Search

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

Six in vitro pear cultivars, Wonhwang, Xuehua, Conference, Stankimson, Starcrimson and Red Bastlett were infected by Apple stem pitting virus (ASPV) and were treated by combination of 25 μg/ml ribavirin and temperature 35 °C. Results showed that ribavirin could enhance the proliferation of Xuehua, Conference, Stankimson and Starcrimson and death plants were found in Xuehua and Red Bastlett and the total survival rate of the six cultivars was 93.5%. After treatment, the regenerated plants were detected by reverse transcription-polymerase chain reaction (RT-PCR). The results showed that ASPV in all regenerated plants could not be detected and the total elimination rate of the six cultivars was 92.3%. The combination showed high efficacy on elimination of ASPV.

Apple stem grooving virus (ASGV) occurs worldwide on apple (Malus pumila), pear (Pyrus pyrifolia), citrus (Citrus reticulata) and lily (Lilium brownii). Its incidence in pears trees from twelve provinces in China was determined using reverse transcription polymerase chain reaction. Overall, 84% of trees were infected with ASGV. Partial sequences of coat protein gene in isolates from pear had 85–100% nucleotide (nt) identities and 91–100% amino acid (aa) identities. The aa identity in the variable region of the movement protein ranged from 49 to 100%. The complete genome of one ASGV isolate (HH) was determined. The isolate showed an overall nt identity of 80–91% to fourteen previously reported isolates from a range of hosts; the highest identity to isolate ASGV-CHN infecting apple in China and the lowest identity to an isolate ASGV-P infecting pear in South Korea. This is the first comprehensive study on the incidence and molecular divergence of ASGV in pear.

To investigate the prevalence and genetic diversity of Grapevine berry inner necrosis virus (GINV) in China, 195 grapevine samples from 15 Chinese provinces and regions were tested using reverse-transcription polymerase chain reaction. The samples included symptomatic and asymptomatic cultivars, with 35.9% (70 of 195) of samples testing positive for GINV. Seventeen samples had obvious ring spot symptoms, and 94.1% (16 of 17) tested positive for GINV, suggesting that GINV may be highly associated with the ring spot symptom. The genetic diversity of GINV isolates was analyzed based on the partial nucleotide and amino acid sequences of the coat protein (CP) and movement protein (MP) genes. Phylogenetic analyses of the MP and CP gene sequences divided the GINV isolates into three groups. The majority of the Chinese isolates were in groups 1 and 2, and only one Chinese isolate, along with a previously reported Japanese isolate, was in group 3. This is the first report on the genetic diversity of GINV isolates and their prevalence and distribution in China.

Four varieties of potted apple were subjected to thermotherapy (37 ± 1 °C) coupled with shoot tip grafting. Using reverse transcription-polymerase chain reaction assays prior to treatment, mixed infections with Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV), Apple mosaic virus (ApMV) and Apple scar skin viroid (ASSVd) were detected in 95.8 % of treated plants. It was found that the sprouts of Dahongrong (DHR) and Qiyuetianxian (QYT) variety buds were inhibited by high temperature, although some buds of these two varieties were able to sprout, the growth was slow. The average survival rate of shoot tips cut after thermotherapy was 41.2 % (61/148). The survival rate of DHR (63.2 %) was highest among the four varieties. Sixty-one surviving apple plants were detected over two periods, indicative of an average elimination rate of 65.6 % (40/61) for new leaves (June) and 37.7 % (23/61) for dormant branches (November). The difference of elimination rate for DHR between the two periods was the most obvious. Detections rates of viruses were also different in the two periods; ASGV in dormant branches were 27.8 % higher than those in new leaves, and ASPV (90.6 %) remained the same over the two periods.

The presence of grapevine virus B (GVB) was detected in 188 grapevine samples from China by double antibody sandwich ELISA (DAS-ELISA) and reverse transcription-PCR (RT-PCR). The accuracy of detection by RT-PCR was confirmed by sequencing amplified PCR fragments. Seventeen samples were GVB-positive by DAS-ELISA and five by RT-PCR. The isolate QMW proved to be positive by RT-PCR only, and four isolates (DGWH, DGW, QM, and JFL) could be detected by both methods. Among the five GVB-positive samples detected by RT-PCR, two isolates were originally collected from Henan province and three from Liaoning province. The expected 722 bp DNA fragment, covering partial ORF3 through partial ORF5, was amplified from the five GVB infected samples. Sequence analysis revealed that the molecular variants΄ composition of GVB in the different isolates was complex. Clones of DGWH, DGW, QM, and JFL isolate shared high nucleotide identities, while the identities among the clones of isolate QMW varied. The variants of GVB isolates obtained in this study showed nucleotide identities from 81.1% to 97.9% among themselves, and 79.1% to 98.5% identity with five previously published GVB isolates in NCBI. The alignment of partial ORF3 and the phylogenetic relationships of ORF4 revealed that the molecular variants of Chinese GVB isolates could be clustered into three groups. Only isolate DGW was in the same group with the reported GVB isolates from other countries; the other four GVB isolates in this study were clustered into two groups.

Mass-customization production (MCP) companies must fight with shop-floor uncertainty and complexity caused by wide variety of product components. The research is motivated by a typical MCP company that has experienced inefficient scheduling due to paper-based identification and manual data collection. This paper presents an RFID-enabled real-time manufacturing execution system (RT-MES). RFID devices are deployed systematically on the shop-floor to track and trace manufacturing objects and collect real-time production data. Disturbances are identified and controlled within RT-MES. Planning and scheduling decisions are more practically and precisely made and executed. Online facilities are provided to visualize and manage real-time dynamics of shop-floor WIP (work-in-progress) items. A case study is reported in a collaborating company which manufactures large-scale and heavy-duty machineries. The efficiency and effectiveness of the proposed RT-MES are evaluated with real-life industrial data for shop-floor production management in terms of workers, machines and materials.

In vitro plants of sand pear ( Pyrus pyrifolia cv. Jinshui no. 2), which were infected by Apple chlorotic leaf spot virus (ACLSV) and Apple stem grooving virus (ASGV), were treated by chemotherapy with ribavirin, thermotherapy at 35 ± 0.5 °C and the combined application of both methods. Results showed that chemotherapy with ribavirin at 15–25 μg/ml for 5–30 days could enhance the growth and proliferation of in vitro pear plants. Chemotherapy combined with thermotherapy could greatly improve the efficiency of virus eradication as it was compared with the separated application of both methods. A high virus eradication efficiency of 100% was achieved by chemotherapy of ribavirin at 25 μg/ml combined with thermotherapy at 35 °C for 40 days, followed by culturing of 0.5–1 mm long meristem-tips. The efficacy of ribavirin for the elimination of both ASGV and ACLSV had no significant difference.

Pb(Zr0.5Ti0.5)O3 films with thickness of about 1.5 and 3.7 μm have been deposited on single-crystal SrTiO3 substrate by a sol-gel process from nonhydrolyzed metal alkoxide precursor. X-ray diffraction shows that the films exhibit a single perovskite phase with (001)-preferred orientation. Atomic force microscopy study indicates that the PZT film possesses a crack-free and smooth surface. The optical waveguide property has been examined by the prism-film coupling experiment. Four and 12 TE modes are observed for 1.5 and 3.7 μm PZT films, respectively.

In this paper, we have grown self-assembled GaSb quantum dots (QDs) on GaAs (100) substrate by liquid phase epitaxy (LPE) technique. The surface morphology, density and size distribution of GaSb QDs are investigated by High-Resolution Scanning Electron Microscope and Atomic Force Microscopy, respectively. Cross-sectional transmission electron microscopy is employed to obtain a cross sectional image of single quantum dot and to present the composition of QDs by focused energy dispersive X-ray (EDX). Feature of QDs of room-temperature photoluminescence (PL) spectroscopy is obvious, and the peak of the QDs at ~l.leV is well separated from wetting layer (WL) at ~ 1.34 eV.

A persistent photoconductivity (PPC) measurement was made on Ge-doped ZnSe using contact electrodes. It is shown that Ge in ZnSe forms deep levels responsible for the observed PPC effect at a quenching temperature of 210 K. The photogenerated carriers move freely in the ZnSe:Ge epilayer but are confined in the region exposed to light, indicating that it is possible to write an erasable metallic pattern on the epilayer.

The quasi-periodical quaternary ferroelectric Bragg reflectors were fabricated by using precursor solution with PEG additive. For PZT, both PEG and PVP are suitable polymers in fabrication of periodical structures based on one single chemical solution, while for BST the optical performance of the BST multilayers derived from the solution containing PVP is better than that of the BST multilayers prepared using the PEG-containing solution. One or two defect layers were inserted into the multilayers. The single cavity BST multilayer shows well-defined resonant cavity mode occurring in the reflection stop band while the BST multilayer with double cavities exhibit two coupled cavity modes on the high reflection band.

Cellulose tribenzoate (CTB) has some desirable operational properties and special interactions with alcohols. When chromatographic separation is carried out at 150°C, the C1–C4 alcohols have enhanced retention and other alcohols are eluted rapidly. Some probe molecules were used to characterize the chromatographic behavior of CTB by calculating the adsorption enthalpy (−ΔHa) between the sample and stationary phase.

Calcium was localized by in situ precipitation with potassium antimonate during epididymal maturation of the mouse and guinea pig sperms. In caput epididymis the calcium in mouse sperm head was mainly localized on the inner surface of tha outer acrosomal membrane (OAM) in preacrosomal region. During the passage from the caput epididymis to the cauda epididymis the calcium amount of mouse sperm did not undergo apparent changes. In comparison with mouse sperm, there were a few fine calcium deposite granules on the inner surface of the guinea pig sperm OAM on the abdomen side at the caput epididymis stage, but these granules disappeared at the cauda epididymis stage. The microvilli of columnar cell in columnar epithlium lining the epididymal duct are probably involved in regultion of Ca2+ concentration of the intraluminal fluid. The calcium precipitation granules distributing in the microvilli were observed. An abundance of Ca2+ were present in the intraluminal fluid of the corpus epididymis and they might have some important functions during the process of sperm maturation. Calcium in sperm tail was mainly distributed in the mitochondria. Compared with the mouse sperm, the mitochondria of guinea pig sperm possessed more calcium.

Based on phase separation, quasiperiodic PbZr0.4 Ti0.6O3 (PZT) multilayers with alternating PZT and porous-PZT layers were fabricated by using a single precursor, and the ferroelectric and dielectric behaviours of the PZT multilayers were investigated. The PZT multilayers have an averaged remanent polarization of 42.3 ?C?cm?2 and an average coercive field of 43?kV?cm?1. Two distinct dielectric relaxation phenomena were observed in the frequency range from 100?Hz to 1?MHz: the one at lower frequency is attributed to space charge polarization, while the one at higher frequency, with an activation energy of 0.49?eV, is expected to be associated with dipolar defect complexes related to oxygen vacancies.

In this paper we report results on a new hardened field oxide which exhibits improved resistance to ionizing radiation. This new field insulator shows much less radiation-induced shift in flatband voltage than that of ordinary SiO2 (either thermally grown or chemically vapor deposited). Results are obtained over a range of bias conditions (-10 volts to +22.5 volts) and radiation dosage (0 ~ 4 × 104 rads (SiO2)).

We have carried out numerical studies of the exponent characterizing the distribution of low-energy magnon modes on the infinite percolating cluster of the two-dimensional, bond-dilute, nearest-neighbor Heisenberg antiferromagnet and the XY model. In the case of the antiferromagnet we obtain agreement with the predictions of scaling theory using the value of the transverse susceptibility exponent given by Kumar and Harris. The agreement with scaling theory is somewhat less satisfactory for the XY model, but may improve with larger arrays.

Changrolin is 4-(3', 5'-bis[(N-pyrrolidinyl)methyl]-4'-hydroxyanilino)-quinazoline. It is a novel type of antidysrhythmic drug. It has been synthesized in 4 steps. According to our experiments, changrolin exhibited significant protective and therapeutic effects against experimental arrhythmias induced by aconitine or ouabain. It raised the electrical threshold of ventricular fibrillation. Intravenous injections in dogs and rabbits caused (i) a mild tachycardia followed by bradycardia; (ii) a prolongation of P-R interval and a widening of QRS complex in the electrocardiogram; (iii) a gradual hypotehsion; (iv) a slight weakening of cardiac functions; and (v) only moderate influences on the hearts of dogs and rabbits when the rate of infusion was less than 1 mg/min. Changrolin could be well absorbed by oral administration. Absorption appeared to be more rapid and complete by intramuscular injection. 14C-labelled changrolin was distributed mainly in the liver and the alimentary tract.

We use both eigenvalue counting techniques and CPA theory to determine the density of linearized magnon modes in 2D bond dilute magnets. The calculations are done for nearest neighbor Heisenberg ferromagnets and antiferromagnets and for the XY model. Results are obtained for 50x50 arrays with averages taken over 15 configurations. At the critical percolation concentration the distribution of the excitations on the infinite cluster varies as ϵ -λ with λ ≈ 0.32 for Heisenberg ferromagnets, λ ≈ 0.28 for the XY model and λ ≈ -0.02 for Heisenberg antiferromagnets. These results are compared with the predictions of scaling theory.