Search

Tomato spotted wilt (TSW) disease caused by tomato spotted wilt orthotospovirus (TSWV, Orthotospovirus tomatomaculae ) poses a significant threat to specialty and staple crops worldwide by causing over a billion dollars in crop losses annually. Current strategies for TSWV diagnosis heavily rely on nucleic acid or protein-based techniques which require significant technical expertise, and are invasive, time-consuming, and expensive, thereby catalyzing the search for better alternatives. In this study, we explored the potential of Raman spectroscopy (RS) in early detection of TSW in a non-invasive and non-destructive manner. Specifically, we investigated whether RS could be used to detect strain specific TSW symptoms associated with four TSWV strains infecting three differentially resistant tomato cultivars. In the acquired spectra, we observed notable reductions in the intensity of vibrational peaks associated with carotenoids. Using high-performance liquid chromatography (HPLC), we confirmed that TSWV caused a substantial decrease in the concentration of lutein that was detected by RS. Finally, we demonstrated that Partial Least Squares-Discriminant Analysis (PLS-DA) could be used to differentiate strain-specific TSW symptoms across all tested cultivars. These results demonstrate that RS can be a promising solution for early diagnosis of TSW, enabling timely disease intervention and thereby mitigating crop losses inflicted by TSWV., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision., (Copyright © 2024 Juárez, Steczkowski, Chinnaiah, Rodriguez, Gadhave and Kurouski.)

Tomato spotted wilt orthotospovirus (TSWV) is one of the most successful pandemic agricultural pathogens transmitted by several species of thrips in a persistent propagative manner. Current management strategies for TSWV heavily rely on growing single-gene resistant cultivars of tomato (" Sw-5b " gene) and pepper (" Tsw " gene) deployed worldwide. However, the emergence of resistance-breaking strains (RB) in recent years has compounded the threat of TSWV to agricultural production worldwide. Despite this, an extensive study on the thrips transmission biology of RB strains is currently lacking. It is also unclear whether mutualistic TSWV-thrips interactions vary across different novel strains with disparate geographical origins. To address both critical questions, we studied whether and how four novel RB strains of TSWV (two sympatric and two allopatric), along with a non-RB strain, impact western flower thrips (WFT) fitness and whether this leads to differences in TSWV incidence, symptom severity (virulence), and virus accumulation in two differentially resistant tomato cultivars. Our findings show that all RB strains increased WFT fitness by prolonging the adult period and increasing fecundity compared to non-RB and non-viruliferous controls, regardless of the geographical origin of strains or the TSWV titers in individual thrips, which were substantially low in allopatric strains. TSWV accumulation in thrips varied at different developmental stages and was unrelated to the infected tissues from which thrips acquired the virus. However, it was significantly positively correlated to that in WFT-inoculated susceptible plants, but not the resistant ones. The TSW incidences were high in tomato plants infected with all RB strains, ranging from 80% to 90% and 100% in resistant and susceptible plants, respectively. However, TSW incidence in the non-RB-infected susceptible tomato plants was 80%. Our findings provide new insights into how novel strains of TSWV, by selectively offering substantial fitness benefits to vectors, modulate transmission and gain a potential epidemiological advantage over non-RB strains. This study presents the first direct evidence of how vector-imposed selection pressure, besides the one imposed by resistant cultivars, may contribute to the worldwide emergence of RB strains., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Chinnaiah, Gautam, Herron, Workneh, Rush and Gadhave.)

Whitefly, Bemisia tabaci Gennadius (B cryptic species), transmits cucurbit leaf crumple virus (CuLCrV) in a persistent fashion. CuLCrV affects several crops such as squash and snap bean in the southeastern United States. CuLCrV is often found as a mixed infection with whitefly transmitted criniviruses, such as cucurbit yellow stunting disorder virus (CYSDV) in hosts such as squash, or as a single infection in hosts such as snap bean. The implications of different host plants (inoculum sources) with varying infection status on CuLCrV transmission/epidemics is not clear. This study conducted a series of whitefly mediated CuLCrV transmission experiments. In the first experiment, three plants species: squash, snap bean, and tobacco were inoculated by whiteflies feeding on field-collected mixed-infected squash plants. In the second experiment, three plant species, namely squash, snap bean, and tobacco with varying infection status (squash infected with CuLCrV and CYSDV and snap bean and tobacco infected with CuLCrV), were used as inoculum sources. In the third experiment, squash plants with differential CuLCrV accumulation levels and infection status (either singly infected with CuLCrV or mixed infected with CuLCrV and CYSDV) were used as inoculum sources. Irrespective of plant species and its infection status, CuLCrV accumulation in whiteflies was dependent upon the CuLCrV accumulation in the inoculum source plants. Furthermore, differential CuLCrV accumulation in whiteflies resulted in differential transmission, CuLCrV accumulation, and disease phenotype in the recipient squash plants. Overall, results demonstrate that whitefly mediated CuLCrV transmission between host plants follows a virus density dependent phenomenon with implications for epidemics.

Wheat streak mosaic virus (WSMV) and Triticum mosaic virus (TriMV) are important viral pathogens of wheat in the Great Plains. These viruses individually or in mixed infections with High Plains wheat mosaic virus cause a devastating wheat streak mosaic (WSM) disease. Although seed transmission of WSMV has been studied, no information is currently available on that of TriMV. Furthermore, no study has explored the implications of mixed infections of WSMV and TriMV on seed transmission of one or both viruses. To study both aspects, seeds from differentially resistant field-grown wheat plants (cv. TAM 304 (susceptible), Joe (WSMV resistant, Wsm2 gene), and Breakthrough (BT) (WSMV and TriMV resistant, Wsm1 gene)) showing characteristic WSM symptoms were collected and analyzed to quantify both viruses using qRT-PCR. The percentage of seeds tested positive for WSMV or TriMV individually and in mixed infection varied with cultivar and virus combinations; 13% of TAM 304 seeds tested positive for WSMV, followed by 8% of BT and 4% of Joe seeds. Similarly, TriMV was detected in 12% of BT seeds, followed by 11% of TAM 304 and 8% of Joe seeds. Lastly, mixed infection was detected in 7% of TAM 304 seeds, followed by 4% in BT, and 2% in Joe. Dissection of field-collected seeds into three parts, embryo, endosperm, and seed coat, revealed both WSMV and TriMV accumulated only in the seed coat. Consistent with seeds, percent infection of WSMV or TriMV in the plants that emerged from infected seeds in each treatment varied with cultivar and virus combinations (WSMV: BT 3%; Joe 2%; TAM 304 9%; TriMV: BT 7%; Joe 8%; and TAM 304 10%). Plants infected with mixed viruses showed more pronounced WSM symptoms compared to individual infections. However, both viruses were present only in a few plants (BT: 2%, Joe: 1%, and TAM 304: 4%). Taken together, this study showed that TriMV was transmitted vertically at a higher frequency than WSMV in resistant cultivars, and the seed transmission of TriMV with WSMV increased the virulence of both pathogens (measured via WSM symptom severity) in the emerged plants. Furthermore, Wsm1 and Wsm2 genes considerably reduced WSMV transmission via infected seeds. However, no such effects were observed on TriMV, especially in progeny plants. These results reiterated the importance of planting clean seeds and highlighted the immediate need to identify/develop new sources of TriMV resistance to effectively manage the recurring WSM epidemic.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Wheat is one of the oldest and most widely cultivated staple food crops worldwide. Wheat encounters an array of biotic and abiotic stresses during its growth that significantly impact the crop yield and consequently global food security. Molecular and imaging methods that can be used to detect such stresses are laborious and have numerous limitations. This catalyzes the search for alternative techniques that can be used to monitor plant health. Raman spectroscopy (RS) is a modern analytical technique that is capable of probing structure and composition of samples non-invasively and non-destructively. In this study, we investigate the accuracy of RS in confirmatory diagnostics of biotic and abiotic stresses in wheat. Specifically, we modelled nitrogen deficiency (ND) and drought, key abiotic stresses, and Russian wheat aphid (Diuraphis noxia) infestation and viral diseases: wheat streak mosaic virus (WSMV) and Triticum mosaic virus (TriMV), economically significant biotic stresses in common bread wheat. Raman spectra as well as high pressure liquid chromatography (HPLC)-based analyses revealed drastically distinct changes in the intensity of carotenoid vibration (1185 cm -1 ) and in the concentration of lutein, chlorophyll, and pheophytin biomolecules of wheat, triggered in response to aforementioned biotic and abiotic stresses. The biochemical changes were reflected in unique vibrational signatures in the corresponding Raman spectra, which, in turn could be used for ~100% accurate identification of biotic and abiotic stresses in wheat. These results demonstrate that a hand-held Raman spectrometer could provide an efficient, scalable, and accurate diagnosis of both biotic as well as abiotic stresses in the field., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Higgins, Serada, Herron, Gadhave and Kurouski.)

Citrus yellow-vein disease (CYVD) was first reported in California in 1957. We now report that CYVD is associated with a virus-like agent, provisionally named citrus yellow-vein associated virus (CYVaV). The CYVaV RNA genome has 2,692 nucleotides and codes for two discernable open reading frames (ORFs). ORF1 encodes a protein of 190 amino acid (aa) whereas ORF2 is presumably generated by a -1 ribosomal frameshifting event just upstream of the ORF1 termination signal. The frameshift product (717 aa) encodes the RNA-dependent RNA polymerase (RdRp). Phylogenetic analyses suggest that CYVaV is closely related to unclassified virus-like RNAs in the family Tombusviridae . Bio-indexing and RNA-seq experiments indicate that CYVaV can induce yellow vein symptoms independently of known citrus viruses or viroids., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2021 Kwon, Bodaghi, Dang, Gadhave, Ho, Osman, Al Rwahnih, Tzanetakis, Simon and Vidalakis.)

Background: The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system has become a powerful tool for functional genomics in plants. The RNA-guided nuclease can be used to not only generate precise genomic mutations, but also to manipulate gene expression when present as a deactivated protein (dCas9)., Results: In this study, we describe a vector toolkit for analyzing dCas9-mediated activation (CRISPRa) or inactivation (CRISPRi) of gene expression in maize protoplasts. An improved maize protoplast isolation and transfection method is presented, as well as a description of dCas9 vectors to enhance or repress maize gene expression., Conclusions: We anticipate that this maize protoplast toolkit will streamline the analysis of gRNA candidates and facilitate genetic studies of important trait genes in this transformation-recalcitrant plant., Competing Interests: Competing interestsThe authors declare that they have no competing interests., (© The Author(s) 2020.)

Mixed infection of plant viruses is ubiquitous in nature and can affect virus-plant-vector interactions differently than single virus infection. While several studies have examined virus-virus interactions involving mixed virus infection, relatively few have examined effects of mixed virus infection on vector preference and fitness, especially when multiple vectors are involved. This study explored how single and mixed viral infection of a non-persistently transmitted cucumber mosaic virus (CMV) and propagative and persistently-transmitted tomato spotted wilt orthotospovirus (TSWV) in pepper, Capsicum annum L., influenced the preference and fitness of their vectors, the green peach aphid, Myzus persicae (Sulzer), and the tobacco thrips, Frankliniella fusca (Hinds), respectively. In general, mixed infected plants exhibited severe symptoms compared with individually infected plants. An antagonistic interaction between the two viruses was observed when CMV titer was reduced following mixed infection with TSWV in comparison with the single infection. TSWV titer did not differ between single and mixed infection. Myzus persicae settling preference and median developmental were not significantly different between CMV and/or TSWV-infected and non-infected plants. Moreover, M. persicae fecundity did not differ between CMV-infected and non-infected pepper plants. However, M. persicae fecundity was substantially greater on TSWV-infected plants than non-infected plants. Myzus persicae fecundity on mixed-infected plants was significantly lower than on singly-infected and non-infected plants. Frankliniella fusca fecundity was higher on CMV and/or TSWV-infected pepper plants than non-infected pepper plants. Furthermore, F. fusca -induced feeding damage was higher on TSWV-infected than on CMV-infected, mixed-infected, or non-infected pepper plants. Overall, our results indicate that the effects of mixed virus infection on vectors were not different from those observed following single virus infection. Virus-induced host phenotype-modulated effects were realized on both specific and non-specific vectors, suggesting crosstalk involving all vectors and viruses in this pathosystem. The driving forces of these interactions need to be further examined. The effects of interactions between two viruses and two vectors towards epidemics of one or both viruses also need to be examined.

Mixed virus infection in host plants can differentially alter the plant phenotype, influence vector fitness, and affect virus acquisition and inoculation by vectors than single-virus infection. Vector acquisition of multiple viruses from multiple host plants could also differentially affect vector fitness and virus inoculation than acquisition of one virus. Whitefly-virus pathosystems in the southern United States include both the above-stated facets. For the first facet, this study examined the effects of single and mixed infection of cucurbit leaf crumple virus (CuLCrV, a begomovirus) and cucurbit yellow stunting disorder virus (CYSDV, a crinivirus) infecting squash on whitefly (Bemisia tabaci Gennadius MEAM1) host preference and fitness. Mixed infection of CuLCrV and CYSDV in squash plants severely altered their phenotype than single infection. The CYSDV load was reduced in mixed-infected squash plants than in singly-infected plants. Consequently, whiteflies acquired reduced amounts of CYSDV from mixed-infected plants than singly-infected plants. No differences in CuLCrV load were found between singly- and mixed-infected squash plants, and acquisition of CuLCrV by whiteflies did not vary between singly- and mixed-infected squash plants. Both singly- and mixed-infected plants similarly affected whitefly preference, wherein non-viruliferous and viruliferous (CuLCrV and/or CYSDV) whiteflies preferred non-infected plants over infected plants. The fitness study involving viruliferous and non-viruliferous whiteflies revealed no differences in developmental time and fecundity. For the second facet, this study evaluated the effects of individual or combined acquisition of tomato-infecting tomato yellow leaf curl virus (TYLCV, a begomovirus) and squash-infecting CuLCrV on whitefly host preference and fitness. Whiteflies that acquired both CuLCrV and TYLCV had significantly lower CuLCrV load than whiteflies that acquired CuLCrV alone, whereas TYLCV load remained unaltered when acquired individually or in conjunction with CuLCrV. Whitefly preference was not affected following individual or combined virus acquisition. Viruliferous (CuLCrV and/or TYLCV) whiteflies preferred to settle on non-infected tomato and squash plants. The mere presence of CuLCrV and/or TYLCV in whiteflies did not affect their fitness. Taken together, these results indicate that mixed infection of viruses in host plants and acquisition of multiple viruses by the vector could have implications for virus accumulation, virus acquisition, vector preference, and epidemics that sometimes are different from single-virus infection or acquisition., (Copyright © 2020 The Authors. Published by Elsevier B.V. All rights reserved.)

Potyviruses are the largest group of plant infecting RNA viruses that cause significant losses in a wide range of crops across the globe. The majority of viruses in the genus Potyvirus are transmitted by aphids in a non-persistent, non-circulative manner and have been extensively studied vis-à-vis their structure, taxonomy, evolution, diagnosis, transmission, and molecular interactions with hosts. This comprehensive review exclusively discusses potyviruses and their transmission by aphid vectors, specifically in the light of several virus, aphid and plant factors, and how their interplay influences potyviral binding in aphids, aphid behavior and fitness, host plant biochemistry, virus epidemics, and transmission bottlenecks. We present the heatmap of the global distribution of potyvirus species, variation in the potyviral coat protein gene, and top aphid vectors of potyviruses. Lastly, we examine how the fundamental understanding of these multi-partite interactions through multi-omics approaches is already contributing to, and can have future implications for, devising effective and sustainable management strategies against aphid-transmitted potyviruses to global agriculture.

Cucurbit leaf crumple virus (CuLCrV), a bipartite begomovirus, is transmitted by whiteflies in a persistent and circulative manner. Like other begomoviruses, CuLCrV transmission via feeding is well understood; however, whether and how CuLCrV is transmitted by horizontal and vertical modes in its vector, Bemisia tabaci, remains unexplored. We studied transovarial and mating transmission of CuLCrV, and comparatively analyzed virus accumulation in whiteflies through feeding and nonfeeding modes. Furthermore, we quantified CuLCrV DNA A accumulation at different time points to determine whether this virus propagates in whiteflies. CuLCrV DNA A was transmitted vertically and horizontally by B. tabaci , with low frequency in each case. Transovarial transmission of CuLCrV DNA A was only 3.93% in nymphs and 3.09% in adults. Similarly, only a single viruliferous male was able to transmit CuLCrV DNA A to its nonviruliferous female counterparts via mating. In contrast, viruliferous females were unable to transmit CuLCrV DNA A to nonviruliferous males. Additionally, the recipient adults that presumably acquired CuLCrV transovarially and via mating were not able to transmit the virus to squash plants. We further report that the CuLCrV DNA A viral copy numbers were significantly lower in nonfeeding modes of transmission than in feeding ones. The viral copy numbers significantly decreased at succeeding time points throughout adulthood, suggesting no CuLCrV propagation in B. tabaci . Altogether, the low frequency of nonfeeding transmission, reduced virus accumulation in whiteflies, and absence of plant infectivity through nonfeeding transmission suggest that transovarial and mating CuLCrV transmission might not substantially contribute to CuLCrV epidemics.

The association of plant viruses with their vectors has significant implications for virus transmission and spread. Only a few studies, with even fewer pathosystems, have explored non-persistent (NP) virus-vector interactions that are presumed to be transient. We studied how a NP virus, Papaya ringspot virus (PRSV) influenced the behavior and biology of its vector, the melon aphid (Aphis gossypii Glover) and the non-vector, silverleaf whitefly (Bemisia tabaci Gennadius). We also assessed whether the fitness effects on aphids are modulated through changes in the host plant, squash (Cucurbita pepo L.) nutrient profile. The overall performance of A. gossypii was substantially higher on PRSV-infected plants, along with increased arrestment on PRSV-infected than non-infected plants. No such PRSV-modulated fitness effects were observed with B. tabaci. PRSV-infected plants had increased concentrations of free essential amino acids: threonine, arginine and lysine; non-essential amino acids: glycine and homocysteine; and soluble carbohydrates: galactose, raffinose and cellobiose. In general, PRSV encouraged long-term feeding and enhanced fitness of A. gossypii through host plant nutrient enrichment. These findings provide evidence for a NP virus mediated positive fitness effects on its vector, with no spillover fitness benefits to the non-vector within the same feeding guild.

The use of microbial inoculants containing plant growth-promoting rhizobacteria as a promoter of plant fitness and health is becoming increasingly popular in agriculture. However, whether and how these bacteria affect indigenous bacterial communities in field conditions is sparsely explored. We studied the effects of seed inoculation and field soil application of ubiquitous soil bacteria, B. cereus, B. subtilis, and B. amyloliquefaciens, on the diversity, evenness, and richness of endophytic bacterial communities in sprouting broccoli roots using high-throughput metagenome sequencing. The multiple operational taxonomic units (OTUs) assigned to different bacterial taxa clearly showed changes in ecological measures and relative abundances of certain taxa between control and treatment groups. The Bacillus inocula, themselves, failed to flourish as endophytes; however, the effects they extended on the endophytic bacterial community were both generic as well as species specific. In each case, Pseudomonadales, Rhizobiales, Xanthomonadales, and Burkholderiales were the most abundant orders in the endosphere. B. amyloliquefaciens drastically reduced the most abundant genus, Pseudomonas, while increasing the relative abundance of a range of minor taxa. The Shannon-Weiner diversity and Buzas and Gibson's evenness indices showed that the diversity and evenness were increased in both B. amyloliquefaciens and mixed treated plants. The UniFrac measurement of beta diversity showed that all treatments affected the specific composition of the endophytic bacterial community, with an apparent interspecies competition in the mixed treatment. Taken together, Bacillus species influenced the diversity, evenness, and composition of the endophytic bacterial community. However, these effects varied between different Bacillus spp. in a context-specific manner.

The uniformity of crop yield is extremely important for consumers and of as much relevance to the grower as overall yield. However, size inequality within a plant population is rarely measured and has never before been considered in relation to the use of beneficial microbes for yield enhancement. For the first time, we show that addition of soil bacteria to calabrese plants significantly increased size inequality. These effects were usually more apparent in above-ground biomass. This was caused by some (but not all) plants growing very large when inoculated with bacteria, while control plants were mostly small. We suggest that the main reason is the incompatibility of the inoculated bacteria with those already present in the rhizosphere. In some cases the inoculum matched the indigenous community, providing a benefit to plant growth, while often it did not and plants remained relatively small. We conclude that analyses of size inequality should be an integral part of experiments using microbial soil amendments. These analyses can help to inform the production of more effective microbial products and to ensure that the integration of beneficial microbes into sustainable production systems does not impair uniformity in yield.

Biological and morphological plasticity in polyphagous insect herbivores allow them to exploit diverse host plant species. Geographical differences in resource availability can lead to preferential host exploitation and result in inconsistent host specialization. Biological and molecular data provide insights into specialization and plasticity of such herbivore populations. In agricultural landscapes, Aphis gossypii encounters several crop and non-crop hosts, which exist in temporal and spatial proximity. We investigated the host-specialization of two A. gossypii host-associated populations (HAPs), which were field collected from cotton and squash (cotton-associated population and melon-associated population), and later maintained separately in the greenhouse. The two aphid populations were exposed to seven plant species (cotton, okra, watermelon, squash, cucumber, pigweed, and morning glory), and evaluated for their host utilization plasticity by estimating aphid's fitness parameters (nymphal period, adult period, fecundity, and intrinsic rate of increase). Four phenotypical characters (body length, head capsule width, hind tibia length and cornicle length) were also measured from the resulting 14 different HAP × host plant combinations. Phylogenetic analysis of mitochondrial COI sequences showed no genetic variation between the two HAPs. Fitness parameters indicated a significant variation between the two aphid populations, and the variation was influenced by host plants. The performance of melon-aphids was poor (up to 89% reduction in fecundity) on malvaceous hosts, cotton and okra. However, cotton-aphids performed better on cucurbitaceous hosts, squash and watermelon (up to 66% increased fecundity) compared with the natal host, cotton. Both HAPs were able to reproduce on two weed hosts. Cotton-aphids were smaller than melon-aphids irrespective of their host plants. Results from this study suggest that the two HAPs in the study area do not have strict host specialization; rather they exhibit plasticity in utilizing several hosts. In this scenario, it is unlikely that host-associated A. gossypii populations would evolve into host-specific biotypes.

Soil microbes present a novel and cost-effective method of increasing plant resistance to insect pests and thus create a sustainable opportunity to reduce current pesticide application. However, the use of microbes in integrated pest management programs is still in its infancy. This can be attributed primarily to the variations in microbial inoculum performance under laboratory and field conditions. Soil inoculants containing single, indigenous microbial species have shown promising results in increasing chemical defenses of plants against foliar feeding insects. Conversely, commercial inoculants containing multiple species tend to show no effects on herbivore infestation in the field. We present here a simple model that endeavours to explain how single and multiple species in microbial inoculants differentially govern insect population dynamics via changes in plant chemical profiles. We discuss further how this knowledge can be applied to manipulate soil microbial species and develop 'tailored' microbial inoculants that could be used in plant protection against antagonists.