Search

Background and Aims: We aimed to assess the associations of exposure to air pollutants and standard and advanced lipoprotein measures, in a nationwide sample representative of the adult population of Spain. Methods: We included 4647 adults (>18 years), participants in the national, cross‐sectional, population‐based di@bet.es study, conducted in 2008–2010. Standard lipid measurements were analysed on an Architect C8000 Analyzer (Abbott Laboratories SA). Lipoprotein analysis was made by an advanced 1H‐NMR lipoprotein test (Liposcale®). Participants were assigned air pollution concentrations for particulate matter <10 μm (PM10), <2.5 μm (PM2.5) and nitrogen dioxide (NO2), corresponding to the health examination year, obtained by modelling combined with measurements taken at air quality stations (CHIMERE chemistry‐transport model). Results: In multivariate linear regression models, each IQR increase in PM10, PM2.5 and NO2 was associated with 3.3%, 3.3% and 3% lower levels of HDL‐c and 1.3%, 1.4% and 1.1% lower HDL particle (HDL‐p) concentrations (p <.001 for all associations). In multivariate logistic regression, there was a significant association between PM10, PM2.5 and NO2 concentrations and the odds of presenting low HDL‐c (<40 mg/dL), low HDL‐p (

Background: Recent reports have suggested that air pollution may impact thyroid function, although the evidence is still scarce and inconclusive. In this study we evaluated the association of exposure to air pollutants to thyroid function parameters in a nationwide sample representative of the adult population of Spain.Methods: The Di@bet.es study is a national, cross-sectional, population-based survey which was conducted in 2008-2010 using a random cluster sampling of the Spanish population. The present analyses included 3859 individuals, without a previous thyroid disease diagnosis, and with negative thyroid peroxidase antibodies (TPO Abs) and thyroid-stimulating hormone (TSH) levels of 0.1-20 mIU/L. Participants were assigned air pollution concentrations for particulate matter <2.5μm (PM2.5) and Nitrogen Dioxide (NO2), corresponding to the health examination year, obtained by means of modeling combined with measurements taken at air quality stations (CHIMERE chemistry-transport model). TSH, free thyroxine (FT4), free triiodothyronine (FT3) and TPO Abs concentrations were analyzed using an electrochemiluminescence immunoassay (Modular Analytics E170 Roche).Results: In multivariate linear regression models, there was a highly significant negative correlation between PM2.5 concentrations and both FT4 (p<0.001), and FT3 levels (p<0.001). In multivariate logistic regression, there was a significant association between PM2.5 concentrations and the odds of presenting high TSH [OR 1.24 (1.01-1.52) p=0.043], lower FT4 [OR 1.25 (1.02-1.54) p=0.032] and low FT3 levels [1.48 (1.19-1.84) p=<0.001] per each IQR increase in PM2.5 (4.86 μg/m3). There was no association between NO2 concentrations and thyroid hormone levels. No significant heterogeneity was seen in the results between groups of men, pre-menopausal and post-menopausal women.Conclusions: Exposures to PM2.5 in the general population were associated with mild alterations in thyroid function. [ABSTRACT FROM AUTHOR]

Objective: To assess the efficacy of the insulin pen cap Insulclock on improving glycemic control, treatment adherence, and user satisfaction in people with type 1 diabetes.Research Design and Methods: This multicenter, open-label, randomized controlled trial comprised a 4-week run-in phase and a 6-week double-arm phase in which participants were randomly assigned into an active or masked mode.Results: Fifty-five participants were evaluable (active group, n = 26, masked group, n = 29). The increase in time in range was higher in the active versus masked group (5.2% vs. -0.8%; P = 0.016). The active group showed a higher reduction in mean glucose, glucose management indicator, time above range, and high blood glucose index. On-time insulin doses increased in the active group and decreased in the masked group.Conclusions: Insulclock system use was associated with improved glycemic control, glycemic variability, hyperglycemia risk, and treatment adherence in people with uncontrolled type 1 diabetes. [ABSTRACT FROM AUTHOR]

Objective: It has been proposed that a mild form of acquired resistance to thyroid hormone may occur in the general population. Its clinical significance remains largely unknown. The objective of the study was to explore whether a newly described thyroid hormone resistance index is associated with the risk of mortality in a sample of community-dwelling euthyroid subjects representative of the adult population of Spain. Design: Longitudinal observational study including 3750 individuals, free of thyroid disease, TPO antibodies-negative (<50 IU/mL) and with TSH levels within the euthyroid range (≥0.5 and ≤5.0 mUI/mL) participating in the nationwide study Di@bet.es (2008-2010). Methods: We used the Thyroid Feedback Quantile-based Index (TFQI) as a marker of resistance to thyroid hormone. The study population was grouped into categories according to their TFQI values at baseline. Fatal events were ascertained from the national death registry (end of follow-up December 2016). Results: A total of 231 deaths were recorded during an average follow-up of 7.3 years. Compared with the category with the highest sensitivity to free thyroxine (TFQI ≤ p5) (reference), the relative risk of mortality in the categories with TFQI > p5 and ≤p25; >p25 and ≤p50; >p50 and ≤p75; >p75 and ≤p95 and >p95 were 1.01, (0.47-2.19), 1.42 (0.682.97), 1.54 (0.74-3.22), 1.47 (0.70-3.11) and 2.61 (1.16-5.89), respectively (P for trend 0.003). The association remained significant after multivariate adjustment of the data (P for trend 0.017). Conclusions: A thyroid hormone resistance index focused on deviations of the average pituitary response to thyroid hormones may be associated with all-cause mortality independently of other conventional risk factors and comorbidities. [ABSTRACT FROM AUTHOR]

: BackgroundIn the setting of minimal approach Sestamibi-guided parathyroid surgery for primary hyperparathyroidism we evaluated if total serum calcium level monitoring is as valuable as intraoperative parathyroid hormone (iPTH) monitoring.: Study designProspective open single-blinded efficacy trial of two intraoperative diagnostic monitoring methods (iPTH and total serum calcium level) on a cohort of surgical patients. All patients (n = 35) were undergoing parathyroid surgery at the Department of General Surgery at B Cruces’ Hospital, Vizcaya, Spain, between October 1999 and March 2001. Kinetics of serum levels of Ca and iPTH during surgery and time of prediction of cure for each method (measured in the clinic, admission, and intraoperatively, such as induction of anesthesia, and every 5 minutes after removal of adenoma) were analyzed.: ResultsHypercalcemia and iPTH levels became corrected in 34 patients. Average serum calcium levels dropped from pathologic 11.07 ± 0.41 mg/dL (mean ± standard deviation) to normal values 9.7 ± 0.82 mg/dL during the first intraoperative determination (minute 5), but mean iPTH decreased from pathologic (192 ± 98 pg/mL) to normal values (39.93 ± 25.12 pg/mL) during the third intraoperative determination (minute 15). Serum calcium level at 5 minutes after removal decreased by 100% in 34 patients, but iPTH only showed a similar drop during the third determination at 15 minutes. Frozen sections were conclusive for parathyroid tissue (20.56 ± 10.3 minutes after removal).: ConclusionsIntraoperative measurement of total calcium level might be an easier and less expensive method than iPTH measurement in the prediction of cure during surgery for primary hyperparathyroidism resulting from adenoma. [Copyright &y& Elsevier]

Objective: Pituitary adenomas (PA) are rare in young patients, and additional studies are needed to fully understand their pathogenesis in this population. We describe the clinical and genetic characteristics of apparently sporadic PA in a cohort of young patients. Design: Clinical and molecular analysis of 235 patients (age = 30 years) with PA. Clinicians from several Spanish and Chilean hospitals provided data. Methods: Genetic screening was performed via next-generation sequencing and comparative genomic hybridization array. Clinical variables were compared among paediatric, adole scent (<19 years) and young adults' (=19-30 years) cohorts and types of adenomas. Phenotype-genotype associations were examined. Results: Among the total cohort, mean age was 17.3 years. Local mass effect symptoms were present in 22.0%, and prolactinomas were the most frequent (44.7%). Disease-causing g ermline variants were identified in 22 individuals (9.3%), more exactly in 13.1 and 4.7% of the populations aged b etween 0-19 and 19-30 years, respectively; genetically positive patients were younger at diagnosis and had larger tumo ur size. Healthy family carriers were also identified. Conclusions: Variants in genes associated with syndromic forms of PAs were detected in a large cohort of apparently sporadic pituitary tumours. We have identified novel variants in well-known genes and set the possibility of incomplete disease penetrance in carriers of MEN1 alterations or a limited clinical expression of the syndrome. Despite the low penetrance observed, screening of AIP and MEN1 variants in young patients and relatives is of clinical value. [ABSTRACT FROM AUTHOR]

Evaluates the utility of existing depression screens as tools for the Puerto Rican primary care patients aged 50 and older. Receiver operator characteristic curves for several depression screens; Use of the bilingual, bicultural interviewer; Implication of the increases in depression detection.

The aim of this study was to estimate the incidence of diabetes mellitus in the Basque Country and the risk factors involved in the disease by reassessing an adult population after 7 years of follow-up. In the previous prevalence study, 847 people older than 18 years were randomly selected from all over the Basque Country and were invited to answer a medical questionnaire, followed by a physical examination and an oral glucose tolerance test. In the reassessment, the same variables were collected and the resulting cohort comprised 517 individuals of whom 43 had diabetes at baseline. The cumulative incidence of diabetes was 4.64% in 7 years and the raw incidence rate was 6.56 cases/1000 person-years (95%CI: 4.11–9.93). Among the incident cases, 59% were undiagnosed. The most strongly associated markers by univariate analyses were age > 60 years, dyslipidaemia, prediabetes and insulin resistance. We also found association with hypertension, obesity, family history of diabetes and low education level. Multivariate analysis adjusted for age and sex showed that a set of risk factors assessed together (dyslipidaemia, waist-to-hip-ratio and family history of diabetes) had great predictive value (AUC-ROC = 0.899, 95%CI: 0.846–0.953, p = 0.942), which suggests the need for early intervention before the onset of prediabetes. [ABSTRACT FROM AUTHOR]

The GCM2 gene encodes a transcription factor predominantly expressed in parathyroid cells that is known to be critical for development, proliferation and maintenance of the parathyroid cells. A cohort of 127 Spanish patients with a disorder of calcium metabolism were screened for mutations by Next-Generation Sequencing (NGS). A targeted panel for disorders of calcium and phosphorus metabolism was designed to include 65 genes associated with these disorders. We observed two variants of uncertain significance (p.(Ser487Phe) and p.Asn315Asp), one likely pathogenic (p.Val382Met) and one benign variant (p.Ala393_Gln395dup) in the GCM2 gene in the heterozygous state in five families (two index cases had hypocalcemia and hypoparathyroidism, respectively, and three index cases had primary hyperparathyroidism). Our study shows the utility of NGS in unravelling the genetic origin of some disorders of the calcium and phosphorus metabolism, and confirms the GCM2 gene as an important element for the maintenance of calcium homeostasis. Importantly, a novel variant in the GCM2 gene (p.(Ser487Phe)) has been found in a patient with hypocalcemia. [ABSTRACT FROM AUTHOR]

Background: Longitudinal data assessing the impact of iodine deficiency (ID) on mortality are scarce. We aimed to study the association between the state of iodine nutrition and the risk of total and cause-specific mortality in a representative sample of the Spanish adult population. Methods: We performed a longitudinal observational study to estimate mortality risk according to urinary iodine (UI) concentrations using a sample of 4370 subjects >18 years representative of the Spanish adult population participating in the nationwide study Di@bet.es (2008–2010). We used Cox regression to assess the association between UI at the start of the study (<50, 50–99, 100–199, 200–299, and ≥300 μg/L) and mortality during follow-up (National death registry—end of follow-up December 2016) in raw models, and adjusted for possible confounding variables: age, sex, educational level, hypertension, diabetes, obesity, chronic kidney disease, smoking, hypercholesterolemia, thyroid dysfunction, diagnosis of cardiovascular disease or cancer, area of residence, physical activity, adherence to Mediterranean diet, dairy and iodinated salt intake. Results: A total of 254 deaths were recorded during an average follow-up period of 7.3 years. The causes of death were cardiovascular 71 (28%); cancer 85 (33.5%); and other causes 98 (38.5%). Compared with the reference category with adequate iodine nutrition (UI 100–300 μg/L), the hazard ratios (HRs) of all-cause mortality in the category with UI ≥300 μg/L were 1.04 (95% confidence interval [CI 0.54–1.98]); however, in the categories with 50–99 UI and <50 μg/L, the HRs were 1.29 [CI 0.97–1.70] and 1.71 [1.18–2.48], respectively (p for trend 0.004). Multivariate adjustment did not significantly modify the results. Conclusions: Our data indicate an excess mortality in individuals with moderate-severe ID adjusted for other possible confounding factors. [ABSTRACT FROM AUTHOR]

The maintenance of magnesium (Mg2+) homeostasis is essential for human life. The Cystathionine-β-synthase (CBS)-pair domain divalent metal cation transport mediators (CNNMs) have been described to be involved in maintaining Mg2+ homeostasis. Among these CNNMs, CNNM2 is expressed in the basolateral membrane of the kidney tubules where it is involved in Mg2+ reabsorption. A total of four patients, two of them with a suspected disorder of calcium metabolism, and two patients with a clinical diagnosis of primary tubulopathy were screened for mutations by Next-Generation Sequencing (NGS). We found one novel likely pathogenic variant in the heterozygous state (c.2384C>A; p.(Ser795*)) in the CNNM2 gene in a family with a suspected disorder of calcium metabolism. In this family, hypomagnesemia was indirectly discovered. Moreover, we observed three novel variants of uncertain significance in heterozygous state in the other three patients (c.557G>C; p.(Ser186Thr), c.778A>T; p.(Ile260Phe), and c.1003G>A; p.(Asp335Asn)). Our study shows the utility of Next-Generation Sequencing in unravelling the genetic origin of rare diseases. In clinical practice, serum Mg2+ should be determined in calcium and PTH-related disorders. [ABSTRACT FROM AUTHOR]

Osteopontin (OPN), a senescence‐associated secretory phenotype factor, is increased in patients with nonalcoholic fatty liver disease (NAFLD). Cellular senescence has been associated with age‐dependent hepatosteatosis. Thus, we investigated the role of OPN in the age‐related hepatosteatosis. For this, human serum samples, animal models of aging, and cell lines in which senescence was induced were used. Metabolic fluxes, lipid, and protein concentration were determined. Among individuals with a normal liver, we observed a positive correlation between serum OPN levels and increasing age. This correlation with age, however, was absent in patients with NAFLD. In wild‐type (WT) mice, serum and liver OPN were increased at 10 months old (m) along with liver p53 levels and remained elevated at 20m. Markers of liver senescence increased in association with synthesis and concentration of triglycerides (TG) in 10m OPN‐deficient (KO) hepatocytes when compared to WT hepatocytes. These changes in senescence and lipid metabolism in 10m OPN‐KO mice liver were associated with the decrease of 78 kDa glucose‐regulated protein (GRP78), induction of ER stress, and the increase in fatty acid synthase and CD36 levels. OPN deficiency in senescent cells also diminished GRP78, the accumulation of intracellular TG, and the increase in CD36 levels. In 20m mice, OPN loss led to increased liver fibrosis. Finally, we showed that OPN expression in vitro and in vivo was regulated by p53. In conclusion, OPN deficiency leads to earlier cellular senescence, ER stress, and TG accumulation during aging. The p53‐OPN axis is required to inhibit the onset of age‐related hepatosteatosis. [ABSTRACT FROM AUTHOR]

Objective: The activity of brown adipose tissue is sensitive to changes in ambient temperature. A lower exposure to cold could result in an increased risk of developing diabetes at population level, although this factor has not yet been sufficiently studied. Design: We studied 5072 subjects, participants in a national, cross-sectional population-based study representative of the Spanish adult population (Di@bet.es study). All subjects underwent a clinical, demographic and lifestyle survey, a physical examination and blood sampling (75 g oral glucose tolerance test). Insulin resistance was estimated with the homeostasis model assessment (HOMA-IR). The mean annual temperature (°C) in each individual municipality was collected from the Spanish National Meteorology Agency. Results: Linear regression analysis showed a significant positive association between mean annual temperature and fasting plasma glucose (β: 0.087, P < 0.001), 2 h plasma glucose (β: 0.049, P = 0.008) and HOMA-IR (β: 0.046, P = 0.008) in multivariate adjusted models. Logistic regression analyses controlled by multiple socio-demographic variables, lifestyle, adiposity (BMI) and geographical elevation showed increasing odds ratios for prediabetes (WHO 1999), ORs 1, 1.26 (0.95-1.66), 1.08 (0.81-1.44) and 1.37 (1.01-1.85) P for trend = 0.086, diabetes (WHO 1999) ORs 1, 1.05 (0.79-1.39), 1.20 (0.91-1.59) and 1.39 (1.02-1.90) P = 0.037, and insulin resistance (HOMA-IR ≥75th percentile of the non-diabetic population): ORs 1, 1.03 (0.82-1.30), 1.22 (0.96-1.55), 1.26 (0.98-1.63) (P for trend = 0.046) as the mean annual temperature (into quartiles) rose. Conclusions: Our study reports an association between ambient temperature and the prevalence of dysglycemia and insulin resistance in Spanish adults, consistent with the hypothesis that a lower exposure to cold could be associated with a higher risk of metabolic derangements. [ABSTRACT FROM AUTHOR]

Objective: Molecular diagnosis is a useful diagnostic tool in calcium metabolism disorders. The calcium-sensing receptor (CaSR) is known to play a central role in the regulation of extracellular calcium homeostasis. We performed clinical, biochemical and genetic characterization of sequence anomalies in this receptor in a cohort of 130 individuals from 82 families with suspected alterations in the CASR gene, one of the largest series described. Methods: The CASR gene was screened for mutations by polymerase chain reaction followed by direct Sanger sequencing. Results: Presumed CaSR-inactivating mutations were found in 65 patients from 26 families. These patients had hypercalcemia (median: 11.3 mg/dL) but normal or abnormally hig h parathyroid hormone (PTH) levels (median: 52 pg/ mL). On the other hand, presumed CaSR-activating mutations were detected in 17 patients from eight families. These patients had a median serum calcium level of 7.4 mg/dL and hypo parathyroidism (median: PTH 13 pg/mL). Further, common polymorphisms previously associated with high blood ionized calcium levels were found in 27 patients (median calcium: 10.6 mg/dL; median PTH: 65 pg/mL) with no othe r alterations in CASR. Overall, we found 30 different mutations, of which, 14 have not been previously reported (p.Ala26Ser, p.Cys60Arg, p.Lys119Ile, p.Leu123Met, p.Glu133Val, p.Gly222Glu, p.Phe351Ile, p.Cys542Tyr, p.Cys546Gly, p.Cys677Tyr, p.Ile816Val, p.Ala887Asp, p.Glu934*, p.Pro935_Gln945dup). Conclusions: Patients with CASR mutations may not fit the classic clinical pictures of hypercal cemia with hypocalciuria or hypocalcemia with hypercalciuria. Molecular studies are impo rtant for confirming the diagnosis and distinguishing it from other entities. Our genetic analysis confirmed CaSR disorde rs in 82 patients in the study cohort. [ABSTRACT FROM AUTHOR]

Background: The aim of this study was to investigate the national prevalence of thyroid dysfunction in Spain and its association with various clinical, environmental, and demographic variables. Methods: The study included 4554 subjects (42.4% men) with a mean age of 50 years (range 18-93 years), who were participants in a national, cross-sectional, population-based survey conducted in 2009-2010. Data gathered included clinical and demographic characteristics, physical examination, and blood sampling. Thyrotropin, free thyroxine, free triiodothyronine, and thyroid peroxidase antibody (TPOAb) concentrations were analyzed by electrochemiluminescence. Urinary iodine (UI) levels were measured in an isolated urine sample. Results: The prevalence of treated hypothyroidism, untreated subclinical hypothyroidism, and untreated clinical hypothyroidism was 4.2% [confidence interval (CI) 3.6-4.9%], 4.6% [CI 4.0-5.2%], and 0.3% [CI 0.1-0.5%], respectively. The prevalence of total hypothyroidism (including all fractions) was 9.1% [CI 8.2-10.0%]. The prevalence of total hyperthyroidism was 0.8% [CI 0.6-1.1]. A total of 7.5% [CI 6.7-8.3%] of the population tested positive for TPOAbs (≥50 IU/mL). In multivariate logistic regression models, TPOAbs were strongly associated with both hypothyroidism ( p < 0.001) and hyperthyroidism ( p = 0.005), whereas high UI levels (>200 μg/g creatinine) were associated with hypothyroidism ( p < 0.001). The positive association between UI and hypothyroidism remained for both treated ( p < 0.001) and untreated ( p < 0.05) hypothyroidism, whereas it was especially significant for non-autoimmune (TPOAbs negative) forms ( p < 0.001). At UI levels ≥200 μg/g, there was a positive correlation between UI and thyrotropin levels (β = 0.152, p < 0.001) and a negative correlation between UI and free triiodothyronine levels (β = −0.134, p = 0.001). Conclusion: According to the data, a large proportion (10%) of the Spanish population has some evidence of thyroid dysfunction. High TPOAb concentrations were associated with both hypo- and hyperthyroidism, whereas high UI concentrations were associated with hypothyroidism. [ABSTRACT FROM AUTHOR]

Low physical activity (PA), or sedentary lifestyle, is associated with the development of several chronic diseases. We aimed to investigate current prevalence of sedentariness and its association with diabetes and other cardiovascular risk factors. PA was evaluated in a population-based, cross-sectional, randomly sampled study conducted in 2009–2010 in Spain. International Physical Activity Questionnaire (SF-IPAQ) was used to assess PA. 4991 individuals (median age 50 years, 57% women) were studied. Prevalence of sedentariness was 32.3% for men and 39% for women (p < 0.0001). Sex differences were particularly notable (age*sex interaction, p = 0.0024) at early and older ages. Sedentary individuals had higher BMI (28 vs. 27 kg/m2) and obesity prevalence (37 vs. 26%). Low PA was present in 44, 43, and 38% of individuals with known diabetes (KDM), prediabetes/unknown-diabetes (PREDM/UKDM), and normal glucose regulation (p = 0.0014), respectively. No difference between KDM and PREDM/UKDM (p = 0.72) was found. Variables independently associated (p < 0.05) with sedentariness were age, sex, BMI, central obesity, Mediterranean diet adherence, smoking habit, HDL-cholesterol, triglycerides and dyslipidemia. Low PA is on the rise in Spain, especially among women. Sedentariness is associated with several cardiovascular risk factors and may be responsible for the increasing prevalence of obesity and diabetes in this country. [ABSTRACT FROM AUTHOR]

Background Multimorbidity is a common problem in ageing societies and has a wide range of individual and social consequences. The objective of this study was to compare multimorbidity in a population with type 2 diabetes (T2DM) with that in other chronic patients, and identify disease clusters in patients with T2DM. Methods We included all citizens in the Basque Health Service aged ≥ 35 years, and identified the population with chronic conditions (from a list of 51 diseases) and those with T2DM. We performed a descriptive analysis of both populations, including their comorbidities. The average of chronic conditions unadjusted and adjusted by socioeconomic variables was obtained. Further, among patients with T2DM, we performed agglomerative hierarchical clustering to identify clinically relevant subgroups with the same concurrent conditions. Results In 2011, out of a population of 1,473,937, 15.2% had T2DM and 48% some other type of chronic condition. Overall, 87.6% men and 92% of women with T2DM had multimorbidity, while the figures were respectively 54.2% and 57% in chronic patients without T2DM. Patients with T2DM had a higher risk than the general chronic population of having 21 of the 51 chronic conditions considered. We identified 10 relevant disease clusters in patients with T2DM. Conclusions There are notable differences between chronic patients with and without T2DM, the prevalence of multimorbidity being greater among the former. Multimorbidity is a complex phenomenon and more research is required to establish the clinical implications of the disease clusters found, to guide the introduction of integrated care management programmes. [ABSTRACT FROM AUTHOR]

Objective: Specific germline mutations in the RET proto-oncogene are correlated with clinical features in multiple endocrine neoplasia type 2A (MEN2A); however, data are scarce regarding differences in clinical profiles dependent on the type of nucleotide and amino acid substitution at the same codon. We aimed to analyse differences in clinical risk profiles and outcomes among different amino acids encoded by codon 634. Design: The study was retrospective and multicentric. Methods: We collected data included in the Spanish Online National Database from patients with MEN2A carrying a RET proto-oncogene mutation on codon 634. The mean follow-up time was 7.6G6.9 years (1-32). Results: Patients (n= 173) from 49 unrelated families were C634Y carriers, and 26 patients from eight different families had C634R mutation. we found higher penetrance of medullary thyroid carcinoma, phaeochromocytoma and hyperparathyroidism (P<0.001, P=0.007 and P<0.001 respectively) in C634R carriers than in C634Y carriers. The Kaplan-Meier estimate of cumulative lymph node and distant metastases rates showed that these events occurred earlier in patients harbouring the C634R mutation (P<0.001). A multivariate adjusted Cox regression analysis indicated that the C634R mutation was an independent factor for persistent/recurrent disease (hazard ratio, 3.17; 95% CI: 1.66-6.03; P<0.001). Conclusions: Our results suggest that there could be clinical differences caused by different amino acid substitutions at codon 634; specifically, the C634R mutation was associated with a more aggressive MEN2A phenotype than the C634Y mutation. [ABSTRACT FROM AUTHOR]

Background Pegvisomant is an effective treatment for acromegaly. Objective To investigate escape (loss of biochemical control in patients previously controlled) and lipodystrophy in acromegalic patients treated with pegvisomant and to evaluate possible associations with clinical features. Patients and methods Multicentre retrospective study involving 19 Spanish centres. Results Ninety-seven patients were included (59% women, mean age at diagnosis 42 ± 13 years, 80% macroadenomas); mean follow-up on pegvisomant was 5 ± 2·5 years, and 89 (92%) achieved normal IGF-1. Escape was reported in 30/89 (34%) of responders, after a mean treatment duration of 25 ± 21 months. The mean initial dose of pegvisomant was 11 ± 5 mg/day, and mean dose at escape was 14 ± 7 mg/day. Most patients (26/30, 87%) achieved control with dose increase (57%), additional medical treatment (3%) or both (27%). Mean new dose that controlled IGF-1 after escape was 20 ± 7 mg/day. Treatments associated were somatostatin analogues ( SSA in 47%), cabergoline ( CAB in 47%) and both (6%). Lipodystrophy was observed in 15 patients (13 females), mild in six, moderate in six, severe in three and persistent in four. Among patients with lipodystrophy, three escaped and three were nonresponders to pegvisomant. Four patients discontinued the drug, and four had dose reductions because of lipodystrophy. It tended to be more frequent in females ( P = 0·06) and in patients treated with triple association SSA+ CAB+ PEG ( P = 0·018). No relationship between escape and clinical variables was found, except prior CAB ( P = 0·04) and metformin treatment (0·02) and grade of lipodystrophy ( P = 0·02). Conclusions A significant proportion of patients treated with pegvisomant escaped (34%); however, the majority (87%) was easily controlled with either dose increase, further medical treatment or both. Lipodystrophy developed in 15%, mostly females, and influenced the response to treatment. [ABSTRACT FROM AUTHOR]

Background: Type 2 diabetes mellitus is associated with a diverse range of pathologies. The aim of the study was to determine the incidence of diabetes-related complications, the prevalence of coexistent chronic conditions and to report multimorbidity in people with type 2 diabetes living in the Basque Country. Methods: Administrative databases, in four cross sections (annually from 2007 to 2011) were consulted to analyse 149,015 individual records from patients aged ≥35 years with type 2 diabetes mellitus. The data observed were: age, sex, diabetes-related complications (annual rates of acute myocardial infarction, major amputations and avoidable hospitalisations), diabetes-related pathologies (prevalence of ischaemic heart disease, renal failure, stroke, heart failure, peripheral neuropathy, foot ulcers and diabetic retinopathy) and other unrelated pathologies (44 diseases). Results: The annual incidence for each condition progressively decreased during the four-year period: acute myocardial infarction (0.47 to 0.40%), major amputations (0.10 to 0.08%), and avoidable hospitalisations (5.85 to 5.5%). The prevalence for diabetes-related chronic pathologies was: ischaemic heart disease (11.5%), renal failure (8.4%), stroke (7.0%), heart failure (4.3%), peripheral neuropathy (1.3%), foot ulcers (2.0%) and diabetic retinopathy (7.2%). The prevalence of multimorbidity was 90.4%. The highest prevalence for other chronic conditions was 73.7% for hypertension, 13.8% for dyspepsia and 12.7% for anxiety. Conclusions: In the type 2 diabetes mellitus population living in the Basque Country, incidence rates of diabetes complications are not as high as in other places. However, they present a high prevalence of diabetes related and unrelated diseases. Multimorbidity is very common in this group, and is a factor to be taken into account to ensure correct clinical management. [ABSTRACT FROM AUTHOR]

This work intends to describe the physical properties of red blood cell (RBC) membranes in obese adults. The hypothesis driving this research is that obesity, in addition to increasing the amount of body fat, will also modify the lipid composition of membranes in cells other than adipocytes. Forty-nine control volunteers (16 male, 33 female, BMI 21.8 ± 5.6 and 21.5 ± 4.2 kg/m2, respectively) and 52 obese subjects (16 male and 36 female, BMI 38.2± 11.0 and 40.7 ± 8.7 kg/m2, respectively) were examined. The two physical techniques applied were atomic force microscopy (AFM) in the force spectroscopy mode, which allows the micromechanical measurement of penetration forces, and fluorescence anisotropy of trimethylammonium diphenylhexatriene (TMA-DPH), which provides information on lipid order at the membrane polar–nonpolar interface. These techniques, in combination with lipidomic studies, revealed a decreased rigidity in the interfacial region of the RBC membranes of obese as compared to control patients, related to parallel changes in lipid composition. Lipidomic data show an increase in the cholesterol/phospholipid mole ratio and a decrease in sphingomyelin contents in obese membranes. ω-3 fatty acids (e.g., docosahexaenoic acid) appear to be less prevalent in obese patient RBCs, and this is the case for both the global fatty acid distribution and for the individual major lipids in the membrane phosphatidylcholine (PC), phosphatidylethanolamine (PE) and phosphatidylserine (PS). Moreover, some ω-6 fatty acids (e.g., arachidonic acid) are increased in obese patient RBCs. The switch from ω-3 to ω-6 lipids in obese subjects could be a major factor explaining the higher interfacial fluidity in obese patient RBC membranes. [ABSTRACT FROM AUTHOR]

The aim of the study is to assess the prevalence of metabolic syndrome (MetS) in Spain using specific cutoff points for waist circumference (WC) (>94.5 cm for men and >89.5 cm for women) and evaluating the influence of several socio-demographic and economic factors. Data on MetS were obtained from a national study of 4,727 subjects from 18 to 90 years of age, conducted in Spain between 2009 and 2010 (The di@bet.es study). MetS was defined applying the new Harmonized definition (evaluating the use of abdominal obesity (AO) as a obligatory criterion for MetS or not) as well as with other widely used criteria. Results were then compared with data from previous studies. Multiple logistic regression models were used to evaluate the influence of different social factors. The age-standardized MetS prevalence was 38.37 % (CI 35.74-40.99) in men and 29.62 % (CI 27.56-31.69) in women, when AO was required as a diagnostic criterion; 42.13 % (CI 39.37-44.89) and 32.31 % (CI 30.15-34.47) in men and women, respectively, if AO was not considered mandatory. Prevalence of MetS increased with age ( p < 0.001 for trend). Women with a lower educational level were more likely to have MetS (OR 4.4; 95 % CI: 2.84-6.7) as compared with those with a higher educational level. Subjects with MetS had a worse physical quality of life. The combination of AO, hypertension and carbohydrate alterations was the most common MetS' pattern. A high prevalence of MetS was detected in the Spanish population especially in men, the elderly and women with a low educational level. [ABSTRACT FROM AUTHOR]

The present study was undertaken to examine the prevalence of urinary ACR (albumin/creatinine ratio) >30 mg/g and the associated clinical and environmental factors in a representative sample of the population of Spain. Di@bet.es study is a national, cross-sectional population-based survey conducted in 2009-2010. Clinical, metabolic, socio-demographic, anthropometric data and information about lifestyle habit were collected. Those subjects without KDM (known diabetes mellitus) were given an OGTT (oral glucose tolerance test). Albumin and creatinine were measured in a urinary sample and ACR was calculated. The population prevalence of ACR >30 mg/g was 7.65% (adjusted for sex and age). The prevalence of ACR >30 mg/g increased with age (P<0.001). Subjects with carbohydrate metabolism disorders had a greater prevalence of ACR >30 mg/g but after being adjusted for age, sex and hypertension, was significant only in those subjects with UKDM (unknown diabetes mellitus) {OR (odd ratio), 2.07 [95% CI (confidence interval), 1.38-3.09]; P<0.001] and KDM [OR, 3.55 (95% CI, 2.63-4.80); P<0.001]. Prevalence of ACR >30 mg/g was associated with hypertension [OR, 1.48 (95% CI, 1.12-1.95); P=0.001], HOMA-IR (homoeostasis model assessment of insulin resistance) [OR, 1.47 (95% CI, 1.13-1.92); P ≤0.01], metabolic syndrome [OR, 2.17 (95% CI, 1.72-2.72); P<0.001], smoking [OR, 1.40 (95% CI, 1.06-1.83); P≤0.05], physical activity [OR, 0.68 (95% CI, 0.54-0.88); P≤0.01] and consumption of fish [OR, 0.38 (95% CI, 0.18-0.78); P≤0.01]. This is the first study that reports the prevalence of ACR >30 mg/g in the Spanish population. The association between clinical variables and other potentially modifiable environmental variables contribute jointly, and sometimes interactively, to the explanation of prevalence of ACR >30 mg/g. Many of these risk factors are susceptible to intervention. [ABSTRACT FROM AUTHOR]

Eur J Clin Invest 2012 Abstract Background Although high-sensitivity C-reactive protein (hs-CRP) is currently used as a risk marker of cardiovascular disease, it has been suggested that genetic, clinical, biochemical or environmental factors could modify hs-CRP levels. The aim of this study was to investigate sources of interindividual hs-CRP variability in the Spanish population. Materials and methods A representative sample of the Spanish population within the di@bet.es study was used. Study variables included a clinical and demographic structured survey, a lifestyle survey, a physical examination, plasmatic hs-CRP and other biochemical parameters. Results Median and interquartile range of plasma hs-CRP values were 1·73 ± 2·75 mg/dL. Thirty per cent of the study population had hs-CRP levels above 3 mg/dL and 38% from 1 to 3 mg/dL. Body mass index was the strongest factor associated with moderate and high hs-CRP levels. Age, sex, waist-to-hip ratio, weight increase, plasma lipid levels, glucose metabolism (HOMA-IR and abnormal glucose regulation categories), pharmacological treatment (lipid-lowering agents, psychotropic drugs and levothyroxine), smoking, physical activity, different dietary patterns, quality of life and educational level were all significantly associated with hs-CRP levels. Interactions were observed between variables. These interactions modulated the effect of previously described factors on hs-CRP. Conclusions Thirty per cent of the Spanish population have hs-CRP levels considered to represent a cardiovascular risk. Different clinical, anthropometric, biochemical and environmental variables modulate hs-CRP levels. In addition, multiple interactions between variables complicate the interpretation of hs-CRP values. [ABSTRACT FROM AUTHOR]

Summary Context Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients. Objective The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. Results A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. Conclusions Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested. [ABSTRACT FROM AUTHOR]

Objectives: Mental health problems are associated with disability, overuse of medical care, higher rates of mortality and suicide as well as personal suffering for older adults. Residents of urban, low-income senior housing may face increased risk of a variety of mental health problems, including depression. This study identified the prevalence of multiple mental health problems in older residents of low-income senior housing and explored correlates of major depressive disorder for the two largest ethnic groups: black and Latino. Method: In-person diagnostic interviews identified rates of mental illness in a sample of 635 residents of 13 low-income senior housing buildings in a medium-sized northeastern city. Applying George's Social Antecedent Model of Depression, logistic regression analyses identified shared and unique correlates of depression for Latino and black participants. Results: This population had high rates of major depressive disorder (26%), generalized anxiety disorder (12%) and other mental health problems that varied significantly by ethnic and racial group. Separate multivariate models for Latino and black people showed that younger age, more chronic conditions and social distress were related to major depressive disorder for both ethnic groups. Perceived environmental stress, shorter tenure in the building, poorer perceived health, higher life stress and fewer leisure activities were associated with depression for Latinos only. Conclusion: Mental health screening and treatment services are needed in senior housing to address these high rates of mental illness. Unique constellations of correlates of depression for different ethnic groups underscore a need for culturally competent approaches to identification and treatment. [ABSTRACT FROM AUTHOR]

Community-based research often brings investigators from different disciplinary backgrounds together with community representatives to conduct research on topics of mutual concern. This paper describes a case example that illustrates an interdisciplinary/intersectoral study of depression and barriers to mental health care among older adults and illustrate the factors central to implementing a successful research partnership. It will address the following conditions that facilitate and challenge interdisciplinary/intersectoral research: (1) achieving commonality of purpose in study design and research and referral approaches; (2) ensuring the ability to develop, field-test and implement psychometrically rigorous and culturally and qualitatively appropriate instruments; (3) building effective management structures for interdisciplinary/intersectoral research partnerships; and (4) identifying, training and supporting qualified researchers to carry out a mental health study with older ethnically diverse adults. The paper concludes with strengths and limitations of the approach. [ABSTRACT FROM AUTHOR]

A letter to the editor is presented that deals with the issue of iron storage in patients suffering from type 2 diabetes.

Aims: We aimed to assess the utility of validated metabolomic-based non-invasive tests to estimate the prevalence of liver disease in overweight/obese T2DM patients. Materials and Methods: A total of 97 T2DM patients with HbA1c <7% and BMI >25 kg/m2 were recruited. Patients underwent routine lab, liver ultrasound and FibroScan. OWLiver® Care test and OWLiver® test were measured (two serum-based, BMI-dependent lipidomic tests that discriminate between normal liver and NAFLD, and between isolated steatosis and NASH, respectively). Results: Based on results from ultrasound and FibroScan, patients were divided into four groups (Table). The prevalence of NAFLD and NASH was 86.4% and 31.1%, respectively. Severe fibrosis (F2-F4) was found in 22.9% and cirrhosis (F4) in 12.2%. OWLiver® Care test classified correctly 95% of patients with NAFLD (AUC 0.929). It showed high sensitivity (95%) and high accuracy (80%). OWLiver® test showed high consistency with the results of ultrasound and FibroScan, classifying correctly 90% of the samples of patients with NASH. Conclusions: The prevalence of NAFLD and NASH is high in overweight/obese T2DM patients. OWLiver® Care test and OWLiver® test can be good tools for early detection of NAFLD and NASH, respectively, in routine clinical practice. Disclosure: V. Bellido: None. I. Martínez-Arranz: Employee; Self; OWL Metabolomics. I. Goicolea: None. A. Amor: None. J. Pi: None. A. Pérez: None. J. Espiga: Consultant; Self; Novo Nordisk A/S. C. Montalban: None. R. Mayo: Employee; Self; OWL Metabolomics. S. Gaztambide: None. [ABSTRACT FROM AUTHOR]

Background: Type 2 diabetes mellitus is associated with a diverse range of pathologies. The aim of the study was to determine the incidence of diabetes-related complications, the prevalence of coexistent chronic conditions and to report multimorbidity in people with type 2 diabetes living in the Basque Country.Methods: Administrative databases, in four cross sections (annually from 2007 to 2011) were consulted to analyse 149,015 individual records from patients aged ≥ 35 years with type 2 diabetes mellitus. The data observed were: age, sex, diabetes-related complications (annual rates of acute myocardial infarction, major amputations and avoidable hospitalisations), diabetes-related pathologies (prevalence of ischaemic heart disease, renal failure, stroke, heart failure, peripheral neuropathy, foot ulcers and diabetic retinopathy) and other unrelated pathologies (44 diseases).Results: The annual incidence for each condition progressively decreased during the four-year period: acute myocardial infarction (0.47 to 0.40%), major amputations (0.10 to 0.08%), and avoidable hospitalisations (5.85 to 5.5%). The prevalence for diabetes-related chronic pathologies was: ischaemic heart disease (11.5%), renal failure (8.4%), stroke (7.0%), heart failure (4.3%), peripheral neuropathy (1.3%), foot ulcers (2.0%) and diabetic retinopathy (7.2%). The prevalence of multimorbidity was 90.4%. The highest prevalence for other chronic conditions was 73.7% for hypertension, 13.8% for dyspepsia and 12.7% for anxiety.Conclusions: In the type 2 diabetes mellitus population living in the Basque Country, incidence rates of diabetes complications are not as high as in other places. However, they present a high prevalence of diabetes related and unrelated diseases. Multimorbidity is very common in this group, and is a factor to be taken into account to ensure correct clinical management. [ABSTRACT FROM AUTHOR]

Background: Brief depression screens have recently been developed, but their use in older or minority populations has not been studied. To date, optimal depression screens and optimal cutpoints have not been identified for middle-aged and older Hispanic primary care patients.Methods: This study compares multiple versions of four depression screening tools--Center for Epidemiologic Studies-Depression Scale (CES-D), Geriatric Depression Scale, Yale 1-question screen, and PRIME-MD 2-question screen--to the Composite International Diagnostic Interview (CIDI), the World Health Organization's diagnostic interview, which has been validated in adult Latino populations, to assess convergent validity. Three hundred and three Puerto Rican primary care patients age 50 and older completed all screens and the CIDI in a face-to-face interview. Sensitivity and specificity for each screen were calculated, and receiver operator characteristic curves were generated.Results: Between 34% and 61% of patients screened positive for depression, depending on the measure, with 12% meeting DSM-IV criteria for major depression (CIDI). The 10-item CES-D worked best to identify major depression in this population, with a sensitivity of 84% and specificity of 64% using a cutpoint of 3.Conclusions: The 10-item CES-D, which takes about 2 minutes to administer, is a useful tool for identifying Puerto Rican patients in need of an in-depth mental health evaluation in a primary care setting. A lower cutpoint of 3 (instead of the conventional cutpoint of 4) is recommended for optimal sensitivity and specificity. [ABSTRACT FROM AUTHOR]