Search

Context.--Recently, new technologies, such as nextgeneration sequencing and third-generation sequencing, have been used in carrier screening of thalassemia. However, there is no direct comparison between the 2 methods in carrier screening of thalassemia. Objective.--To compare the clinical performance of third-generation sequencing with next-generation sequencing in carrier screening of thalassemia. Design.--Next-generation sequencing and third-generation sequencing were simultaneously conducted for 1122 individuals in Hainan Province. Results.--Among 1122 genetic results, 1105 (98.48%) were concordant and 17 (1.52%) were discordant between the 2 methods. Among the 17 discordant results, 4 were common thalassemia variants, 9 were rare thalassemia variants, and 4 were variations with unknown pathogenicity. Sanger sequencing and polymerase chain reaction for discordant samples confirmed all the results of thirdgeneration sequencing. Among the 685 individuals with common and rare thalassemia variants detected by third-generation sequencing, 512 (74.74%) were carriers of athalassemia, 110 (16.06%) were carriers of b-thalassemia, and 63 (9.20%) had coinheritance of a-thalassemia and bthalassemia. Three thalassemia variants were reported for the first time in Hainan Province, including --THAI, -α2.4, and ααααanti3.7. Eleven variants with potential pathogenicity were identified in 36 patients with positive hemoglobin test results. Among 52 individuals with negative hemoglobin test results, 17 were identified with thalassemia variants. In total, third-generation sequencing and next-generation sequencing correctly detected 763 and 746 individuals with variants, respectively. Third-generation sequencing yielded a 2.28% (17 of 746) increment compared with next-generation sequencing. Conclusions.--Third-generation sequencing was demonstrated to be a more accurate and reliable approach in carrier screening of thalassemia compared with next-generation sequencing. [ABSTRACT FROM AUTHOR]

Background: Conventional thalassemia screening takes a stepwise approach and has limitations in comprehensively identifying all spectrums of mutations. This study aimed to investigate the performance of third-generation sequencing (TGS) compared to conventional molecular testing. Methods: TGS was applied to validate all known variants detected by conventional testing and to detect missing variants in undiagnosed cases. The study was conducted at Maharaj Nakorn Chiang Mai Hospital between December 2021 and April 2022. Results: In total, 19 cases were included in this study, among which 52.6% (10/19) had known thalassemia variants, while 47.7% (9/19) cases were undiagnosed by conventional methods. All 16 variants previously detected were validated by TGS, and TGS additionally detected 43.8% (7/16) thalassemia variants for 36.8% (7/19) cases. Conclusion: TGS could provide additional genetic diagnoses compared with conventional methods. Further cost-effectiveness studies with a larger sample size are needed to explore the role of TGS in clinical practices. [ABSTRACT FROM AUTHOR]

Context.--Thalassemia is the most widely distributed monogenic autosomal recessive disorder in the world. Accurate genetic analysis of thalassemia is crucial for thalassemia prevention. Objective.--To compare the clinical utility of a third-generation sequencing-based approach termed comprehensive analysis of thalassemia alleles with routine polymerase chain reaction (PCR) in genetic analysis of thalassemia and explore the molecular spectrum of thalassemia in Hunan Province. Design.--Subjects in Hunan Province were recruited, and hematologic testing was performed. Five hundred four subjects positive on hemoglobin testing were then used as the cohort, and third-generation sequencing and routine PCR were used for genetic analysis. Results.--Of the 504 subjects, 462 (91.67%) had the same results, whereas 42 (8.33%) exhibited discordant results between the 2 methods. Sanger sequencing and PCR testing confirmed the results of third-generation sequencing. In total, third-generation sequencing correctly detected 247 subjects with variants, whereas PCR identified 205, which showed an increase in detection of 20.49%. Moreover, a triplications were identified in 1.98% (10 of 504) hemoglobin testing--positive subjects in Hunan Province. Seven hemoglobin variants with potential pathogenicity were detected in 9 hemoglobin testing--positive subjects. Conclusions.--Third-generation sequencing is a more comprehensive, reliable, and efficient approach for genetic analysis of thalassemia than PCR, and allowed for a characterization of the thalassemia spectrum in Hunan Province. [ABSTRACT FROM AUTHOR]

Hemoglobin disorders are among the most common genetic diseases worldwide. Molecular diagnosis is helpful in cases where the diagnosis is uncertain and for genetic counseling. Protein‐based diagnostic techniques are frequently adequate for initial diagnosis. Molecular genetic testing is pursued in some cases, particularly when a definitive diagnosis is not possible and especially for the purpose of assessing genetic risk for couples wanting to have children. The expertise available in the clinical hematology laboratory is essential for the diagnosis of patients with hemoglobin abnormalities. Initial diagnoses are made using protein‐based techniques such as electrophoresis and chromatography. Based on these findings, genetic risk to an individual's offspring can be assessed. In the setting of β‐thalassemia and other β‐globin disorders, coincident α‐thalassemia may be difficult to diagnose, which can have potentially serious consequences. In addition, unusual forms of β‐thalassemia caused by deletions in the β‐globin locus cannot be definitively characterized using standard techniques. Molecular diagnostic testing has an important role in the diagnosis of hemoglobin disorders and is important in the setting of genetic counseling. Molecular testing also has a role in prenatal diagnosis to identify fetuses affected by severe hemoglobinopathies and thalassemias. [ABSTRACT FROM AUTHOR]

Background: Erythrocyte parameter analysis is the important means for diagnosis and treatment of hematological diseases, which are essential for screening of thalassemia in southern China combined with hemoglobin electrophoresis analysis. But little is known regarding the reference intervals (RIs) in healthy pediatrics in these two areas. Methods: 95% RIs of erythrocyte parameters were calculated from 853 healthy preschoolers, aged from 1 days to <6 years, according to the C28‐A3C guidelines of the Institute of Clinical and Laboratory Standards. To express the magnitude of sex and age variation, standard deviation ratio (SDR) was calculated using ANOVA. Concurrently, we selected 3814 thalassemia carriers as carriers group and drew receiver operating characteristic (ROC) curves to establish the optimal cut‐off values of hemoglobin electrophoresis parameters, which were used as the upper/lower limits of RIs to efficiently screen thalassemia. Results: All parameters except red blood cell (RBC) required age partitioning, confirmed by SDRage above.4. There was no need for sex partitioning on all parameters, confirmed by SDRsex below.4. The optimal cut‐off value of Hemoglobin A2 (Hb A2) in the four subgroups was <7.8% (Hb A), 2.3%–3.2%, 2.5%–3.6% and 2.6%–3.6%, respectively. Conclusion: In this study, the establishment of RIs improved the diagnostic efficiency of hematological disease (especially thalassaemia) for children in Guangxi. It provides reliable hematological references for the identification and diagnosis, treatment monitoring, and health screening of children's clinical diseases. [ABSTRACT FROM AUTHOR]

Introduction: Newborn screening is an important supplement to thalassemia control and prevention. Capillary electrophoresis (CE) technology has several advantages for thalassemia screening but with low sensitivity, especially for thalassemia carriers. This study aims to illustrate the application of an optimized interpretation model in newborn thalassemia screening by capillary hemoglobin electrophoresis. Methods: Two thousand, two hundred fifty‐eight neonates selected from four regions in China were enrolled and were screened for α‐thalassemia and β‐thalassemia by capillary electrophoresis. Results were interpreted based on an optimized model integrated with multiple parameters. Molecular analysis was carried out in synchrony and used as the gold standard for the screening performance assessment. The consistency among different regions and thalassemia genotypes were also investigated. Results: Among the 2258 neonates, 485 were identified to have a likely diagnosis of thalassemia, and 422 α‐thalassemia, 80 β‐thalassemia, and 21 α/β‐thalassemia cases were confirmed by molecular analysis, including 277 α‐thalassemia silent carriers, 135 α‐thalassemia trait carriers, 10 Hemoglobin H disease, and 80 β‐thalassemia trait carriers. The screening sensitivity, specificity, positive, and negative predictive value for α‐thalassemia and β‐thalassemia were 84.83%, 99.14%, 95.98%, 96.41%, and 88.75%, 98.73%, 76.34%, and 99.48%, respectively. The optimized interpretation model showed higher performance for thalassemia carriers, though some neonates with silent α‐thalassemia genotypes (‐α3.7/αα, ‐α4.2/αα, and αWSα/αα) and β‐28/βN genotype were still missed. The screening performance among different regions was comparable. Conclusions: Capillary hemoglobin electrophoresis with the optimized interpretation model shows reliable performance for newborn thalassemia screening. It is applicable to large‐scale population screening. [ABSTRACT FROM AUTHOR]

Introduction: Thalassemia is one of the most common autosomal recessive inherited diseases worldwide, and it is also highly prevalent and variable in southern China. Various types of genetic testing technologies have been developed for diagnosis and screening of thalassemia. Characterized genomic DNA reference materials (RMs) are necessary for assay development, validation, proficiency testing, and quality assurance. However, there are no publicly available RMs for thalassemia genetic testing as yet. Methods: To address the need for the publicly available DNA RMs for thalassemia genetic testing, the National Institutes for Food and Drug Control and the China National GeneBank established 32 new cell lines with three wild‐type genotypes and 29 distinct genotypes of thalassemia which account for approximately 90% thalassemia carriers in China. The genomic DNA of 32 cell lines was characterized by four clinical genetic testing laboratories using different genetic testing methods and technology platforms. Results: The genotyping results are concordant among four laboratories. In addition, the results of stability test demonstrated that the genotypes of these DNA samples are not influenced by preanalytical conditions such as long‐term exposure to high‐temperature (37°C) environment and repeated freeze‐thawing. Conclusion: We developed the first national panel of 32 genomic DNA RMs which are renewable and publicly available for the quality assurance of various genetic testing methods and will facilitate research and development in thalassemia genetic testing. [ABSTRACT FROM AUTHOR]

Background: The author works as an antenatal and newborn (ANNB) screening coordinator in a hospital designated as an area of low prevalence for sickle cell and thalassaemia (SCT). As such, the opportunity for an ANNB coordinator to gain competency in prenatal counselling of individuals with SCT is limited. Method: Two case studies are used to demonstrate social, cultural and ethical issues arising from counselling individuals with SCT. Findings: Information regarding genetic risk and haemoglobinopathy status can be threatening for individuals and families, as well as transforming, depending on the context in which information is provided. [ABSTRACT FROM AUTHOR]

Introduction: Most β‐thalassemia carriers have hypochromic microcytosis with mean corpuscular volume (MCV) < 80 fL and mean corpuscular hemoglobin (MCH) < 27 pg. These can be variable due to β‐thalassemia mutations, genetic interaction between thalassemic genes, and blood cell counters. We have examined whether these indices are effective in screening of β‐thalassemia in Thailand where thalassemia is prevalence and heterogeneous. Methods: Retrospective data were reviewed on 11 443 Thai subjects encountered from August 2014 to August 2017. Subjects with heterozygous β‐thalassemia based on Hb and DNA analyses were recruited along with MCV and MCH values and analyzed. Results: Among the 11 443 subjects reviewed, 1425 were β‐thalassemia carriers. Data were available on 1214 subjects for MCV and 965 subjects for MCH. DNA analysis identified 20 different β0‐thalassemia mutations in 874 (72.0%) cases and 6 β+‐thalassemia mutations in 340 (28.0%) subjects. Of these 1214 carriers, 26 (2.1%) had MCV ≥ 80 fL; 6 (23.1%) carried β0‐thalassemia, and the remaining 20 (76.9%) had β+‐thalassemia. In contrast for those having MCH values, only 4 of 965 (0.4%) had MCH ≥ 27 pg. DNA analysis identified both β0‐thalassemia and β+‐thalassemia mutations. Conclusions: Using MCV alone for the screening of β‐thalassemia may pose a significant number of false negative although three‐quarter of them are carriers of mild β+‐thalassemia. MCH with approximately five times more sensitive is a better screening marker. Using a combined MCV and MCH is highly recommended, especially in an area with high prevalence and heterogeneity of thalassemia like Thailand. [ABSTRACT FROM AUTHOR]

α-Thalassemia (α-thal) is one of the most common genetic disorders worldwide. The aim of this study was to investigate for the first time the α-thal mutation spectrum in the Lak population living in Lorestan Province, Iran. One hundred and seventy-six α-thal carriers participated in the study. Multiplex gap-polymerase chain reaction (gap-PCR), amplification refractory mutation system (ARMS)-PCR and direct sequencing were used for the detection of different mutations on the α-globin (HBA1 and HBA2) genes. A total of 11 different mutations was identified. The –α3.7 (rightward; NG_000006.1: g.34164_37967del3804) deletion was observed most frequently (56.35%), followed by α−5 ntα (HBA2: c.95+2_95+6delTGAGG), αpolyA2α (HBA2: c.*92A>G) and – –MED I (NG_000006.1: g.24664_41064del16401), with frequencies of 15.47, 9.39, and 6.08%, respectively. These four mutations accounted for more than 87.0% of the total mutated alleles. Moreover, 19 different genotypes were identified. The types and distribution pattern of the mutations identified in this study, in comparison with other studies conducted in Iran, was most similar to the Kurdish population of Kermanshah Province, Iran. Due to the lack of information on α-thal in Lorestan Province, it was not possible to compare the mutation spectrum in the Lur and Lak populations. In conclusion, our results may help in setting up a strategy for an α-thal screening program and genetic counseling in the Lak people. [ABSTRACT FROM AUTHOR]

Objective To report on the prevalence and etiology of pediatric anemia in the Commonwealth of the Northern Mariana Islands (CNMI). Method A retrospective chart review was conducted that included patients up to 19 years of age who presented for well child care and whose hemoglobin or hematocrit was checked in the CNMI from 2014 to 2015. Lab values, diagnoses and treatment plans, patient reported ethnicity, and follow-up results were collected from eligible patients. Results The records for 1483 pediatric patients who had 1584 well child visits were reviewed. The prevalence of anemia amongst all eligible patients was 8.0% (5.4-10.7). This included 292 9 to 18 months old patients, which is estimated to be 40% of the total pediatric population of CNMI in that age group. Among the 9 to 18 months old patients, the prevalence of anemia is 5.5% (2.6-8.4). Etiology of anemia was investigated and of the patients treated with iron, 55.2% had a documented response. The majority of those without documentation of improvement with iron were patients who were lost to follow-up. In addition, a total of 10 patients were found to have an alpha or beta thalassemia variant discovered initially by anemia screening or sibling tracing. Discussion In this United States Commonwealth, prevalence of anemia appears lower than prevalence reported for other independent Pacific Island nations and closer to that of the US. Thalassemia is documented within this population. Limitations to this data were use of a convenient sample that may be hampered by lack of presentation to well-child care. This study will guide future public health studies on anemia prevalence and can guide public health intervention decisions to improve pediatric care in the CNMI. [ABSTRACT FROM AUTHOR]

The article presents a case study of a Chinese family that demonstrates that complex interactions between thalassemia defective alleles affects screening and cause severe anemia. The study highlights pitfall in the current thalassemia screening strategy and suggests counseling for couples about the limitations of the screening strategy before they undergo a thalassemia screening test purely based on erythrocyte indices. The study recommends to consider α Gene multiplications.

Thalassemia is considered one of the most common genetic blood disorders that has received excessive attention in the medical research fields worldwide. Under this context, one of the greatest challenges for healthcare professionals is to correctly differentiate normal individuals from asymptomatic thalassemia carriers. Usually, thalassemia diagnosis is based on certain measurable characteristic changes to blood cell counts and related indices. These characteristic changes can be derived easily when performing a complete blood count test (CBC) using a special fully automated blood analyzer or counter. However, the reliability of the CBC test alone is questionable with possible candidate characteristics that could be seen in other disorders, leading to misdiagnosis of thalassemia. Therefore, other costly and time-consuming tests should be performed that may cause serious consequences due to the delay in the correct diagnosis. To help overcoming these challenging diagnostic issues, this work presents a new novel dataset collected from Palestine Avenir Foundation for persons tested for thalassemia. We aim to compile a gold standard dataset for thalassemia and make it available for researchers in this field. Moreover, we use this dataset to predict the specific type of thalassemia known as beta thalassemia (β-thalassemia) based on hybrid data mining model. The proposed model consists of two main steps. First, to overcome the problem of the highly imbalanced class distribution in the dataset, a balancing technique called SMOTE is proposed and applied to handle this problem. In the second step, four classification models, namely k-nearest neighbors (k-NN), naïve Bayesian (NB), decision tree (DT) and the multilayer perceptron (MLP) neural network are used to differentiate between normal persons and those patients carrying β-thalassemia. Different evaluation metrics are used to assess the performance of the proposed model. The experimental results show that the SMOTE oversampling method can effectively improve the identification ratio of β-thalassemia carriers in a highly imbalanced class distribution. The results reveal also that the NB classifier achieved the best performance in differentiating between normal and β-thalassemia carriers at oversampling SMOTE ratio of 400%. This combination shows a specificity of 99.47% and a sensitivity of 98.81%. [ABSTRACT FROM AUTHOR]

α-Thalassemia is an inherited, autosomal recessive, disorder characterized by a microcytic hypochromic anemia. It is one of the most common monogenic gene disorders in the world population. The clinical severity varies from almost asymptomatic, to mild microcytic hypochromic, and to a lethal hemolytic condition, called Hb Bart's Hydrops Foetalis Syndrome. The molecular basis are usually deletions and less frequently, point mutations affecting the expression of one or more of the duplicated α-genes. The clinical variation and increase in disease severity is directly related to the decreased expression of one, two, three or four copies of the α-globin genes. Deletions and point mutations in the α-globin genes and their regulatory elements have been studied extensively in carriers and patients and these studies have given insight into the α-globin genes are regulated. By looking at naturally occurring deletions and point mutations, our knowledge of globin-gene regulation and expression will continue to increase and will lead to new targets of therapy. [ABSTRACT FROM AUTHOR]

Thalassemia, the burden of inherited disorders of hemoglobin, the commonest group of single gene disorders in India is huge. A recent survey by Indian Council of Medical Research (ICMR) [10] reveals 9 of every 100 people in Kolkata are affected by thalassemia, a figure alarmingly high as compared to other major metros. According to ICMR, lack of awareness is the main reason for the high figure in Kolkata. Only education can reduce this barrier. So, this research was conducted to evaluate the effectiveness the awareness programme on knowledge and their motivation to screen the status regarding thalassemia among adolescent students. A pre-experimental study was conducted and the design used one group pre-test post-test. Non probability convenient sampling technique was used to select class IX & X students. Two hundred students were selected by total enumeration technique. A valid and reliable structured knowledge questionnaire and HPLC Test was used to collect data. The findings of the study revealed that majority of the subjects are within 14-15 years, 55% were male and rest 45% were female. 71% students were unknown to the term Thalassemia. Only 1% (2) had affected family member & relatives. There is a significant difference between mean pre-test and post-test knowledge score [t=47 "t" df(199)= 1.97; p<0.05]. The majority of the students (95%) agreed for thalassemia screening. Report of thalassemia screening showed 11% were thalassemia carrier. There was deficiency in knowledge regarding thalassemia among adolescent students. The awareness programme was effective in improving knowledge of adolescent students regarding thalssemia and to motivate them for screening. [ABSTRACT FROM AUTHOR]

Gliomas are the most common primary malignant brain tumor in humans. Lower grade gliomas are usually less aggressive but many cases eventually progress to a more aggressive secondary glioblastoma (GBM, WHO Grade IV), which has a universally fatal prognosis despite maximal surgical resection and concurrent chemo-radiation. With the identification of molecular markers, however, there is promise for improving diagnostic and therapeutic strategies. One of the key molecular alterations in gliomas is the alpha thalassemia/mental retardation syndrome X-linked (ATRX) gene, which is frequently mutated. One-third of pediatric GBM cases are also found to have the ATRX mutation and the genetic signatures are different from adult cases. The exact role of ATRX mutations in gliomagenesis, however, is unclear. In this review, we describe the normal cellular function of the ATRX gene product followed by consequences of its dysfunction. Furthermore, its possible association with the alternative lengthening of telomeres (ALT) phenotype is outlined. Lastly, therapeutic options potentiated through a better understanding of ATRX and the ALT phenotype are explored. [ABSTRACT FROM AUTHOR]

Objectives The island of Sardinia has one of the highest incidence rates of β-thalassemia in Europe due to its long history of endemic malaria, which, according to historical records, was introduced around 2,600 years ago by the Punics and only became endemic around the Middle Ages. In particular, the cod39 mutation is responsible for more than 95% of all β-thalassemia cases observed on the island. Debates surround the origin of the mutation. Some argue that its presence in the Western Mediterranean reflects the migration of people away from Sardinia, others that it reflects the colonization of the island by the Punics who might have carried the disease allele. The aim of this study was to investigate β-globin mutations, including cod39, using ancient DNA (aDNA) analysis, to better understand the history and origin of β-thalassemia and malaria in Sardinia. Materials and Methods PCR analysis followed by sequencing were used to investigate the presence of β-thalassemia mutations in 19 individuals from three different Roman and Punic necropolises in Sardinia. Results The cod39 mutation was identified in one male individual buried in a necropolis from the Punic/Roman period. Further analyses have shown that his mitochondrial DNA (mtDNA) and Y-chromosome haplogroups were U5a and I2a1a1, respectively, indicating the individual was probably of Sardinian origin. Conclusions This is the earliest documented case of β-thalassemia in Sardinia to date. The presence of such a pathogenic mutation and its persistence until present day indicates that malaria was likely endemic on the island by the Roman period, earlier than the historical sources suggest. [ABSTRACT FROM AUTHOR]

Thalassemia is one of the most common hereditary blood disorders. Epidemiological data regarding the occurrence and distribution of thalassemia is important for designing appropriate prevention strategies. The objective of this study was to update and reveal the prevalence of thalassemia and mutation spectrum in the Baise region of southern China. We screened 47,500 individuals from Baise region by hematological and genetic analysis. Totally, 11,432 (24.07%) subjects were diagnosed as being carriers and patients of thalassemia, including 7290 (15.35%) subjects with α-thalassemia, 3152 (6.64%) subjects with β-thalassemia and 990 (2.08%) subjects with both α-thalassemia and β-thalassemia. Ten α-thalassemia mutations and 31 genotypes were identified in the α-thalassemia carriers and patients. Meanwhile, 13 β-thalassemia mutations and 26 genotypes were characterized in the β-thalassemia carriers and patients. Furthermore, the true prevalence of nondeletional mutations and Thailand type (− THAI) deletion mutation were first reported in this study. In addition, three cases of αα/ααα3.7, five cases of HKαα/αα and two rare β-globin mutations, − 86 (G > C) and CD 121 (G > T) were first identified in the Chinese Zhuang ethnic populations. Our data indicated that there was great heterogeneity and extensive spectrum of thalassemias in the Baise populations. The findings will be useful for genetic counseling and prevention of severe thalassemia in this region. [ABSTRACT FROM AUTHOR]

The clinical course of hemoglobin H (HbH) disease is remarkably variable. It is not completely clear how genetic and environmental factors interplay to modify clinical severity in affected individuals. Previous studies suggested that altered structure or function of alpha-hemoglobin-stabilizing protein (AHSP) could modify the clinical phenotypes of thalassemias. The present study attempted to explore the potential role of AHSP in the pathophysiology of HbH disease in 95 Chinese and Thai/Sino-Thai patients with deletional and non-deletional form of this disease. We identified six polymorphic sites in AHSP which were subgrouped into major haplotype clades. No association between AHSP genotypes or haplotypes and clinical phenotypes was observed. Instead, multiple linear regression analysis indicated that expression of AHSP correlated negatively with age (P < 0.001) and hemoglobin (P = 0.007), but positively with reticulocyte count (P = 0.003) and severity score (P = 0.003). Subgroup analysis showed that AHSP expression was higher in the non-deletional form than in the deletional form (P < 0.001). Moreover, specific types of non-deletional HbH disease with production of mutant alpha-globin chains that do not bind to AHSP (Hb Constant Spring and Hb Pakse) showed the highest AHSP expression. The present findings demonstrate that AHSP expression is a biomarker of HbH disease severity and infer an important role of AHSP in modulating the pathophysiology of this disease. Pharmacological or genetic means to alter AHSP expression may be a novel approach for amelioration of disease severity in HbH disease. [ABSTRACT FROM AUTHOR]

Background: β-Thalassemia is the most prevalent genetic disorder in India. Its traits and coinheritance vary from mild to severe conditions, resulting in thalassemia minor, intermediate, and major, depending upon many factors. Purpose: The objective of this study was to identify the incidence of β-thalassemia traits, their coinheritance, and mutations, as well as to support the patients already diagnosed with β-thalassemia in East-Western Indian population for better management. Patients and methods: Seventy-five referral cases for β-thalassemia were analyzed for various β-thalassemia traits, heterozygosity, and homozygosity conditions. Blood phenotypic parameters using cell counter and capillary electrophoresis were investigated. Analyses of eight common mutations of thalassemia in India were carried out using polymerase chain reaction-amplification refractory mutation system, end point polymerase chain reaction, and DNA sequencing methods. Results: Of these (75) referral cases from East-Western Indian region, 68 were positive for β-thalassemia (90.67%). The majority of case types were of β-thalassemia minor (49, 65.33%), followed by HbE traits (6, 8.0%) and β-thalassemia major, including heterozygous and homozygous (5, 6.66%; 4, 5.33%) types and then HbE homozygous (2, 2.66%), as well as one each of the HbE/β-thalassemia and HbD/β-thalassemia (1, 1.34%) combination. Mutation analysis also revealed that the highest frequency of mutation was c.92+5G>C (41, 60.29%) followed by deletion 619bp (9, 13.23%) and c.79G>A (8, 11.76%) in our study group. Five cases (nos. 24, 27, 33, 58, and 71) exhibited coinheritance between β0/β+ (2), β0/β D (1), and c.124_127delTTCT/β+ or β0 (2) affecting the Rajasthani and Gujarati populations in our study of the Western region of India. Conclusion: We strongly recommend these Western populations for genetic screening before adopting reproductive technologies and interracial marital relations. [ABSTRACT FROM AUTHOR]

β-Thalassemia (β-thal) is the most prevalent hereditary blood disorder in Pakistan with a carrier rate of 5.0–8.0%. The homozygous affected children require frequent blood transfusions for their survival. This autosomal recessive disease can only be prevented through awareness programs, carrier screening, mutation detection, genetic counseling and prenatal diagnosis (PND). The present study aimed to determine the prevalence of various mutations causing β-thal and also to detect carriers of these mutations in families living in the Mardan Division, Khyber Pakhtunkhwa (KP) Province, Pakistan. The study was conducted at the Department of Biochemistry, Abdul Wali Khan University Mardan, Pakistan. Blood samples of β-thalassemic families were collected from various transfusion centers in Mardan Division. Using the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) technique, all samples were analyzed for the six most common mutations causing β-thal in this area. Six different mutant primers for the detection of different mutations were used. The most common mutations detected in thalassemic patients were frameshift codons (FSC) 8/9 (+G) (HBB: c.27_28insG), codons 41/42 (–TTCT) (HBB: c.126_129delCTTT), and IVS-I-5 (G>C) (HBB: c.92+5G>C). The predominant mutation for carrying the mutant genes for β-thal were FSC 8/9, IVS-I-5, codons 41/42, IVS-I-1. It was also found that 66.7% of marriages were consanguineous. The FSC 8/9 mutation was found to be the most common β-thal mutation with a frequency of 44.4%. This research project provides a strong incentive for the establishment of large scale mutation detection and PND services in the Mardan Division. [ABSTRACT FROM AUTHOR]

Objectives: In sickle cell/β-thalassemia, mutations in the corresponding β-globin genes are responsible for complex pathological events resulting in diverse clinical complications. The objective of this study was to provide an overview of the clinical and laboratory characteristics of patients with the syndrome, and of the degree of severity of clinical manifestations resulting from the β-thalassemia mutation. Methods: A retrospective chart review was performed on 46 patients with sickle cell/β-thalassemia (31 Sβo and 15 Sβ+), evaluating hematological parameters and end organ damage. Statistical analyzes were carried out in order to highlight differences between the two groups according to the nature of the thalassemia mutation. Results: As expected, patients with the Sβo phenotype had a higher degree of hematological involvement in comparison to Sβ+ patients; with lower hemoglobin levels, and signs of more intense chronic hemolysis. However, Sβ+ patients were more prone to the occurrence of acute chest syndrome. The impact of the thalassemia mutation upon total body and bone composition was also evident, as Sβo patients presented lower body mass index (BMI) and bone mineral density. The degree of bone damage correlated to lower BMI and hemoglobin levels, as well as plaquetosis, monocytosis and elevated lactate dehydrogenase, possibly reflecting the effects of hemolysis and inflammation upon bone metabolism and body constitution. Conclusions: This study identified significant differences among sickle cell/β-thalassemia patients according to the beta mutation involvement, pointing to an important predictor of disease severity. [ABSTRACT FROM AUTHOR]

The article discusses findings of a study on cell cycle, proliferation and apoptosis in erythroblasts cultured from patients with Ꞵ-thalassemia major. It states premature intramedullary apoptosis of erythroid progenitors as an accepted model for the ineffective erythropoiesis of Ꞵ-thalassemia major, and mentions dysregulation of the cell cycle as a significant contributor to the ineffective erythropoiesis of&#2932-thalassaemia major. It notes that increase in apoptosis.

Non-transfusion-dependent thalassemia (NTDT) is associated with various forms of thalassemia and genetic modifiers. We report the molecular basis of NTDT in hemoglobin (Hb) E-β-thalassemia disease. This study was done in 73 adult patients encountered at the prenatal diagnosis center of Khon Kaen University, Northeast Thailand. Hematological parameters and Hb patterns were collected, and α- and β-globin gene mutations were determined. Multiple single-nucleotide polymorphisms (SNPs) including the rs7482144/Gγ-XmnI polymorphism, rs2297339, rs2838513, rs4895441, and rs9399137 in the HBS1L-MYB gene, rs4671393 and rs11886868 in the BCL11A gene, and G176AfsX179 in the KLF1 gene were examined. Five β0-thalassemia mutations and a severe β+-thalassemia mutation in trans to the βE gene were identified. No significant difference in hematological parameters was observed among β-thalassemia genotypes. Coinheritance of α-thalassemia was observed in 31 of the 73 subjects (42.5%). Four SNPs including Gγ-XmnI, rs2297339, rs4895441, and rs9399137 of HBS1L-MYB were found to be associated with high Hb F levels in 39 (53.4%) subjects. The molecular basis of NTDT in the remaining 3 (4.1%) cases could not be defined. These results indicate multiple genetic factors in NTDT patients and underline the importance of complete genotyping to provide proper management, make clinical predictions, and improve genetic counseling. [ABSTRACT FROM AUTHOR]

We hereby describe a rare case of delta beta (δβ)-thalassemia as a cause of anemia in a 2-month pregnant female who was diagnosed as homozygous δβ-thalassemia after gene mutation studies. δβ-thalassemia is an unusual variant of thalassemia with elevated level of fetal hemoglobin. Homozygous patients of this disorder, unlike β-thalassemia, show mild anemia and give a clinical picture similar to that of thalassemia intermedia. However, δβ-thalassemia heterozygotes clinically show the characteristics of thalassemia minor. [ABSTRACT FROM AUTHOR]

We present a patient with a compound heterozygosity codon 39 (C > T) (β0) [or β39(C5)Gln→Stop (G39X);CAG > TAG;HBB: c.118C > T] and –87 (C > T) (β+) (HBB: c.−137C > T) β-globin mutations, a non transfusion-dependent thalassemia phenotype and 97.0% fetal hemoglobin. A novel heterozygous mutation was identified in a highly conserved residue in the COOH-terminus of the Krüppel-like factor 1, R360H, that likely altered DNA-binding and impaired transactivation. [ABSTRACT FROM AUTHOR]

Beta-thalassemia, one of the most common single-gene disorders, is the result of reduced or absent production of β-globin chains. Patients with β-thalassemia show weak genotype–phenotype correlations. Mitochondrial DNA polymorphisms are a potential source for different physiological and pathological characteristics and have been found to be associated as genetic modifiers with various pathophysiologies, including cancers and neurodegenerative diseases. A group of 35 patients with β-thalassemia was investigated for the presence of mtDNA D-loop polymorphisms in comparison with 504 normal controls. We found four mtDNA D-loop polymorphisms at nucleotides 16,069C > T, 16,189T > C, 16,319G > A, and 16,519T > C that showed significant differences between patients and normal subjects. There is no strong proof for the association of these polymorphisms with β-thalassemia. It is hypothesized that iron overload or its effects on sequestration of calcium or zinc can lead to oxidative stress and ROS production inside the mitochondria. Therefore, possible accompanying of mtDNA polymorphisms with β-thalassemia disease may complicate the genotype–phenotype correlation and could affect the clinical outcomes in the patients. [ABSTRACT FROM PUBLISHER]

Introduction: β-Thalassaemias are common genetic disorders in the Indian subcontinent and its status has not been well studied in the Upper Assam region of North Eastern India. Aim: The aim of the study was to show the prevalence of β- thalassaemias and its co-existence with Haemoglobin E and Haemoglobin S in the Upper Assam region of North Eastern India. Materials and Methods: A total of 1200 anaemic patients were investigated for β- thalassaemias. Complete Blood Count (CBC) and High Performance Liquid Chromatography (HPLC) were done for screening. Results: Out of 1200 patients screened, 5.83% β-thalassaemia trait, 2.33% compound Hb E/β-Thalassaemia, 1.33% β-thalassaemia major and 0.42% compound Hb S/β- thalassaemia were detected. A high incidence of thalassaemia is found among the people of Upper Assam region of North Eastern India. Conclusion: The only way to prevent the disease is carrier detection and awareness among the people about it. [ABSTRACT FROM AUTHOR]

Most β-thalassemia carriers have mild anemia, low mean corpuscular volume and mean corpuscular hemoglobin, and elevated hemoglobin α2 (HbA2). However, there is considerable variability resulting from coinheritance with α- and/or δ-globin gene mutations, dominant inheritance of β-thalassemia mutations, highly unstable variant globin chains, large deletions removing part or all of the β-globin gene cluster, loss of heterozygosity of the β-globin gene cluster during development, or concomitant erythroid enzyme or membrane protein abnormalities. Recognition of the specific abnormality and correct diagnosis can allay anxiety and unnecessary investigation, help formulate treatment programs, and deliver appropriate genetic and family counseling. [ABSTRACT FROM AUTHOR]

Background Patients with non-transfusion-dependent thalassemia (NTDT) present with a spectrum of disease severities. Since there are multiple pathophysiologies in such patients, tailoring treatment remains essential. Therefore, one simple, reliable tool would be beneficial to assess disease severity and tailor therapy, particularly for internal medicine specialists who may treat a variety of NTDT patients with a multitude of complications. This would allow for standardization of assessments leading to timely interventions and prevention of complications. Methods A working group of NTDT experts was formed to develop a new disease severity scoring system for adult and pediatric patients with NTDT, based on parameters considered to be most pertinent in defining disease severity. Results 20 parameters were selected for inclusion in the disease severity scoring system. An additional six parameters, largely related to growth and development, were selected specifically for pediatric patients (≤ 16 years of age). Consensus of expert opinion was used to establish the selected methods of assessment for each parameter, based on feasibility and availability of technology, cost containment, and avoidance of patient risk. Conclusion We propose that this new disease severity scoring system for adult and pediatric NTDT patients could be developed into a practical tool for widespread clinical use. [ABSTRACT FROM AUTHOR]

Background: The term thalassemia intermedia describe a form of thalassemia of intermediate severity, between the major transfusiondependent forms of the disease and the symptomless carrier states. The phenotypic diversity of β-thalassemia results from its underlying genetic diversity. The wide clinical variability of these conditions leads to major difficulties in their management. The molecular basis of thalassemia intermedia is very heterogeneous. The clinical and hematological course of β-thalassemia intermedia is influenced by a number of genetic factors. Methods and Results: The main aim of the study was to evaluate the effect of globin and nonglobin genetic modifiers on clinical severity of the disease. The study group consisted of 66 homozygous patients with β-thalassemia [40 transfusion-dependent thalassemia (TDT), 26 nontransfusion- dependent thalassemia (NTDT)]. Hepatosplenomegaly was pronounced in the NTDT group. The presence of associated α-thalassemia was significantly higher in untransfused patients (P < 0.05). The milder β-thalassemia mutations, such as Cap site +1 (A→C), -88 (C→T), and -87 (C→G), were observed mainly in the NTDT group (9.61%) as against patients with TDT (1.25%). The cis-DNA haplotypes, motifs, or polymorphisms around the gamma-globin genes [(AT)x(T)y motif (38.4%), XmnI (76.92%)and the Aγ-δ intergenic region haplotype T (73.07%) and Pre Gγ globin gene haplotype TAG (46.15%)] contributed significantly in amelioration of the disease severity. Conclusion: Our study emphasizes the complexity of genetic interactions that underlie the phenotype of β-thalassemia and highlights the importance of epistatic factors and the regulation of HbF production in β-thalassemia syndromes. [ABSTRACT FROM AUTHOR]

Background and aims Thalassemia is one of the most frequent hereditary hemoglobin (Hb) disorders in southern China. Accurate population frequency data are needed for planning the control of thalassemia in the high-risk Guilin, the southern region of China. Methods Anemia patients (n = 11,143) from the Guilin Region of the Guangxi Zhuang Autonomous Region of southern China were analyzed by Gap-PCR, PCR-based reverse dot blot (RDB), and direct sequencing methods. Results Of these patients, 4365 (39.17%) were diagnosed with α-thalassemia (α-thal), 2643 (23.72%) with β-thalassemia (β-thal), and 263 (2.36%) as carriers of both α- and β-thal. The diagnosed α-thal anomalies were related to 6 gene mutations and 27 genotypes, with the most common α-thal mutations being — SEA (61.37%), − α 3.7 (18.52%), − α 4.2 (6.80%), and α CS α (6.64%). The β-thal anomalies were related to 14 gene mutations and 30 genotypes, with the seven most common mutations [CD41–42 (-TTCT) (52.02%), CD17 (A > T) (22.12%), IVS-II-654 (C > T) (11.29%), − 28 (A > G) (5.01%), CD71–72 (4.04%), CD26 (2.28%), and − 29 (1.83%)] accounting for 98.58% of the β-globin gene mutations. In addition, CD37 (TGG → TAG) and CD 30 (A → G) were two particularly rare dominant β-thal mutations in Chinese populations. Conclusions Our data suggested that the population in Guilin are at high risk of α- and β-thalassemia. The results of this study will be useful for genetic counseling and the prevention of severe thalassemia in the Guilin Region. [ABSTRACT FROM AUTHOR]

β-Thalassemia is a genetic disease caused by a defect in the production of the β-like globin chain. More than 200 known different variants can lead to the disease and are mainly found in populations that have been exposed to malaria parasites. We recently described a duplication of four nucleotides in the first exon of β-globin gene in several families of patients living in Nord-Pas-de-Calais (France). Using the genotypes at 12 microsatellite markers surrounding the β-globin gene of four unrelated variant carriers plus an additional one recently discovered, we found that they shared a common haplotype indicating a founder effect that was estimated to have taken place 225 years ago (nine generations). In order to determine whether this variant arose in this region of Northern Europe or was introduced by migrants from regions of the world where thalassemia is endemic, we genotyped the first 4 unrelated variant carriers and 32 controls from Nord-Pas-de-Calais for 97 European ancestry informative markers (EAIMs). Using these EAIMs and comparing with population reference panels, we demonstrated that the variant carriers were very similar to the controls and were closer to North European populations than to South European or Middle-East populations. Rare β-thalassemia variants have already been described in patients sampled in non-endemic regions, but it is the first proof of a founder effect in Northern Europe. [ABSTRACT FROM AUTHOR]

Background: β-Thalassaemia is a common genetic blood disorder in the Middle Eastern region. Mandatory premarital screening and genetic counselling (PMSGC) programmes are implemented in 8 Middle East countries to reduce at-risk marriages and thus disease prevalence. A scoping review was conducted to explore the effectiveness of these programmes. Methods: The 6-stage scoping framework of Arksey and O'Malley [Int J Soc Res Methodol 2005;8:19-32] was used. Reported outcomes were analysed per country, with success defined as achieving a 65% reduction in at-risk marriages and/or thalassaemia-affected births. Emergent enablers and barriers were analysed thematically. Results: Twenty-one sources were included from the 1,348 identified, discussing 7 country programmes, with 95% (20/21) published during 2003-2013. Five publications each were included for Iran and Saudi Arabia, 3 for Turkey, 2 each for Bahrain and Iraq (Kurdistan), and 1 for the United Arab Emirates, plus 2 multi-country evaluations. No programme achieved a 65% at-risk marriage cancellation rate. Though data on thalassaemia-affected birth reductions were minimal, programmes in Iran, Turkey and Iraq reported at least 65% reductions. A thematic analysis found that screening timing, access to prenatal detection and abortion, socio-religious issues, awareness and counselling affected decisions. Conclusion: This review found that PMSGC programmes were unsuccessful in discouraging at-risk marriages but successful in reducing the prevalence of affected births in countries providing prenatal detection and therapeutic abortion. A life cycle approach to prevention, incorporation of school screening, awareness campaigns, reconsideration of therapeutic abortion, and screening and counselling of couples married prior to programme inception are likely to improve the effectiveness of such programmes in the Middle Eastern region. © 2015 S. Karger AG, Basel [ABSTRACT FROM AUTHOR]

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. [ABSTRACT FROM AUTHOR]

Introduction: Both coinheritance of thalassemic δ-globin mutation and coexistence of iron deficiency anemia (IDA) tend to decrease HbA2 (α2δ2) level and thereby poses a diagnostic conundrum in β-thalassemia trait. Methods: We retrospectively studied 78 Omani subjects, presenting with low HbA2 level by high-performance liquid chromatography (HPLC), and their DNA was sequenced for the presence of mutations in the δ-globin gene (HBD). In these subjects, their serum ferritin levels allowed evaluation of the degree of iron deficiency. Results: Overall, six different δ-globin gene mutations were observed in 40 study subjects (51.3%) and IDA in 33 subjects, with the remaining five subjects showing normal HBD sequence and serum ferritin level. Among the subjects with δ-globin gene mutations, seven had an associated IDA confirmed by significantly low serum ferritin levels. Heterozygosity for the delta (+) cd27G-->T mutation (HbA2-Yialousa; HBD: c.82G>T) was the most common abnormality observed (n = 26, 66.6%) followed by heterozygosity for HBD c.-118C->T (d -68 C->T) (n = 6, 15.4%), for cd16G-->C (n = 4, 10.3%), for cd98G-->A (n = 2, 5.1%), for cd142G-->C (n = 1, 2.6%), and for cd147G-->T (n = 1, 2.6%). Conclusions: These delta mutations exhibit low HbA2 either due to a shift in the HPLC position or due to their bona fide thalassemic feature. Two mutations, namely cd142 G-->C (GCC to CCC, Ala to Pro) and stop codon cd147 G-->T (stop to Leu with elongation of 15 amino acids), herein first reported are novel. Coexistence of IDA could lead to erroneous diagnostic interpretation unless it is specifically looked for. [ABSTRACT FROM AUTHOR]

A molecular study of Hb Lepore heterozygotes identified by the UK population screening program has revealed four out of the five known Lepore variants. The region of homologous δ- and β-globin gene sequence was determined in 58 unrelated Hb Lepore heterozygotes referred for confirmation of their carrier status by DNA analysis through the national thalassemia and sickle cell screening program over a period of 10 years. The most common variant found was Hb Lepore-Boston-Washington (Hb LBW, HBD: c.265 C > c.315 + 7 C) observed in 46 carriers (79.0%). Hb Lepore-Hollandia ( HBD: c.69 A > c.92 + 16 A) was found in nine cases (16.0%); Hb Lepore-Baltimore ( HBD: c.208 G > c.254 C) in two cases (4.0%) and Hb Lepore-ARUP ( HBD: c.97 C > c.150 C) in one carrier (2.0%). Analysis of the hematological findings showed no significant differences between the four groups. The wide range of Hb Lepore variants observed in this study confirms the very diverse range of α- and β-globin gene mutations observed in the UK population by previous studies. [ABSTRACT FROM AUTHOR]

Iron overload cardiomyopathy is one of the most common causes of death in thalassemia patients. Although new iron chelating agents have been developed, the mortality rate from heart failure remains elevated as a result of iron overload. This could be due to the fact that our understanding of the underlying mechanism of iron uptake into cardiomyocytes is still unclear, thus impeding the discovery and refinement of more effective therapy for thalassemia therapeutic strategies in thalassemic iron overload cardiomyopathy. Growing evidence indicates that multiple routes of iron entry into cardiomyocytes exist under iron overload conditions. These include both L-type (LTCC) and T-type (TTCC) calcium channels, divalent metal transporter 1 (DMT1) and transferrin receptors (TfRs). In this review, the routes of iron uptake into cardiomyocytes under iron overload conditions are presented. Evidence from pharmacological interventions in support or against the possible route of iron entry of each portal in cardiomyocytes are also comprehensively summarized and discussed. [ABSTRACT FROM AUTHOR]

The 3′ untranslated region (3′UTR) region is well known to be associated with mRNA stability because of its associations with 3′ end processing, polyadenylation and mRNA capping. Mutations located in this area cause a β-thalassemia (β-thal) phenotype compatible with β+-thal. Two brothers, 49- and 41-years-old, were diagnosed with β-thal intermedia (β-TI) at 2 years of age. The β-globin gene from the promoter region to the 3′UTR was sequenced and both brothers were diagnosed to be compound heterozygotes for the 3′UTR +1592 (A > G) ( HBB: c.*+118A > G) and codon 39 (C > T) ( HBB: c.118C > T) mutations. Their mother was a carrier of the nonsense codon 39 mutation and her hematological data suggested β-thal trait; their father was a carrier of the 3′UTR +1592 mutation, though he did not have hematological parameters associated with β-thal. The adenine at position +1592 or +118 bases downstream of the termination codon is highly conserved among primates and placental mammals, as it is located between the polyadenylation A signal (PAS) and the polyadenylation A cleavage (PAC) sites. Given its location, it is likely that this mutation would interfere with mRNA maturation; however, the clinical data of the heterozygous carriers show virtually no significant alterations. Therefore, we suggest that the impact on cleavage-stimulation factor (CstF) recognition of the mRNA sequence would be minimal and not significantly alter polyadenylation. Although the mechanism is not known, and because the carrier has no β-thal minor, the mRNA is stable enough that the synthesis of the β-globin chain is unaffected. [ABSTRACT FROM AUTHOR]

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α3.7/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel [ABSTRACT FROM AUTHOR]

Aims Hypochromic microcytic anaemia is the hallmark phenotype of thalassaemia. Current phenotypical tests do not provide a diagnosis in a small proportion of patients with red blood cell microcytosis. We aim to evaluate the genetic basis of red cell microcytosis in these cases in our Chinese population. Methods We identified from a large cohort of 1684 unselected requests for thalassaemia testing 23 Chinese subjects who had unexplained microcytosis after phenotypical iron and haemoglobin studies. In 18 of these subjects with available DNA, extensive genotypical analysis of the α and β globin gene cluster was performed, including gap-PCR, multiplex amplificationrefractory mutation system, Sanger sequencing and multiplex ligation-dependent probe amplification. Results Occult single and double α globin gene (HBA1, HBA2) deletions and α thalassaemic haemoglobinopathies (Haemoglobin Quong Sze, Haemoglobin Constant Spring) were the genetic basis for the microcytosis. Occult β globin gene (HBB) mutations and d globin gene (HBD) abnormalities masking β thalassaemia are not seen. Conclusions A cost-effective genotyping approach for the detection of these occult globin gene mutations can be proposed. The identification of these mutations is important for making a diagnosis and for the provision of accurate genetic counselling. (This paper adds to our understanding of the genetic basis of red blood cell microcytosis in clinical practice, and it provides a costeffective approach for genotyping in diagnostic laboratories). [ABSTRACT FROM AUTHOR]

We report the general phenotype severity and the hematological presentation in a cohort of 125 sickle cell anemia (SCA) patients with identical homozygous HbS/S genotype and categorized by identical β S haplotype, both with and without alpha thalassemia. No clear general phenotype correlation was found when patients were compared regardless of the haplotype but overall, patients with homozygous alpha thalassemia (α−/α−) had the highest Hb, HCT, RBC and the lowest MCV, MCH and MCHC levels. When patients with identical haplotype were compared, the mildest hematological and clinical conditions were observed in patients of the Asian/Asian haplotype, also known as Arab-Indian haplotype, and carriers of α-thalassemia, suggesting an additional ameliorating effect of alpha thalassemia. In conclusion, our results show that alpha thalassemia improves the hematological conditions but amelioration of the general disease severity is only noticed when compared in cohorts of the same haplotype. [ABSTRACT FROM AUTHOR]

We present the deferasirox pharmacokinetics evaluation of a female patient on iron chelation, for the interesting findings from her genetic background (hereditary haemochromatosis and heterozygous β-thalassaemia) and clinical history (ileostomy; iron overload from transfusions). Drug plasma concentrations were measured by an HPLC-UV validated method, before and after ileum resection. Area under deferasirox concentration curve over 24 h (AUC) values were determined by the mixed log-linear rule, using Kinetica software. AUC was low also with high deferasirox dose as well as tolerability. Non invasive tissue iron quantification by magnetic resonance imaging or superconducting quantum interference device were prevented by a metal hip replacement. Good efficacy and normalisation of iron markers was obtained on long term. Therapeutic drug monitoring in patient in critical conditions may help to understand reasons for non response and set individualised treatment. [ABSTRACT FROM AUTHOR]

Background: The development of anti-red blood cell antibodies (both allo-and autoantibodies) remains a major problem in thalassemia major patients. We studied the frequency of red blood cell (RBC) alloimmunization and autoimmunization among thalassemia patients who received regular transfusions at our center and analyzed the factors, which may be responsible for development of these antibodies. Materials and Methods: The study was carried out on 319 multiply transfused patients with -thalassemia major registered with thalassemia clinic at our institute. Clinical and transfusion records of all the patients were examined for age of patients, age at initiation of transfusion therapy, total number of blood units transfused, transfusion interval, status of splenectomy or other interventions. Alloantibody screening and identification was done using three cell and 11 cell panel (Diapanel, Bio-rad, Switzerland) respectively. To detect autoantibodies, autocontrol was carried out using polyspecific coombs (IgG + C3d) gel cards. Results: Eighteen patients out of total 319 patients (5.64%) developed alloantibodies and 90 (28.2%) developed autoantibodies. Nine out of 18 patients with alloantibodies also had autoantibodies. Age at first transfusion was significantly higher in alloimmunized than nonimmunized patients (P = 0.042). Out of 23 alloantibodies, 52.17% belonged to Rh blood group system (Anti-E = 17%, Anti D = 13%, Anti-C = 13%, Anti-Cw = 9%), 35% belonged to Kell blood group system, 9% of Kidd and 4% of Xg blood group system. Conclusion: Alloimmunization was detected in 5.64% of multitransfused thalassemia patients. Rh and Kell blood group system antibodies accounted for more than 80% of alloantibodies. This study re-emphasizes the need for RBC antigen typing before first transfusion and issue of antigen matched blood (at least for Rh and Kell antigen). Early institution of transfusion therapy after diagnosis is another means of decreasing alloimmunization. [ABSTRACT FROM AUTHOR]