Search

Objective: The active metabolite of vitamin A, all-trans retinoic acid (ATRA), is involved in the proliferation and differentiation of granulosa cells, and promotes the follicular development, oocyte maturation, and ovulation in mammals. This study aims to investigate the ATRA induced potential long noncoding RNAs (lncRNAs) that regulate the expression of genes associated with granulosa cell proliferation and follicular development. Methods: The lncRNA and mRNA profiles of porcine granulosa cells from ATRA treatment and control group in vitro were constructed through RNA sequencing. Meanwhile, the sequencing data were verified using quantitative polymerase chain reaction (qPCR). Results: A total of 86 differentially expressed lncRNAs and 128 differentially expressed genes (DEGs) were detected in granulosa cells after ATRA treatment. The quantitative real-time PCR (qRT-PCR) results were consistent with the RNA-seq data. Functional annotation analysis revealed that the DEGs were remarkably enriched in ovary function and reproduction which contained FoxO, Hippo, Oocyte meiosis, mammalian target of rapamycin signaling pathway, as well as several pathways associated with hormone regulation like oxytocin signaling pathway and steroid hormone biosynthesis. Moreover, an interaction network of lncRNAs and their cis-target DEGs was constructed, and 7 differentially expressed lncRNAs and 6 cis-target DEGs were enriched in ovarian steroidogenesis and reproduction. Conclusion: These findings expand the lncRNA catalogue and provide a basis for further studies on the mechanism of ATRA-mediated lncRNA regulation of follicular development in pigs. [ABSTRACT FROM AUTHOR]

Background: Polycystic ovary syndrome (PCOS) is an endocrine disease associated with reproductive and metabolic abnormalities. The aim of this study was to elucidate the effects of Schisandra rubriflora (S. rubriflora) on PCOS and its related mechanisms using network pharmacology, molecular docking and in vitro experiments. Materials and methods: HERB database and SwissTargetPrediction database were used to obtain the active components and the targets of S. rubriflora. Differentially expressed genes (DEGs) associated with PCOS were obtained by analyzing GSE54248 dataset. A protein-protein interaction network was constructed, and topological analyses were performed to identify the hub targets and main bioactive components. The binding abilities between hub targets and key components were studied by molecular docking. Finally, in vitro PCOS models were constructed with KGN cells and rat ovarian granulosa cells, respectively, and the regulatory effects of schisandrin, a key bioactive component of S. rubriflora, on the cells were investigated by in vitro assays. Results: A total of 14 bioactive ingredients of S. rubriflora and 26 potential therapeutic targets of S. rubriflora in PCOS treatment were obtained. Bioinformatics analyses suggested that the mechanisms of S. rubriflora in treating PCOS were related to IL-17 signaling pathway and TNF signaling pathway. The binding affinities between key components of S. rubriflora (schisandrin, wyerone, and rugosal) and hub targets (PTGS2, MMP9, MCL1, and JUN) were high. Schisandrin could attenuate lipopolysaccharide-induced inflammation, oxidative stress, and apoptosis of KGN cells and rat ovarian granulosa cells, as well as inhibit hub target expression and TNF pathway activation. Conclusion: PTGS2, MMP9, MCL1 and JUN are potential targets for S. rubriflora to treat PCOS. Schisandrin, a main component of S. rubriflora, may be a candidate for the treatment of PCOS. [ABSTRACT FROM AUTHOR]

Polycystic ovary syndrome (PCOS) is a complex gynecological endocrinological condition that significantly impacts women's fertility during their reproductive lifespan. The causes of PCOS are multifaceted, and its pathogenesis is not yet clear. This study established a rat model of PCOS and, in conjunction with clinical samples and database data, analysed the role of claudin 11 (CLDN11) in follicular granulosa cells (GCs) in regulating the proliferation of GCs. Our findings revealed a notable decrease in the protein expression of CLDN11 within the follicular GCs of individuals with PCOS. In vitro rat cell experiments revealed that interference with CLDN11 significantly inhibited viability and increased the apoptosis of GCs. Additional research has illuminated the mechanism by which CLDN11 regulates the expression levels of CCND1 and PCNA through the PI3K/AKT signalling pathway, significantly influencing the proliferation of rat follicular GCs. Furthermore, overexpression of CLDN11 via an adeno-associated virus (AAV) vector was found to reverse the PCOS-like phenotype induced in rats by letrozole. Our findings suggest that CLDN11 stimulates the proliferation of these cells by activating the PI3K/AKT pathway, thereby increasing the expression of CCND1 and PCNA. These discoveries underscore the critical function of CLDN11 in regulating the functionality of follicular GCs, which offers novel insights into the fundamental mechanisms governing PCOS. [ABSTRACT FROM AUTHOR]

Background: Endocrine-disrupting chemicals (EDCs) interfere with the endocrine system and negatively impact reproductive health. Biochanin A (BCA), an isoflavone with anti-inflammatory and estrogen-like properties, has been identified as one such EDC. This study investigates the effects of BCA on transcription, metabolism, and hormone regulation in primary human granulosa cells (GCs), with a specific focus on the activation of bitter taste receptors (TAS2Rs). Methods: Primary human GCs from 60 participants were treated with 10 µM BCA, and selective antagonists were used to block TAS2R activation. The study assessed the expression of TAS2R14 and TAS2R43, and analyzed the impact on StAR and CYP17A1 gene expression. Intracellular calcium levels, lipid droplet size, and mitochondrial network complexity were measured to evaluate cellular metabolism and energy dynamics. Results: BCA treatment significantly upregulated TAS2R14 and TAS2R43 expression, leading to a 70% increase in StAR mRNA levels and a twofold increase in CYP17A1 expression (p < 0.05). These effects were reversed by TAS2R antagonists. Additionally, BCA treatment decreased intracellular Ca2+ levels (p < 0.01) and reduced lipid droplet size (p < 0.001), both of which were counteracted by antagonists. Enhanced mitochondrial network complexity (p < 0.001) was also observed, suggesting increased mitochondrial fusion and improved cellular energy dynamics. Conclusion: The findings indicate that BCA modulates transcriptional and metabolic processes in GCs through the activation of TAS2Rs, highlighting their role in endocrine regulation. The statistically significant results emphasize the relevance of further exploring the effects of EDCs like BCA on reproductive health. Collaborative research efforts are essential to address and mitigate the adverse impacts of EDCs on fertility. [ABSTRACT FROM AUTHOR]

Background: Polycystic ovary syndrome (PCOS) is a prevalent endocrine disorder among women of reproductive age. It is characterized by hyperandrogenism, ovulatory dysfunction, and the presence of polycystic ovarian morphology (PCOM) on ultrasound, often accompanied by metabolic disturbances such as insulin resistance and obesity. Current treatments, including oral contraceptives and anti-androgen medications, often yield limited efficacy and undesirable side effects. This study investigates the role of UGT2B15, an essential enzyme for androgen metabolism, in PCOS pathogenesis and its potential as a therapeutic target. Methods: We used RNA sequencing to examine the effects of UGT2B15 knockdown in KGN cells. To modulate UGT2B15 expression, we employed siRNA and (R)/(S)-NAF (naftopidil), a chemical inducer of UGT2B15 identified in our previous studies on a prostate hyperplasia model. The effects of siRNA and (R)/(S)-NAF on dihydrotestosterone (DHT) levels, cell apoptosis, and the expression of apoptosis-related proteins in KGN cells were evaluated. In a PCOS mouse model, we assessed the effects of (R)-NAF and (S)-NAF on serum androgen levels, menstrual cycles, ovarian morphology, and UGT2Bs expression. Additionally, luciferase reporter and ChIP assays were utilized to study UGT2B15 regulation by NR1H4. Results: Elevated androgens were found to suppress UGT2B15 expression in ovarian granulosa cells, leading to DHT accumulation and apoptosis. (R)-NAF and (S)-NAF treatments reversed these effects, alleviating PCOS symptoms in mice such as hyperandrogenism, irregular menstrual cycles, and the presence of ovarian cysts. NR1H4 negatively regulated the transcription of UGT2B15 in KGN cells. (R)-NAF and (S)-NAF disrupted NR1H4 binding to the UGT2B15 promoter without affecting its protein levels, indicating direct interference with its regulation. Conclusions: UGT2B15 represents a promising target for novel PCOS therapies by modulating androgen metabolism and protecting ovarian granulosa cells from apoptosis. (R)-NAF and (S)-NAF regulate UGT2B15 by disrupting NR1H4's binding to its promoter, implying potential therapeutic compounds for PCOS treatment. [ABSTRACT FROM AUTHOR]

Extracellular vesicles, or exosomes, are produced by every type of cell and contain metabolites, proteins, lipids, and nucleic acids. Their role in health and disease is to influence different aspects of cell biology and to act as intermediaries between cells. Follicular fluid exosomes or extracellular vesicles (FF-EVs) secreted by ovarian granulosa cells are critical mediators of ovary growth and maturation. The movement and proteins of these exosomes are crucial in the regulation of cellular communication and the aging of cells, a process termed inflammaging. Menopause, a natural progression in the aging of females, is often accompanied by numerous negative symptoms and health issues. It can also act as a precursor to more severe health problems, including neurological, cardiovascular, and metabolic diseases, as well as gynecological cancers. Researchers have discovered pathways that reveal the diverse effects of exosome-driven cellular communication and oocyte development in the follicular fluid. It also explores the complex functions of FF exosomal proteins in the pathologies associated with menopause. [ABSTRACT FROM AUTHOR]

Objective: Polycystic Ovary Syndrome (PCOS) is a prevalent endocrinopathy in reproductive-aged women, contributing to 75% of infertility cases due to ovulatory dysfunction. The condition poses significant health and psychological challenges, making the study of its pathogenesis and treatment a research priority. This study investigates the effects of Mogroside V (MV) on PCOS, focusing on its anti-inflammatory and anti-insulin resistance properties. Methods: Forty-five female Sprague–Dawley rats were divided into three groups: control, PCOS model, and MV treatment. The PCOS model was induced using a high-fat diet and letrozole. The MV treatment group was subsequently administered MV after the establishment of the PCOS model. The study monitored body mass, assessed estrous cycle changes, and measured serum hormone levels. Transcriptome sequencing and bioinformatics were used to identify differentially expressed genes related to inflammation and insulin resistance. Expression of pyroptosis and insulin resistance markers was analyzed using qRT-PCR, Western blot, and IHC. Additionally, an in vitro model assessed MV's impact on inflammation and insulin resistance. Results: The PCOS group exhibited elevated serum testosterone (T), luteinizing hormone (LH), insulin, and fasting glucose levels, along with increased insulin resistance (HOMA-IR) and decreased estradiol (E2), which were reversed by MV treatment. Transcriptome analysis identified significant gene expression changes between groups, particularly in pathways related to NLRP3 inflammation and insulin metabolism. MV treatment normalized the expression of ovarian pyroptosis factors (NLRP3, Caspase-1, GSDMD) and inflammatory cytokines (IL-1β, IL-18). In cellular models, MV increased E2 levels, reduced LDH release, and decreased the expression of insulin resistance and pyroptosis markers. Correlation analysis showed pyroptosis factors were positively correlated with HOMA-IR and IGF1, and negatively with IGF1R and E2 levels. Conclusion: MV improves PCOS by reducing pyroptosis and insulin resistance, enhancing insulin sensitivity, and promoting estrogen synthesis, thereby restoring granulosa cell function and follicular development. [ABSTRACT FROM AUTHOR]

Polycystic ovary syndrome (PCOS) is the leading cause of anovulatory infertility among women of reproductive age, yet the range of effective treatment options remains limited. Our previous study revealed that reduced levels of nicotinamide adenine dinucleotide (NAD+) in ovarian granulosa cells (GCs) of women with PCOS resulted in the accumulation of reactive oxygen species (ROS) and mitochondrial dysfunction. However, it is still uncertain whether increasing NAD+ levels in the ovaries could improve ovarian function in PCOS. In this study, we demonstrated that supplementation with the NAD+ precursor nicotinamide riboside (NR) prevented the decrease in ovarian NAD+ levels, normalized estrous cycle irregularities, and enhanced ovulation potential in dehydroepiandrosterone (DHEA)-induced PCOS mice. Moreover, NR supplementation alleviated ovarian fibrosis and enhanced mitochondrial function in ovarian stromal cells of PCOS mice. Furthermore, NR supplementation improved oocyte quality in PCOS mice, as evidenced by reduced abnormal mitochondrial clustering, enhanced mitochondrial membrane potential, decreased ROS levels, reduced spindle abnormality rates, and increased early embryonic development potential in fertilized oocytes. These findings suggest that supplementing with NAD+ precursors could be a promising therapeutic strategy for addressing ovarian infertility associated with PCOS. Ovarian NAD+ levels decreased in DHEA-induced PCOS mice, accompanied by mitochondrial dysfunction in oocytes and ovarian stromal cells, resulting in reduced oocyte quantity and quality, decreased early embryonic development potential, and increased ovarian fibrosis. After increasing ovarian NAD+ levels by NR supplementation to restore PCOS-related impairment of mitochondria function, ovarian dysfunction in PCOS was attenuated as characterized by improved oocyte quantity and quality, enhanced early embryonic development potential, and decreased ovarian fibrosis. [ABSTRACT FROM AUTHOR]

Simple Summary: The low laying performance of geese has significantly hindered the development of the goose breeding industry. The growth and development of goose follicle granulosa cells (GCs) directly influence normal ovulation in geese, which in turn impacts egg production. Our previous data suggest that de novo lipogenesis (DNL) occurs within the GCs of goose follicles. In this study, we investigated the potential mechanism of action of the PLIN1 gene in goose GCs for the first time, using cell culture, transfection, and transcriptome sequencing technologies. The results of the transcriptome analysis indicated that PLIN1 may regulate oxidative stress in goose follicular granulosa cells through the TGF-β signaling pathway, thereby inducing cell proliferation or apoptosis. Additionally, nine candidate genes were identified as potentially involved in this process. These findings enhance the understanding of the molecular regulatory mechanisms in goose follicular GCs and provide a theoretical foundation for future in-depth studies on these molecular mechanisms. PLIN1, a member of the PAT family, is expressed in both adipocytes and steroidogenic cells. In this study, we used cell transfection technology combined with transcriptome sequencing to investigate the regulatory mechanism of PLIN1 in goose follicular GCs. Gene Ontology (GO) analysis revealed that in the four groups (phGC: over_vs_over-NC; hGC: over_vs_over-NC; phGC: si_vs_si-NC; hGC: si_vs_si-NC), most differentially expressed genes (DEGs) were significantly enriched (p < 0.05) in pathways related to biological processes (BPs), particularly those associated with the regulation of cellular lipid metabolism and oxidative stress. KEGG analysis further identified significant enrichment (p < 0.05) in pathways related to cell apoptosis and the cell cycle. A joint analysis of KEGG and PPI on the upregulated and downregulated DEGs revealed that the TGF-β signaling pathway was the only pathway significantly enriched among both upregulated and downregulated DEGs after PLIN1 overexpression in hGCs and phGCs. Based on these findings, we hypothesize that PLIN1 overexpression may promote granulosa cell proliferation and apoptosis by activating the TGF-β signaling pathway in goose follicular GCs. Additionally, nine potential candidate genes were identified: PPARγ, MGLL, PTEN, BAMBI, BMPR2, JUN, FST, ACSF3, and ACSL4. These results address a significant research gap concerning the role of this gene in granulosa cells and contribute to the understanding of its molecular regulatory mechanisms. [ABSTRACT FROM AUTHOR]

Simple Summary: The broody behavior of geese has seriously impacted egg production performance and hindered the development of the industry. However, the principal regulators and underlying physiological mechanisms of this biological process are not well understood. Consequently, this study aimed to identify key proteins by assessing the antioxidant levels in the ovary in conjunction with proteomic analysis to elucidate the mechanisms underlying geese broodiness and offer new insights to improve egg production performance. Studies have demonstrated significant alterations in ovarian oxidative stress levels, ovarian degeneration, and follicular atresia during the broody period in geese. The results of this study showed that during the broody period, geese exhibited degraded ovarian tissues, disrupted follicular development, a thinner granulosa cell layer, and lower levels of ovarian hormones E2, P4, and AMH. Antioxidant activity (GSH, CAT, SOD, T-AOC, and the content of H2O2) and the mRNA expression levels of antioxidant genes (GPX, SOD-1, SOD-2, CAT, COX-2, and Hsp70) were significantly higher in pre-broody geese compared to laying geese, while the expression of apoptosis-related genes (p53, Caspase-3, and Caspase-9) increased and the anti-apoptotic gene Bcl-2 decreased. Additionally, proteomic analysis identified 703 differentially expressed proteins (DEPs), primarily concentrated in the GO categories of the biological process (biological regulation, response to stimulus, etc.) and enriched in the KEGG pathways (PI3K-Akt signaling pathway, etc.). Among them, XDH was central to the regulatory network. Furthermore, Western blotting revealed higher expression of XDH in the ovaries of pre-broody geese than those of laying geese. Pearson correlation analysis indicated a significant correlation between XDH expression and oxidative stress markers in the ovaries of geese (r > 0.75). Overall, these results demonstrated that geese experience ovarian atrophy and remarkably increased oxidative stress during the broody period, suggesting that XDH may be a key driver of broodiness in geese. [ABSTRACT FROM AUTHOR]

Simple Summary: The aim of this research was to characterize the structure, expression, and function of unc-13d in the process of sex reversal in Monopterus albus. The expression profile of unc-13d suggested that unc-13d plays an important role in sex reversal. Additionally, the DNA methylation of the promoter of unc-13d exhibited negative correlation with gene expression, especially at site 114. Furthermore, we found that dmrt1 antagonistically regulates foxl2 expression through unc-13d. Monopterus albus is a protogynous hermaphroditic fish that changes from female to male, but the underlying sex change mechanism remains as-yet unknown. In this study, we firstly cloned and characterized the sequence and protein structure of unc-13d of M. albus. We found that the genomic structure of unc-13d was different from other species. Expression was detected in the developing gonad by applying qRT-PCR and in situ hybridization. We found that the expression of unc-13d in the ovotestis was higher than in the ovary and testes. A strong signal of unc-13d was detected in oocytes and granulosa cells in the ovary and spermatogonia and primary spermatocytes in the testes. We found that the promoter methylation of unc-13d was negatively correlated with gene expression in developing gonads, especially at site 114. A dual-luciferase assay was designed and revealed that dmrt1 regulates promoter activity opposite to foxl2. In summary, during sex reversal, DNA methylation affects the binding of the transcription factor dmrt1 and foxl2 in the promoter region through methylation and demethylation interactions to regulate the expression of unc-13d during gonadal development. [ABSTRACT FROM AUTHOR]

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1. [ABSTRACT FROM AUTHOR]

Ovarian tissue cryopreservation addresses critical challenges in fertility preservation for prepubertal female cancer patients, such as the lack of viable eggs and hormonal deficiencies. However, mitigating follicle and granulosa cell damage during freeze-thaw cycles remains an urgent issue. Luteinizing hormone (LH), upon binding to luteinizing hormone receptors (LHR) on granulosa cells, enhances estrogen synthesis and secretion, contributing to the growth of granulosa cells and follicles. This study examined mouse ovarian follicles and granulosa cells to identify optimal LH treatments using morphological assessments and LIVE/DEAD assays. The study found significant increases in the expression of Leucine-rich G-protein-coupled receptor 5 (Lgr5) and Forkhead box L2 (Foxl2) in mural and cumulus granulosa cells under LH influence, alongside marked reductions in active caspase-3 expression. Double immunofluorescence of Ki67 with Foxl2 and Lgr5 revealed ongoing proliferative activity in granulosa cells post freeze-thaw. In addition, LH treatment significantly boosted the expression of transforming growth factor (TGF-β) and its superfamily members in both granulosa cells and oocytes. These findings suggest that LH addition during cryopreservation can diminish damage to follicles and granulosa cells, offering new strategies to enhance the efficacy of mammalian ovarian cryopreservation. [ABSTRACT FROM AUTHOR]

Background: Granulosa cell proliferation and survival are essential for normal ovarian function and follicular development. Long non-coding RNAs (lncRNAs) have emerged as important regulators of cell proliferation and differentiation. Nuclear paraspeckle assembly transcript 1 (NEAT1) has been implicated in various cellular processes, but its role in granulosa cell function remains unclear. Methods: We investigated the function of lncRNA NEAT1 in human ovarian granulosa-like tumor cells (KGN). The effects of NEAT1 overexpression or silencing on cell proliferation and cell cycle were evaluated using CCK-8 assays and flow cytometry. The interaction between NEAT1, miR-29a-3p, and IGF1 was examined using dual-luciferase reporter assays, qRT-PCR, and Western blot analysis. Results: NEAT1 promoted granulosa cell proliferation and cell cycle progression by indirectly upregulated IGF1 expression through acting as a molecular sponge for miR-29a-3p. Cell proliferation and G2/M phase proportions were increased by overexpression of NEAT1, whereas cell proliferation and G2/M phase proportions decreased with NEAT1 silencing. The effects of NEAT1 on cell proliferation and cell cycle-related proteins (CCNB1 and CDK2) were partially reversed by miR-29a-3p mimic, while miR-29a-3p inhibitor rescued the effects of NEAT1 silencing. Conclusion: LncRNA NEAT1 could promote ovarian granulosa cell proliferation and cell cycle progression via the miR-29a-3p/IGF1 axis in polycystic ovary syndrome. Further investigation of this mechanism in clinical samples may have implications for understanding ovarian physiology and pathology. [ABSTRACT FROM AUTHOR]

Since the establishment of the COVID-19 pandemic, a range of studies have been developed to understand the pathogenesis of SARS-CoV-2 infection, vaccine development, and therapeutic testing. However, the possible impacts that these viruses can have on non-target organisms have been explored little, and our knowledge of the consequences of the COVID-19 pandemic for biota is still very limited. Thus, the current study aimed to address this knowledge gap by evaluating the possible impacts of oral exposure of C57Bl/6 J female mice to SARS-CoV-2 lysate protein (at 20 µg/L) for 30 days, using multiple methods, including behavioral assessments, biochemical analyses, and histopathological examinations. Although we did not have evidence of hematological, mutagenic, or genotoxic effects, we noted that the ingestion of SARS-CoV-2 lysate protein-induced behavioral disorders (hypoactivity, anxiety-like behavior, and short-term memory deficit), which were associated with oxidative stress and dopaminergic and cholinesterase imbalance in the animal brain. Furthermore, the elevation of bilirubin levels and lactate dehydrogenase levels in these animals suggests the occurrence of hepatic changes, and the redox imbalance, nitrosative stress, and elevated production of IFN-γ and inflammatory infiltration in the duodenum, disrupted follicular structure, and presence of vacuoles in granulosa cells, in ovarian, indicate that the SARS-CoV-2-exposed group showed significant toxicity. Principal component analysis (PCA) and cluster analysis confirmed that the groups were clearly separated and showed that the largest changes upon SARS-CoV-2 exposure were related to ROS, MDA, nitrite, IFN-γ/IL-10 levels and SOD and catalase activity in the ovary; IFN-γ/IL-10 production and SOD activity in the duodenum; BChE activity in the brain; bilirubin levels and lactate dehydrogenase activity in the serum; number of primary follicles in the ovary. In conclusion, our study provides new insights into the toxicity of SARS-CoV-2 lysate proteins in a non-target terrestrial organism of infection and, therefore, expands our understanding of the real extent of the ecological/environmental impact of the COVID-19 pandemic. [ABSTRACT FROM AUTHOR]

As one of the essential lignan derivative found in traditional Chinese medicinal herbs, secoisolariciresinol diglucoside (SDG) was proved to promote women's health through its phytoestrogenic properties. Increasingly studies indicated that this compound could be a potential drug capable of preventing estrogen-related diseases. Here, we aimed to investigate whether SDG can counteract cyclophosphamide (CTX) induced premature ovarian insufficiency (POI) and further explore its specific molecular mechanism. In this study, we first validated the therapeutic effect of SDG on POI in a mouse model. Then, the mechanism by which SDG improves POI is predicted through a combination of network and pharmacology, and its authenticity is further confirmed by experimental verification, molecular docking analysis and molecular dynamics simulation. The results showed that SDG significantly alleviated POI by improving ovarian indices and follicle counts while protecting against CTX-induced ovarian damage by modulating the PI3K/Akt signaling pathway in KGN cells. In addition, molecular docking studies confirmed SDG's high affinity for Akt1 and PI3Kγ, pinpointing the precise interaction sites. These results underscore the protective mechanisms of SDG against ovarian damage, highlighting its therapeutic potential. In summary, our study identified that SDG can ameliorate CTX-induced POI with its mechanism of action intricately linked to the modulation of the PI3K/Akt signaling pathway. [ABSTRACT FROM AUTHOR]

Objective: Polycystic ovary syndrome (PCOS) is a reproductive endocrine disease characterized by reproductive dysfunction and metabolic abnormalities. The purpose of this study was to explore the expression characteristics of coding and non-coding RNAs in granulosa cells of PCOS, and to provide data support for understanding the pathogenesis of PCOS. Methods: Three patients with PCOS (according to the 2003 Rotterdam diagnostic criteria) and three normal controls were selected. We used the standard long protocol to collect granulosa cells from two groups, who underwent assisted reproduction at the Reproductive Medicine Center of the Affiliated Hospital of Inner Mongolia Medical University, China. We performed whole-transcriptome sequencing using RNA-Seq technology to construct transcriptome patterns of messenger RNAs (mRNAs), long non-coding RNAs (lncRNAs), circular RNAs (circRNAs), and microRNAs (miRNAs). These patterns were then subjected to in-depth analysis using bioinformatics tools. Results: We identified a total of 2111 mRNAs and 4328 non-coding RNAs (ncRNAs) in the PCOS group as compared with the control group. Among the ncRNAs, there were 2047 lncRNAs, 892 circRNAs, and 1389 miRNAs. Based on the condition |log2(fold_change) |≥ 1 and a P-value of ≤ 0.05, we obtained 705 differentially expressed genes (DEGs), 204 differentially expressed lncRNAs, 111 differentially expressed circRNAs, and 88 differentially expressed miRNAs. The target genes were mainly enriched in metabolic pathways such as mitogen-activated protein kinase (MAPK), Wnt, transforming growth factor-beta (TGF-β), and the cell cycle. There were three types of circRNAs, among which the number of exon-type circRNAs accounted for more than 90%. Using co-expression network analysis, we identified several important candidate gene mRNAs (VLDLR, PPP2R2B, and MYOCD), lncRNAs (FBXO30, SNHG14, and PVT1), and miRNAs (miRNA-150); these mRNAs and ncRNAs could play a regulatory role in PCOS granulosa cells. Conclusion: In this study, we discovered significant alterations in mRNAs, lncRNAs, circRNAs, and miRNAs in PCOS granulosa cells, indicating dysregulation in vital pathways. Notably, genes like VLDLR, PPP2R2B, and MYOCD, along with lncRNAs FBXO30, SNHG14, and PVT1, may contribute to PCOS pathology, shedding light on potential therapeutic targets. [ABSTRACT FROM AUTHOR]

Background/Objectives: The avascular nature of the follicle creates a hypoxic microenvironment, establishing a niche where granulosa cells (GCs) rely on glycolysis to produce energy in the form of lactate (L-lactate). Autophagy, an evolutionarily conserved stress-response process, involves the formation of autophagosomes to encapsulate intracellular components, delivering them to lysosomes for degradation. This process plays a critical role in maintaining optimal follicular development. However, whether hypoxia regulates autophagy in GCs via lactate remains unclear. Methods: In this study, we investigated lactate-induced autophagy under hypoxia by utilizing glycolysis inhibitors or silencing related genes. Results: We observed a significant increase in autophagy in ovarian GCs under hypoxic conditions, indicated by elevated LC3II levels and reduced P62 levels. Suppressing lactate production through glycolytic inhibitors (2-DG and oxamate) or silencing lactate dehydrogenase (LDHA/LDHB) effectively reduced hypoxia-induced autophagy. Further investigation revealed that the HIF1-α/BNIP3/Beclin-1 axis is essential for lactate-induced autophagy under hypoxic conditions. Inhibiting HIF-1α activity using siRNAs or PX-478 downregulated BNIP3 expression and subsequently suppressed autophagy. Similarly, BNIP3 silencing with siRNAs repressed lactate-induced autophagy in hypoxic conditions. Mechanistically, immunoprecipitation experiments showed that BNIP3 disrupted pre-existing Bcl-2/Beclin-1 complexes by competing with Bcl-2 to form Bcl-2/BNIP3 complexes. This interaction released Beclin-1, which subsequently triggered lactate-induced autophagy under hypoxic conditions. Conclusions: These findings unveil a novel mechanism by which hypoxia regulates GC autophagy through lactate production, highlighting its potential role in sustaining follicular development under hypoxic conditions. [ABSTRACT FROM AUTHOR]

The specific expression profile and function of circular RNA (circRNA) in follicular atresia remain largely unknown. Here, the circRNA expression profiles of granulosa cells derived from healthy follicles (HFs) and antral follicles (AFs) in buffalo were analyzed by RNA-seq, and the mechanism of a differentially expressed circRNA (DEcircRNA) circTEC regulating the granulosa cell function that affects follicular atresia was further explored. RNA-seq results showed that a total of 112 DEcircRNAs were identified. Among them, circTEC was highly expressed in HF, and its circular structure was confirmed by RNase R digestion assay, reversed PCR and Sanger sequencing. Functional experiments demonstrated that circTEC promotes the proliferation and steroid hormone synthesis of buffalo granulosa cells (bGCs), and it also inhibits their apoptosis. In-depth mechanism analysis showed that the expression level of circTEC in bGCs from AFs was adversely related to miR-144-5p and consistent with FZD3. CircTEC acts as an endogenous sponge of miR-144-5p to regulate the expression of the target gene FZD3 in AFs, which promotes the proliferation of bGCs and inhibits bGCs apoptosis, thereby inhibiting follicular atresia in buffalo. In summary, our study revealed the regulatory role of the circTEC/miR-144-5p/FZD3 axis during follicular atresia in buffalo. These results provided new insights into the biological mechanism underlying follicular atresia. [ABSTRACT FROM AUTHOR]

Ovarian aging significantly impacts female fertility, with mitochondrial dysfunction emerging as a key factor. This study investigated the effects of recombinant follicle-stimulating hormone (FSH) and luteinizing hormone (LH) on mitochondrial function and metabolism in aging female reproductive cells. Human granulosa cells (HGL5) were treated with FSH/LH or not. Mitochondrial function was assessed through various assays, including mitochondrial mass, membrane potential, ROS levels, and ATP production. Mitochondrial dynamics and morphology were analyzed using MitoTracker staining. Cellular respiration was measured using a Seahorse Bioenergetics Analyzer. Metabolic reprogramming was evaluated through gene expression analysis and metabolite profiling. In vivo effects were studied using aging mouse oocytes. FSH/LH treatment significantly improved mitochondrial function in aging granulosa cells, increasing mitochondrial mass and membrane potential while reducing ROS levels. Mitochondrial dynamics showed a shift towards fusion and elongation. Cellular respiration, ATP production, and spare respiratory capacity were enhanced. FSH/LH-induced favorable alterations in cellular metabolism, favoring oxidative phosphorylation. In aging mouse oocytes, FSH/LH treatment improved in vitro maturation and mitochondrial health. In conclusion, FSH/LH supplementation ameliorates age-related mitochondrial dysfunction and improves cellular metabolism in aging female reproductive cells. [ABSTRACT FROM AUTHOR]

Simple Summary: Normal folliculogenesis is essential for mammalian fertility. Ovarian granulosa cells (GCs) are necessary in mammalian reproduction as they secrete factors promoting oocyte growth and maturation. Although the role of inhibitin beta A (INHBA) in the proliferation and secretion functions of GCs is well established, the post-transcriptional regulation of INHBA expression during folliculogenesis in sheep remains unclear. This research investigated the role of miRNAs in sheep GCs that target INHBA and assessed the potential functions of miR-134-3p in the activity of GCs in sheep. These results confirmed the functions of miR-134-3p in controlling GC proliferation and apoptosis via influencing the TGF-β/PI3K/AKT pathway. Inhibin β-A (INHBA), a TGF-β superfamily member, is crucial for developing follicles. Although miRNAs are essential for post-transcriptional gene regulation, it is not yet known how they affect the expression of INHBA during follicle development. Using bioinformatics analyses, miR-134-3p was found, in this investigation, to be a crucial microRNA that targets INHBA in sheep GCs. Furthermore, when the follicular diameter expanded, there was a discernible decline in miR-134-3p expression. The miR-134-3p overexpression markedly reduced the proliferation of GCs, whereas its knockdown augmented it. Moreover, cell cycle progression was enhanced by miR-134-3p overexpression. Furthermore, miR-134-3p overexpression heightened GC apoptosis, while its knockdown reduced it. Importantly, miR-134-3p overexpression blocked the PI3K/AKT/mTOR axis, whereas its knockdown stimulated it. Overall, the outcomes of transfections with INHBA and miR-134-3p showed that, in sheep GCs, miR-134-3p targets INHBA to control cell proliferation and apoptosis. In summary, these results add to our understanding of the molecular mechanisms involving important miRNAs in ewe fecundity by indicating that miR-134-3p influences cell proliferation, cell apoptosis, and the TGF-β/PI3K/AKT/mTOR axis, which, in turn, influences the follicular development of sheep GCs. [ABSTRACT FROM AUTHOR]

Polycystic ovary syndrome (PCOS) is a common endocrine disorder marked by ovarian dysfunction and metabolic abnormality. This study explores the therapeutic potential of leonurine (SCM-198) in PCOS. Our results show that SCM-198 treatment significantly improved ovarian function, hormone disorders and insulin resistance while reducing granulosa cell ferroptosis. This study provides the first evidence that SCM-198 modulates the gut microbiota composition, increases the abundance of Christensenella minuta , and boosts butyrate levels. Transcriptomic and metabolomic analyses revealed that PCOS patients exhibit granulosa cell ferroptosis and decreased butyrate levels in follicular fluid. Butyrate was shown to alleviate ferroptosis in granulosa cells via the SLC7A11/TXNRD1/GPX4 pathway, as confirmed in vitro with KGN cells. The therapeutic mechanism of SCM-198 in the management of PCOS via the gut microbiota-ovary axis involves the enhancement of gut microbiota and its metabolites. This intervention improves ovarian function and alleviates PCOS symptoms by targeting ferroptosis in granulosa cells. [Display omitted] • SCM-198 alleviates ovarian dysfunction and insulin resistance in PCOS-like mice. • Christensenella minuta and butyric acid are key contributors to the treatment of PCOS. • Butyrate inhibits ferroptosis in granulosa cells through the SLC7A11/GPX4 pathway. [ABSTRACT FROM AUTHOR]

BACKGROUND Successful ovulation is essential for natural conception and fertility. Defects in the ovulatory process are associated with various conditions of infertility or subfertility in women. However, our understanding of the intra-ovarian biochemical mechanisms underlying this process in women has lagged compared to our understanding of animal models. This has been largely due to the limited availability of human ovarian samples that can be used to examine changes across the ovulatory period and delineate the underlying cellular/molecular mechanisms in women. Despite this challenge, steady progress has been made to improve our knowledge of the ovulatory process in women by: (i) collecting granulosa cells across the IVF interval, (ii) creating a novel approach to collecting follicular cells and tissues across the periovulatory period from normally cycling women, and (iii) developing unique in vitro models to examine the LH surge or hCG administration-induced ovulatory changes in gene expression, the regulatory mechanisms underlying the ovulatory changes, and the specific functions of the ovulatory factors. OBJECTIVE AND RATIONALE The objective of this review is to summarize findings generated using in vivo and in vitro models of human ovulation, with the goal of providing new insights into the mechanisms underlying the ovulatory process in women. SEARCH METHODS This review is based on the authors' own studies and a search of the relevant literature on human ovulation to date using PubMed search terms such as 'human ovulation EGF-signaling', 'human ovulation steroidogenesis', 'human ovulation transcription factor', 'human ovulation prostaglandin', 'human ovulation proteinase', 'human ovulation angiogenesis' 'human ovulation chemokine', 'human ovulatory disorder', 'human granulosa cell culture'. Our approach includes comparing the data from the authors' studies with the existing microarray or RNA-seq datasets generated using ovarian cells obtained throughout the ovulatory period from humans, monkeys, and mice. OUTCOMES Current findings from studies using in vivo and in vitro models demonstrate that the LH surge or hCG administration increases the expression of ovulatory mediators, including EGF-like factors, steroids, transcription factors, prostaglandins, proteolytic systems, and other autocrine and paracrine factors, similar to those observed in other animal models such as rodents, ruminants, and monkeys. However, the specific ovulatory factors induced, their expression pattern, and their regulatory mechanisms vary among different species. These species-specific differences stress the necessity of utilizing human samples to delineate the mechanisms underlying the ovulatory process in women. WIDER IMPLICATIONS The data from human ovulation in vivo and in vitro models have begun to fill the gaps in our understanding of the ovulatory process in women. Further efforts are needed to discover novel ovulatory factors. One approach to address these gaps is to improve existing in vitro models to more closely mimic in vivo ovulatory conditions in humans. This is critically important as the knowledge obtained from these human studies can be translated directly to aid in the diagnosis of ovulation-associated pathological conditions, for the development of more effective treatment to help women with anovulatory infertility or, conversely, to better manage ovulation for contraceptive purposes. REGISTRATION NUMBER N/A. [ABSTRACT FROM AUTHOR]

STUDY QUESTION What molecular mechanisms underlie the decline in ovarian reserve as the number and quality of oocytes decrease in patients with ovarian endometriomas (OEM)? SUMMARY ANSWER Elevated expression of the let-7 micro(mi)RNAs in the follicular microenvironment of OEM-affected ovaries targets the expression of type 1 insulin-like growth factor receptor (IGF1R) in granulosa cell (GC) and disrupts their proliferation, steroid hormone secretion levels, adenosine triphosphate (ATP) energy metabolism, and reactive oxygen species (ROS) oxidative stress levels. WHAT IS KNOWN ALREADY Patients with OEM exhibit diminished ovarian reserve, characterized by reduced oocyte quantity and quality. Fibrotic changes in the ovarian tissue surrounding the OEM create a disruptive microenvironment for follicular growth and development. STUDY DESIGN, SIZE, DURATION This is a cross-sectional study aimed to elucidate the molecular mechanisms underlying the impact of OEM on follicular development. Initially, miRNA expression profiles in follicular fluid (FF) samples were sequenced from patients with infertility related to OEM (N   =   3) and male factor (MF) infertility (N   =   3), with the latter serving as the control group. Differentially expressed miRNAs were validated in additional samples from each group (N   =   55 in OEM group and N   =   45 in MF group) to confirm candidate miRNAs. The study also investigated indicators associated with GCs dysfunction in vitro on rat GCs. Subsequently, rat models of OEM were established through endometrial allogeneic transplantation, and fertility experiments were conducted to assess the let-7/ IGF1R axis response to OEM in vivo. Patient samples were collected between May 2018 and April 2019, and the mechanistic study was conducted over the subsequent three years. PARTICIPANTS/MATERIALS, SETTING, METHODS FF and GC samples were obtained from infertile patients undergoing IVF treatment for OEM and MF related infertility. miRNA expression profiles in FF samples were analyzed using second-generation high-throughput sequencing technology, and candidate miRNAs were validated through quantitative PCR (qPCR). In the in vitro experiments conducted with rat GCs, cell proliferation was assessed using the CCK-8 assay, while steroid hormone concentrations were measured using chemiluminescence. ATP content was determined with an ATP assay kit, and levels of ROS were quantified using flow cytometry. A dual luciferase reporter gene assay was employed to identify the target gene of let-7 based on the construction of a IGF1R reporter gene plasmid using 293T cells. Western blotting was utilized to evaluate the expression of IGF1R in GCs, as well as its downstream proteins, and changes in signaling pathways following let-7 agomir/antagomir transfection and/or Igf1r silencing. In the in vivo OEM rat models, alterations in ovarian structure and cyst morphology were observed using hematoxylin and eosin staining. The expressions of let-7 and Igf1r in GCs were evaluated through qPCR, while variations in IGF1R expression were investigated with immunohistochemistry. MAIN RESULTS AND THE ROLE OF CHANCE The cohort of patients with ovarian OEM in this study exhibited significantly decreased antral follicle counts, oocyte retrieval numbers, and normal fertilization rates compared to the control group with MF. The expression of the let-7 miRNA family was markedly upregulated in the FF and GCs of OEM patients. Transfection of rat GCs with let-7 agonists diminished the functions of GCs, including disrupted cell proliferation, mitochondrial oxidative phosphorylation, and steroid hormone secretion, while transfection of rat GCs with let-7 antagonists caused the opposite effects. Luciferase reporter gene experiments confirmed that let-7 complementarily bound to the 3′-untranslated regions of IGF1R. Stimulation of let-7 expression in rat GCs led to a significant decrease in IGF1R expression, while inhibition of let-7 increased IGF1R expression. The expression of IGF1R in the GCs of OEM patients was also significantly reduced compared to MF patients. Silencing of Igf1r led to the dysfunction of GCs, similar to the effects of let-7 agonization, as demonstrated by the downregulation of key proteins involved in cell proliferation (CCND2 and CCND3) and oestradiol synthesis, as well as an increase in progesterone synthesis (StAR), while implicating the PI3K-Akt and MAPK signaling pathways. The antagonistic effect of let-7 on GCs was ineffective when Igf1r was silenced. Conversely, the agonistic effect of let-7 on GCs could be reversed by stimulation with the IGF1R ligand IGF-1. These findings suggested that let-7 regulated the proliferation, differentiation, and ATP synthesis of GCs through targeting IGF1R. The OEM rat model demonstrated alterations in ovarian morphology and structure, along with reduced fertility. Let-7 expression was significantly upregulated in GCs of OEM rats compared to normal rats, while Igf1r and IGF1R expression in pre-ovulatory follicular GCs were notably downregulated, supporting the notion that elevated let-7 expression in the follicular microenvironment of OEM inhibited IGF1R, leading to abnormal GC function and impacting fertility at the molecular level. LARGE SCALE DATA N/A. LIMITATIONS, REASONS FOR CAUTION The synthesis and secretion mechanisms of steroid hormones are intricate and complex. Some enzymes that regulate oestrogen synthesis also play a role in progesterone synthesis. Moreover, certain receptors can respond to multiple hormone signals. Therefore, in this study, the expression patterns of key enzymes such as CYP17A, CYP11A1, HSD3B2, StAR, and receptors including AR, LHCGR, FSHR, ESR2, might be influenced by various factors and might not demonstrate complete consistency. WIDER IMPLICATIONS OF THE FINDINGS Future research will concentrate on investigating the potential impact of ovarian stromal cells on the external microenvironment of follicle growth. Additionally, screening for small molecule drugs that target let-7 and IGF1R actions can be conducted to intervene and modify the ovarian microenvironment, ultimately enhancing ovarian function. STUDY FUNDING/COMPETING INTEREST(S) This study received funding from the National Natural Science Foundation of China (grant number 82301851 to L.B.S. grant numbers U23A20403 and U20A20349 to S.Y.Z. and grant number 82371637 to Y.D.D.) and the Natural Science Foundation of Zhejiang Province (grant LTGY23H040010 to F.Z.). The authors have no conflicts of interest to declare. [ABSTRACT FROM AUTHOR]

[Display omitted] • This study first reveals a significant presence of core fucosylation in female fertility control. • Ovarian response and oocyte quality are associated with core fucosylation. • Core fucosylation regulates FSH responsiveness of the FSHR on granulosa cells in follicles. • Core fucosylation levels among young and older women could be an indicator for monitoring reproductive health. • Appropriate dietary management of L-fucose appears to be considered as a potentially safe means to maintain and restore reproductive capacity. Ovarian low response to follicle-stimulating hormone (FSH) causes infertility featuring hypergonadotropic hypogonadism, ovarian failure, and/or defective ovarian response. N-glycosylation is essential for FSH receptor (FSHR). Core fucosylation catalyzed by fucosyltransferase 8 (FUT8) is the most common N-glycosylation. Core fucosylation level changes between individuals and plays important roles in multiple physiological and pathological conditions. This study aims to elucidate the significance of FUT8 to modulate FSHR function in female fertility. Samples from patients classified as poor ovary responders (PORs) were detected with lectin blot and real-time PCR. Fut8 gene knockout (Fut8−/−) mice and FUT8-knockdown human granulosa cell line (KGN-KD) were established and in vitro fertilization (IVF) assay, western blot, molecular interaction, immunofluorescence and immunoprecipitation were applied. Core fucosylation is indispensable for oocyte and follicular development. FSHR is a highly core-fucosylated glycoprotein. Loss of core fucosylation suppressed binding of FSHR to FSH, and attenuated FSHR downstream signaling in granulosa cells. Transcriptomic analysis revealed the downregulation of several transcripts crucial for oocyte meiotic progression and preimplantation development in Fut8−/− mice and in POR patients. Furthermore, loss of FUT8 inhibited the interaction between granulosa cells and oocytes, reduced transzonal projection (TZP) formation and caused poor developmental competence of oocytes after fertilization in vitro. While L-fucose administration increased the core fucosylation of FSHR, and its sensitivity to FSH. This study first reveals a significant presence of core fucosylation in female fertility control. Decreased fucosylation on FSHR reduces the interaction of FSH-FSHR and subsequent signaling, which is a feature of the POR patients. Our results suggest that core fucosylation controls oocyte and follicular development via the FSH/FSHR pathway and is essential for female fertility in mammals. [ABSTRACT FROM AUTHOR]

This study examines the role of N-acetylglucosamine kinase (NAGK) in initiating puberty in female mice. We employed real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) and immunofluorescence to measure NAGK expression in the hypothalamic-pituitary-ovarian axis across various developmental stages: infant, prepuberty, puberty, and adult. We further investigated the impact of Nagk gene knockdown on puberty in female mice. This included assessing the expression of puberty-related genes both in vivo and in vitro , GT1-7 cells proliferation and apoptosis, concentrations of GnRH and Kisspeptin, puberty onset timing, serum levels of progesterone (P 4) and estradiol (E 2), and ovarian morphology. Results revealed that Nagk mRNA is present in the hypothalamus, pituitary, and ovaries throughout different developmental stages in female mice. In the hypothalamus, Nagk mRNA levels were comparable during infant and prepuberty, lowest during puberty, and highest in adult. In the pituitary, Nagk mRNA peaked in adult, with no significant variation between infant, prepuberty, and puberty. In the ovaries, Nagk mRNA levels increased during puberty and peaked in adult. NAGK is predominantly located in the arcuate nucleus (ARC), periventricular nucleus (PeN), dorsomedial hypothalamic nucleus (DMH), paraventricular nucleus (PVN), adenohypophysis, and in the ovarian oocytes, interstitium, and granulosa cells across all developmental stages in female mice. Nagk knockdown in GT1-7 cells decreased the transcriptional level of Gnrh , Kiss1 , Gpr54 , Igf1 and Mapk1 4 mRNA and cell proliferation but increased the level of β-catenin mRNA and cell apoptosis, while reducing GnRH secretion. Following ICV injection, Nagk gene knockdown mice exhibited delayed the timing of vaginal opening (VO) and reduced hypothalamic levels of Gnrh , Kiss1 , Gpr54 , Igf1 , Mapk14 , and β-catenin mRNA. Additionally, serum concentrations of E 2 in Nagk gene knockdown mice were significantly lower compared to the control group. These findings indicate that Nagk regulates the expression of Gnrh and Kiss1 mRNA in GT1-7 cells, affects hypothalamus Gnrh mRNA levels and serum E 2 concentration, and that its knockdown can delay puberty onset in female mice. • NAGK was expressed in the reproductive axis of female mice, with mRNA and protein levels varying by developmental stages. • Knockdown of Nagk in GT1-7 cells can reduce the transcription levels of puberty-related genes. • Knockdown of Nagk in GT1-7 cells can inhibit GnRH secretion and cell proliferation, and promote apoptosis. • Knockdown of Nagk delayed the age at vaginal opening and reduced serum E 2 level in mice. [ABSTRACT FROM AUTHOR]

Cumulus granulosa cells (CGCs) are somatic cells surrounding the oocyte that play an important role in oocyte growth, meiotic maturation, ovulation, and fertilization in mammals. Therefore, revealing the molecular mechanisms related to the development and function of CGCs is essential for further understanding the regulatory network in female reproduction. MSX2 belongs to the highly conserved msh homeobox gene family and plays diverse roles in different biological processes. This study cloned the coding sequence (CDS) of the yak MSX2 gene and detected the abundance and localization of MSX2 in the major female reproductive organs. The results indicated that the CDS of this gene included 747 base pairs and encoded 248 amino acids. The abundance of MSX2 mRNA was highly expressed in the luteal phase of the yak ovary during the estrous cycle, and MSX2 protein was widely expressed in different female reproductive organs, including the ovary, corpus luteum, uterus, and oviduct. Repressing MSX2 abundance in yak CGCs declined the cell viability and defective steroidogenesis. Several genes abundances related to cell proliferation, apoptosis, and sterogenesis also changed after MSX2 knockdown. MSX2 overexpression had the opposite effect on cell viability in yak CGCs. These results reveal the specific mechanism by which MSX2 regulates the development and function of yak CGCs and give novel and valuable insights into the mechanisms involved in yak reproduction. • Detecting MSX2 expression in yak reproductive organs. • MSX2 is crucial for steroidogenesis in yak cumulus granulosa cells. [ABSTRACT FROM AUTHOR]

As a member of peroxisome proliferator-activated receptor (PPAR) family, PPARG has been reported to be involved in glucolipid metabolism in various species. However, the function of PPARG in estradiol (E2) synthesis, apoptosis, and proliferation in goat ovarian granulosa cells (GCs) is unclear. In this study, we found that goat PPARG was expressed in GCs of all grades of follicles, and localized in the cytoplasm and nucleus of GCs. Transfection of small interfering RNA-PPARG2 (si-PPARG2) decreased E2 synthesis and the abundances of HSD3B and CYP19A1 mRNA and protein. It also promoted cell apoptosis with significant increases in the ratio of BAX/BCL-2 and Caspase3 mRNA and protein. Meanwhile, cell cycle was inhibited by si-PPARG2 transfection, accompanied by decreased mRNA levels of CDK4 , CKD6 , MYC , CCND1 , CCND2 , PCNA , and CCNB , increased mRNA level of P53 , and decreased protein levels of CDK4, MYC, and CCND1. Furthermore, PPARG interference affected the mRNA and protein abundances of CREB as well as the phosphorylation of CREB but not PKA. In conclusion, our data suggest that PPARG plays an important role in regulating E2 synthesis, cell apoptosis, and proliferation of goat GCs, including the CREB expression and phosphorylation. These results provide evidences for the in-depth study of PPARG in the regulation of goat GCs function. • PPARG interference decreased E2 synthesis and the mRNA and protein abundances of HSD3B and CYP19A1 in goat granulosa cells. • PPARG2 interference affected cell cycle and cell apoptosis in goat granulosa cells. • PPARG interference affected the mRNA and protein abundances and the phosphorylation of CREB in goat granulosa cells. [ABSTRACT FROM AUTHOR]

Inflammation disrupts the normal function of granulosa cells (GCs), which leads to ovarian dysfunction and fertility decline. Inflammatory conditions such as polycystic ovary syndrome (PCOS), primary ovarian insufficiency (POI), endometriosis, and age-related ovarian decline are often associated with chronic low-grade inflammation. Nicotinamide mononucleotide (NMN) is an important precursor of NAD+ and has gained attention for its potential to modulate cellular metabolism, redox homeostasis, and mitigate inflammation. This study investigated the protective roles of NMN against lipopolysaccharide LPS-mediated inflammation in GCs. The results of this experiment demonstrated that LPS had negative effects on GCs in term of reduced viability and proliferation rates and upregulated the production of pro-inflammatory cytokines, including interleukin-1 beta (IL-1β), interleukin-6 (IL-6), cyclooxygenase-2 (Cox-2), and tumor necrosis factor-alpha (TNF-α). Notably, the levels of NAD+ and NAD+/NADH ratio in GCs were reduced in response to inflammation. On the other hand, NMN supplementation restored the NAD+ levels and the NAD+/NADH ratio in GCs and significantly reduced the expression of pro-inflammatory markers at both mRNA and protein levels. It also enhanced cell viability and proliferation rates of GCs. Furthermore, NMN also reduced apoptosis rates in GCs by downregulating pro-apoptotic markers, including Caspase-3, Caspase-9, and Bax while upregulating anti-apoptotic marker Bcl-2. NMN supplementation significantly reduced reactive oxygen species ROS and improved steroidogenesis activity by restoring the estradiol (E2) and progesterone (P4) levels in LPS-treated GCs. Mechanistically, this study found that NMN suppressed the activation of the TLR4/NF-κB/MAPK signaling pathways in GCs, which regulates inflammatory processes. In conclusion, the findings of this study revealed that NMN has the potential to reduce LPS-mediated inflammatory changes in GCs by modulating NAD+ metabolism and inflammatory signaling pathways. NMN supplementation can be used as a potential therapeutic agent for ovarian inflammation and related fertility disorders. [ABSTRACT FROM AUTHOR]