcription. Replication-independent histone turnover is required for transcriptional remodeling of clock-controlled genes in cardiac myocytes in response to growth stimuli.

Glioblastoma (GBM) is the most common malignant primary brain tumor and remains incurable. Previous work has shown that systemic administration of Decitabine (DAC) induces sufficient expression of cancer-testis antigens (CTA) in GBM for targeting by adoptive T-cell therapy in vivo. However, the mechanisms by which DAC enhances immunogenicity in GBM remain to be elucidated. Using New York esophageal squamous cell carcinoma 1 (NY-ESO-1) as a representative inducible CTA, we demonstrate in patient tissue, immortalized glioma cells, and primary patient-derived gliomaspheres that basal CTA expression is restricted by promoter hypermethylation in gliomas. DAC treatment of glioma cells specifically inhibits DNA methylation silencing to render NY-ESO-1 and other CTA into inducible tumor antigens at single-cell resolution. Functionally, NY-ESO-1 T-cell receptor-engineered effector cell targeting of DAC-induced antigen in primary glioma cells promotes specific and polyfunctional T-cell cytokine profiles. In addition to induction of CTA, DAC concomitantly reactivates tumor-intrinsic human endogenous retroviruses, interferon response signatures, and MHC-I. Overall, we demonstrate that DAC induces targetable tumor antigen and enhances T-cell functionality against GBM, ultimately contributing to the improvement of targeted immune therapies in glioma.SignificanceThis study dissects the tumor-intrinsic epigenetic and transcriptional mechanisms underlying enhanced T-cell functionality targeting decitabine-induced cancer-testis antigens in glioma. Our findings demonstrate concomitant induction of tumor antigens, reactivation of human endogenous retroviruses, and stimulation of interferon signaling as a mechanistic rationale to epigenetically prime human gliomas to immunotherapeutic targeting.

SNCAIP duplication may promote Group 4 medulloblastoma via induction of PRDM6, a poorly characterized member of the PRDF1 and RIZ1 homology domain-containing (PRDM) family of transcription factors. Here, we investigated the function of PRDM6 in human hindbrain neuroepithelial stem cells and tested PRDM6 as a driver of Group 4 medulloblastoma. We report that human PRDM6 localizes predominantly to the nucleus, where it causes widespread repression of chromatin accessibility and complex alterations of gene expression patterns. Genome-wide mapping of PRDM6 binding reveals that PRDM6 binds to chromatin regions marked by histone H3 lysine 27 trimethylation that are located within, or proximal to, genes. Moreover, we show that PRDM6 expression in neuroepithelial stem cells promotes medulloblastoma. Surprisingly, medulloblastomas derived from PRDM6-expressing neuroepithelial stem cells match human Group 3, but not Group 4, medulloblastoma. We conclude that PRDM6 expression has oncogenic potential but is insufficient to drive Group 4 medulloblastoma from neuroepithelial stem cells. We propose that both PRDM6 and additional factors, such as specific cell-of-origin features, are required for Group 4 medulloblastoma. Given the lack of PRDM6 expression in normal tissues and its oncogenic potential shown here, we suggest that PRDM6 inhibition may have therapeutic value in PRDM6-expressing medulloblastomas.

The high heritability of amyotrophic lateral sclerosis (ALS) contrasts with its low molecular diagnosis rate post-genetic testing, pointing to potential undiscovered genetic factors. To aid the exploration of these factors, we introduced EpiOut, an algorithm to identify chromatin accessibility outliers that are regions exhibiting divergent accessibility from the population baseline in a single or few samples. Annotation of accessible regions with histone chromatin immunoprecipitation sequencing and Hi-C indicates that outliers are concentrated in functional loci, especially among promoters interacting with active enhancers. Across different omics levels, outliers are robustly replicated, and chromatin accessibility outliers are reliable predictors of gene expression outliers and aberrant protein levels. When promoter accessibility does not align with gene expression, our results indicate that molecular aberrations are more likely to be linked to post-transcriptional regulation rather than transcriptional regulation. Our findings demonstrate that the outlier detection paradigm can uncover dysregulated regions in rare diseases. EpiOut is available at github.com/uci-cbcl/EpiOut.

Excessive nitrogen promotes the formation of nonproductive tillers in rice, which decreases nitrogen use efficiency (NUE). Developing high-NUE rice cultivars through balancing nitrogen uptake and the formation of productive tillers remains a long-standing challenge, yet how these two processes are coordinated in rice remains elusive. Here we identify the transcription factor OsGATA8 as a key coordinator of nitrogen uptake and tiller formation in rice. OsGATA8 negatively regulates nitrogen uptake by repressing transcription of the ammonium transporter gene OsAMT3.2. Meanwhile, it promotes tiller formation by repressing the transcription of OsTCP19, a negative modulator of tillering. We identify OsGATA8-H as a high-NUE haplotype with enhanced nitrogen uptake and a higher proportion of productive tillers. The geographical distribution of OsGATA8-H and its frequency change in historical accessions suggest its adaption to the fertile soil. Overall, this study provides molecular and evolutionary insights into the regulation of NUE and facilitates the breeding of rice cultivars with higher NUE.

P/TGMS (Photo/thermo-sensitive genic male sterile) lines are crucial resources for two-line hybrid rice breeding. Previous studies revealed that slow development is a general mechanism for sterility-fertility conversion of P/TGMS in Arabidopsis. However, the difference in P/TGMS genes between rice and Arabidopsis suggests the presence of a distinct P/TGMS mechanism in rice. In this study, we isolated a novel P/TGMS line, ostms19, which shows sterility under high-temperature conditions and fertility under low-temperature conditions. OsTMS19 encodes a novel pentatricopeptide repeat (PPR) protein essential for pollen formation, in which a point mutation GTA(Val) to GCA(Ala) leads to ostms19 P/TGMS phenotype. It is highly expressed in the tapetum and localized to mitochondria. Under high temperature or long-day photoperiod conditions, excessive ROS accumulation in ostms19 anthers during pollen mitosis disrupts gene expression and intine formation, causing male sterility. Conversely, under low temperature or short-day photoperiod conditions, ROS can be effectively scavenged in anthers, resulting in fertility restoration. This indicates that ROS homeostasis is critical for fertility conversion. This relationship between ROS homeostasis and fertility conversion has also been observed in other tested rice P/TGMS lines. Therefore, we propose that ROS homeostasis is a general mechanism for the sterility-fertility conversion of rice P/TGMS lines.

Long noncoding RNAs (LncRNAs) are key regulators of gene expression and can mediate their effects in both the nucleus and cytoplasm. Some of the best-characterized lncRNAs are localized within the nucleus, where they modulate the nuclear architecture and influence gene expression. In this review, we discuss the role of lncRNAs in nuclear architecture in the context of their gene regulatory functions in innate immunity. Here, we discuss various approaches to functionally characterize nuclear-localized lncRNAs and the challenges faced in the field.

Extrachromosomal DNA is a common cause of oncogene amplification in cancer. The non-chromosomal inheritance of ecDNA enables tumors to rapidly evolve, contributing to treatment resistance and poor outcome for patients. The transcriptional context in which ecDNAs arise and progress, including chromosomally-driven transcription, is incompletely understood. We examined gene expression patterns of 870 tumors of varied histological types, to identify transcriptional correlates of ecDNA. Here, we show that ecDNA-containing tumors impact four major biological processes. Specifically, ecDNA-containing tumors up-regulate DNA damage and repair, cell cycle control, and mitotic processes, but down-regulate global immune regulation pathways. Taken together, these results suggest profound alterations in gene regulation in ecDNA-containing tumors, shedding light on molecular processes that give rise to their development and progression.

It has proved challenging to quantitatively relate the proteome to the transcriptome on a per-gene basis. Recent advances in data analytics have enabled a biologically meaningful modularization of the bacterial transcriptome. We thus investigate whether matched datasets of transcriptomes and proteomes from bacteria under diverse conditions can be modularized in the same way to reveal novel relationships between their compositions. We find that; (1) the modules of the proteome and the transcriptome are comprised of a similar list of gene products, (2) the modules in the proteome often represent combinations of modules from the transcriptome, (3) known transcriptional and post-translational regulation is reflected in differences between two sets of modules, allowing for knowledge-mapping when interpreting module functions, and (4) through statistical modeling, absolute proteome allocation can be inferred from the transcriptome alone. Quantitative and knowledge-based relationships can thus be found at the genome-scale between the proteome and transcriptome in bacteria.

Reproductive success relies on proper establishment and maintenance of biological sex. In many animals, including mammals, the primary gonad is initially ovary biased. We previously showed the RNA binding protein (RNAbp), Rbpms2, is required for ovary fate in zebrafish. Here, we identified Rbpms2 targets in oocytes (Rbpms2-bound oocyte RNAs; rboRNAs). We identify Rbpms2 as a translational regulator of rboRNAs, which include testis factors and ribosome biogenesis factors. Further, genetic analyses indicate that Rbpms2 promotes nucleolar amplification via the mTorc1 signaling pathway, specifically through the mTorc1-activating Gap activity towards Rags 2 (Gator2) component, Missing oocyte (Mios). Cumulatively, our findings indicate that early gonocytes are in a dual poised, bipotential state in which Rbpms2 acts as a binary fate-switch. Specifically, Rbpms2 represses testis factors and promotes oocyte factors to promote oocyte progression through an essential Gator2-mediated checkpoint, thereby integrating regulation of sexual differentiation factors and nutritional availability pathways in zebrafish oogenesis.

The cellular components of tumors and their microenvironment play pivotal roles in tumor progression, patient survival, and the response to cancer treatments. Unveiling a comprehensive cellular profile within bulk tumors via single-cell RNA sequencing (scRNA-seq) data is crucial, as it unveils intrinsic tumor cellular traits that elude identification through conventional cancer subtyping methods. Our contribution, scBeacon, is a tool that derives cell-type signatures by integrating and clustering multiple scRNA-seq datasets to extract signatures for deconvolving unrelated tumor datasets on bulk samples. Through the employment of scBeacon on the The Cancer Genome Atlas (TCGA) cohort, we find cellular and molecular attributes within specific tumor categories, many with patient outcome relevance. We developed a tumor cell-type map to visually depict the relationships among TCGA samples based on the cell-type inferences.

Enteric pathogens such as Salmonella enterica serovar Typhimurium experience spatial and temporal changes to the metabolic landscape throughout infection. Host reactive oxygen and nitrogen species non-enzymatically convert monosaccharides to alpha hydroxy acids, including L-tartrate. Salmonella utilizes L-tartrate early during infection to support fumarate respiration, while L-tartrate utilization ceases at later time points due to the increased availability of exogenous electron acceptors such as tetrathionate, nitrate, and oxygen. It remains unknown how Salmonella regulates its gene expression to metabolically adapt to changing nutritional environments. Here, we investigated how the transcriptional regulation for L-tartrate metabolism in Salmonella is influenced by infection-relevant cues. L-tartrate induces the transcription of ttdBAU, genes involved in L-tartrate utilization. L-tartrate metabolism is negatively regulated by two previously uncharacterized transcriptional regulators TtdV (STM3357) and TtdW (STM3358), and both TtdV and TtdW are required for the sensing of L-tartrate. The electron acceptors nitrate, tetrathionate, and oxygen repress ttdBAU transcription via the two-component system ArcAB. Furthermore, the regulation of L-tartrate metabolism is required for optimal fitness in a mouse model of Salmonella-induced colitis. TtdV, TtdW, and ArcAB allow for the integration of two cues, i.e., substrate availability and availability of exogenous electron acceptors, to control L-tartrate metabolism. Our findings provide novel insights into how Salmonella prioritizes the utilization of different electron acceptors for respiration as it experiences transitional nutrient availability throughout infection.ImportanceBacterial pathogens must adapt their gene expression profiles to cope with diverse environments encountered during infection. This coordinated process is carried out by the integration of cues that the pathogen senses to fine-tune gene expression in a spatiotemporal manner. Many studies have elucidated the regulatory mechanisms of how Salmonella sense metabolites in the gut to activate or repress its virulence program; however, our understanding of how Salmonella coordinates its gene expression to maximize the utilization of carbon and energy sources found in transitional nutrient niches is not well understood. In this study, we discovered how Salmonella integrates two infection-relevant cues, substrate availability and exogenous electron acceptors, to control L-tartrate metabolism. From our experiments, we propose a model for how L-tartrate metabolism is regulated in response to different metabolic cues in addition to characterizing two previously unknown transcriptional regulators. This study expands our understanding of how microbes combine metabolic cues to enhance fitness during infection.

Meningiomas, although mostly benign, can be recurrent and fatal. World Health Organization (WHO) grading of the tumor does not always identify high-risk meningioma, and better characterizations of their aggressive biology are needed. To approach this problem, we combined 13 bulk RNA sequencing (RNA-seq) datasets to create a dimension-reduced reference landscape of 1,298 meningiomas. The clinical and genomic metadata effectively correlated with landscape regions, which led to the identification of meningioma subtypes with specific biological signatures. The time to recurrence also correlated with the map location. Further, we developed an algorithm that maps new patients onto this landscape, where the nearest neighbors predict outcome. This study highlights the utility of combining bulk transcriptomic datasets to visualize the complexity of tumor populations. Further, we provide an interactive tool for understanding the disease and predicting patient outcomes. This resource is accessible via the online tool Oncoscape, where the scientific community can explore the meningioma landscape.

Many autism spectrum disorder (ASD)-associated genes act as transcriptional regulators (TRs). Chromatin immunoprecipitation sequencing (ChIP-seq) was used to identify the regulatory targets of ARID1B, BCL11A, FOXP1, TBR1, and TCF7L2, ASD-associated TRs in the developing human and mouse cortex. These TRs shared substantial overlap in the binding sites, especially within open chromatin. The overlap within a promoter region, 1-2,000 bp upstream of the transcription start site, was highly predictive of brain-expressed genes. This signature was observed in 96 out of 102 ASD-associated genes. In vitro CRISPRi against ARID1B and TBR1 delineated downstream convergent biology in mouse cortical cultures. After 8 days, NeuN+ and CALB+ cells were decreased, GFAP+ cells were increased, and transcriptomic signatures correlated with the postmortem brain samples from individuals with ASD. We suggest that functional convergence across five ASD-associated TRs leads to shared neurodevelopmental outcomes of haploinsufficient disruption.

Intratumor heterogeneity underlies cancer evolution and treatment resistance, but targetable mechanisms driving intratumor heterogeneity are poorly understood. Meningiomas are the most common primary intracranial tumors and are resistant to all medical therapies, and high-grade meningiomas have significant intratumor heterogeneity. Here we use spatial approaches to identify genomic, biochemical and cellular mechanisms linking intratumor heterogeneity to the molecular, temporal and spatial evolution of high-grade meningiomas. We show that divergent intratumor gene and protein expression programs distinguish high-grade meningiomas that are otherwise grouped together by current classification systems. Analyses of matched pairs of primary and recurrent meningiomas reveal spatial expansion of subclonal copy number variants associated with treatment resistance. Multiplexed sequential immunofluorescence and deconvolution of meningioma spatial transcriptomes using cell types from single-cell RNA sequencing show decreased immune infiltration, decreased MAPK signaling, increased PI3K-AKT signaling and increased cell proliferation, which are associated with meningioma recurrence. To translate these findings to preclinical models, we use CRISPR interference and lineage tracing approaches to identify combination therapies that target intratumor heterogeneity in meningioma cell co-cultures.

A quarter of humanity is estimated to have been exposed to Mycobacterium tuberculosis (Mtb) with a 5-10% risk of developing tuberculosis (TB) disease. Variability in responses to Mtb infection could be due to host or pathogen heterogeneity. Here, we focused on host genetic variation in a Peruvian population and its associations with gene regulation in monocyte-derived macrophages and dendritic cells (DCs). We recruited former household contacts of TB patients who previously progressed to TB (cases, n = 63) or did not progress to TB (controls, n = 63). Transcriptomic profiling of monocyte-derived DCs and macrophages measured the impact of genetic variants on gene expression by identifying expression quantitative trait loci (eQTL). We identified 330 and 257 eQTL genes in DCs and macrophages (False Discovery Rate (FDR) < 0.05), respectively. Four genes in DCs showed interaction between eQTL variants and TB progression status. The top eQTL interaction for a protein-coding gene was with FAH, the gene encoding fumarylacetoacetate hydrolase, which mediates the last step in mammalian tyrosine catabolism. FAH expression was associated with genetic regulatory variation in cases but not controls. Using public transcriptomic and epigenomic data of Mtb-infected monocyte-derived dendritic cells, we found that Mtb infection results in FAH downregulation and DNA methylation changes in the locus. Overall, this study demonstrates effects of genetic variation on gene expression levels that are dependent on history of infectious disease and highlights a candidate pathogenic mechanism through pathogen-response genes. Furthermore, our results point to tyrosine metabolism and related candidate TB progression pathways for further investigation.

Chondrocyte differentiation controls skeleton development and stature. Here we provide a comprehensive map of chondrocyte-specific enhancers and show that they provide a mechanistic framework through which non-coding genetic variants can influence skeletal development and human stature. Working with fetal chondrocytes isolated from mice bearing a Col2a1 fluorescent regulatory sensor, we identify 780 genes and 2'704 putative enhancers specifically active in chondrocytes using a combination of RNA-seq, ATAC-seq and H3K27ac ChIP-seq. Most of these enhancers (74%) show pan-chondrogenic activity, with smaller populations being restricted to limb (18%) or trunk (8%) chondrocytes only. Notably, genetic variations overlapping these enhancers better explain height differences than those overlapping non-chondrogenic enhancers. Finally, targeted deletions of identified enhancers at the Fgfr3, Col2a1, Hhip and, Nkx3-2 loci confirm their role in regulating cognate genes. This enhancer map provides a framework for understanding how genes and non-coding variations influence bone development and diseases.

Circadian rhythms are endogenous oscillations in nearly all organisms, from prokaryotes to humans, allowing them to adapt to cyclical environments for close to 24 h. Circadian rhythms are regulated by a central clock, based on a transcription-translation feedback loop. One important protein in the central loop in metazoan clocks is PERIOD, which is regulated in part by Casein kinase 1ε/δ (CK1ε/δ) phosphorylation. In the nematode Caenorhabditis elegans, period and casein kinase 1ε/δ are conserved as lin-42 and kin-20, respectively. Here, we studied the involvement of lin-42 and kin-20 in the circadian rhythms of the adult nematode using a bioluminescence-based circadian transcriptional reporter. We show that mutations of lin-42 and kin-20 generate a significantly longer endogenous period, suggesting a role for both genes in the nematode circadian clock, as in other organisms. These phenotypes can be partially rescued by overexpression of either gene under their native promoter. Both proteins are expressed in neurons and epidermal seam cells, as well as in other cells. Depletion of LIN-42 and KIN-20, specifically in neuronal cells after development, was sufficient to lengthen the period of oscillating sur-5 expression. Therefore, we conclude that LIN-42 and KIN-20 are critical regulators of the adult nematode circadian clock through neuronal cells.

Cis-regulatory elements (CREs) interact with trans regulators to orchestrate gene expression, but how transcriptional regulation is coordinated in multi-gene loci has not been experimentally defined. We sought to characterize the CREs controlling dynamic expression of the adjacent costimulatory genes CD28, CTLA4 and ICOS, encoding regulators of T cell-mediated immunity. Tiling CRISPR interference (CRISPRi) screens in primary human T cells, both conventional and regulatory subsets, uncovered gene-, cell subset- and stimulation-specific CREs. Integration with CRISPR knockout screens and assay for transposase-accessible chromatin with sequencing (ATAC-seq) profiling identified trans regulators influencing chromatin states at specific CRISPRi-responsive elements to control costimulatory gene expression. We then discovered a critical CCCTC-binding factor (CTCF) boundary that reinforces CRE interaction with CTLA4 while also preventing promiscuous activation of CD28. By systematically mapping CREs and associated trans regulators directly in primary human T cell subsets, this work overcomes longstanding experimental limitations to decode context-dependent gene regulatory programs in a complex, multi-gene locus critical to immune homeostasis.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Long noncoding RNAs (lncRNAs) account for the largest portion of RNA from the transcriptome, yet most of their functions remain unknown. Here, we performed two independent high-throughput CRISPRi screens to understand the role of lncRNAs in monocyte function and differentiation. The first was a reporter-based screen to identify lncRNAs that regulate TLR4-NFkB signaling in human monocytes and the second screen identified lncRNAs involved in monocyte to macrophage differentiation. We successfully identified numerous noncoding and protein-coding genes that can positively or negatively regulate inflammation and differentiation. To understand the functional roles of lncRNAs in both processes, we chose to further study the lncRNA LOUP [lncRNA originating from upstream regulatory element of SPI1 (also known as PU.1)], as it emerged as a top hit in both screens. Not only does LOUP regulate its neighboring gene, the myeloid fate-determining factor SPI1, thereby affecting monocyte to macrophage differentiation, but knockdown of LOUP leads to a broad upregulation of NFkB-targeted genes at baseline and upon TLR4-NFkB activation. LOUP also harbors three small open reading frames capable of being translated and are responsible for LOUPs ability to negatively regulate TLR4/NFkB signaling. This work emphasizes the value of high-throughput screening to rapidly identify functional lncRNAs in the innate immune system.

AbstractThe transcription factor RUNX1 is a master regulator of hematopoiesis and is frequently mutated in myeloid malignancies. Mutations in its runt homology domain (RHD) frequently disrupt DNA binding and result in loss of RUNX1 function. However, it is not clearly understood how other RUNX1 mutations contribute to disease development. Here, we characterized RUNX1 mutations outside of the RHD. Our analysis of the patient data sets revealed that mutations within the C-terminus frequently occur in hematopoietic disorders. Remarkably, most of these mutations were nonsense or frameshift mutations and were predicted to be exempt from nonsense-mediated messenger RNA decay. Therefore, this class of mutation is projected to produce DNA-binding proteins that contribute to the pathogenesis in a distinct manner. To model this, we introduced the RUNX1R320∗ mutation into the endogenous gene locus and demonstrated the production of RUNX1R320∗ protein. Expression of RUNX1R320∗ resulted in the disruption of RUNX1 regulated processes such as megakaryocytic differentiation, through a transcriptional signature different from RUNX1 depletion. To understand the underlying mechanisms, we used Global RNA Interactions with DNA by deep sequencing (GRID-seq) to examine enhancer-promoter connections. We identified widespread alterations in the enhancer-promoter networks within RUNX1 mutant cells. Additionally, we uncovered enrichment of RUNX1R320∗ and FOXK2 binding at the MYC super enhancer locus, significantly upregulating MYC transcription and signaling pathways. Together, our study demonstrated that most RUNX1 mutations outside the DNA-binding domain are not subject to nonsense-mediated decay, producing protein products that act in concert with additional cofactors to dysregulate hematopoiesis through mechanisms distinct from those induced by RUNX1 depletion.

Neuropsychiatric genome-wide association studies (GWASs), including those for autism spectrum disorder and schizophrenia, show strong enrichment for regulatory elements in the developing brain. However, prioritizing risk genes and mechanisms is challenging without a unified regulatory atlas. Across 672 diverse developing human brains, we identified 15,752 genes harboring gene, isoform, and/or splicing quantitative trait loci, mapping 3739 to cellular contexts. Gene expression heritability drops during development, likely reflecting both increasing cellular heterogeneity and the intrinsic properties of neuronal maturation. Isoform-level regulation, particularly in the second trimester, mediated the largest proportion of GWAS heritability. Through colocalization, we prioritized mechanisms for about 60% of GWAS loci across five disorders, exceeding adult brain findings. Finally, we contextualized results within gene and isoform coexpression networks, revealing the comprehensive landscape of transcriptome regulation in development and disease.

Nucleotide changes in gene regulatory elements are important determinants of neuronal development and diseases. Using massively parallel reporter assays in primary human cells from mid-gestation cortex and cerebral organoids, we interrogated the cis-regulatory activity of 102,767 open chromatin regions, including thousands of sequences with cell type-specific accessibility and variants associated with brain gene regulation. In primary cells, we identified 46,802 active enhancer sequences and 164 variants that alter enhancer activity. Activity was comparable in organoids and primary cells, suggesting that organoids provide an adequate model for the developing cortex. Using deep learning we decoded the sequence basis and upstream regulators of enhancer activity. This work establishes a comprehensive catalog of functional gene regulatory elements and variants in human neuronal development.