Search

Here we report the identification of a new insulin-like growth factor binding protein homologue, provisionally designated insulin-like growth factor binding related protein-4 (IGFBP-rP4). IGFBP-rP4 was found to be most closely related to IGFBP-7 with 52% amino acid homology and 43% amino acid identity, and shares a similar domain structure. Semi-quantitative RT-PCR expression analysis demonstrated a pattern of downregulation of this gene in multiple tumor samples including lung and colon cancer, compared to matched adjacent normal tissue. Western blotting revealed a protein of approximately 38kDa expressed in both the cell pellet and secreted into the supernatant of transiently transfected Cos-7 cells. Cos-7 supernatants containing IGFBP-RP4 protein were observed to suppress the growth of HeLa cells in culture compared to vector controls. IGFBP-RP4 directly transiently transfected into HeLa cells also further confirmed the growth suppressive properties of this protein. Together these data suggest that IGFBP-RP4 may be a novel putative tumor suppressor protein.

Tankyrase (TANK1) is a human telomere-associated poly(ADP-ribose) polymerase (PARP) that binds the telomere-binding protein TRF1 and increases telomere length when overexpressed. Here we report characterization of a second human tankyrase, tankyrase 2 (TANK2), which can also interact with TRF1 but has properties distinct from those of TANK1. TANK2 is encoded by a 66-kilobase pair gene (TNKS2) containing 28 exons, which express a 6.7-kilobase pair mRNA and a 1166-amino acid protein. The protein shares 85% amino acid identity with TANK1 in the ankyrin repeat, sterile alpha-motif, and PARP catalytic domains but has a unique N-terminal domain, which is conserved in the murine TNKS2 gene. TANK2 interacted with TRF1 in yeast and in vitro and localized predominantly to a perinuclear region, similar to the properties of TANK1. In contrast to TANK1, however, TANK2 caused rapid cell death when highly overexpressed. TANK2-induced death featured loss of mitochondrial membrane potential, but not PARP1 cleavage, suggesting that TANK2 kills cells by necrosis. The cell death was prevented by the PARP inhibitor 3-aminobenzamide. In vivo, TANK2 may differ from TANK1 in its intrinsic or regulated PARP activity or its substrate specificity.

Reduced replicative capacity is a consistent characteristic of cells derived from patients with Werner syndrome. This premature senescence is phenotypically similar to replicative senescence observed in normal cell strains and includes altered cell morphology and gene expression patterns. Telomeres shorten with in vitro passaging of both WRN and normal cell strains; however, the rate of shortening has been reported to be faster in WRN cell strains, and the length of telomeres in senescent WRN cells appears to be longer than that observed in normal strains, leading to the suggestion that senescence in WRN cell strains may not be exclusively associated with telomere effects. We report here that the telomere restriction fragment length in senescent WRN fibroblasts cultures is within the size range observed for normal fibroblasts strains and that the expression of a telomerase transgene in WRN cell strains results in lengthened telomeres and replicative immortalization, thus indicating that telomere effects are the predominant trigger of premature senescence in WRN cells. Microarray analyses showed that mRNA expression patterns induced in senescent WRN cells appeared similar to those in normal strains and that hTERT expression could prevent the induction of most of these genes. However, substantial differences in expression were seen in comparisons of early-passage and telomerase-immortalized derivative lines, indicating that telomerase expression does not prevent the phenotypic drift, or destabilized genotype, resulting from the WRN defect.

The lifespan of human fibroblasts and other primary cell strains can be extended by expression of the telomerase catalytic subunit (hTERT). Since replicative senescence is accompanied by substantial alterations in gene expression, we evaluated characteristics of in vitro-aged dermal fibroblast populations before and after immortalization with telomerase. The biological behavior of these populations was assessed by incorporation into reconstituted human skin. Reminiscent of skin in the elderly, we observed increased fragility and subepidermal blistering with increased passage number of dermal fibroblasts, but the expression of telomerase in late passage populations restored the normal nonblistering phenotype. DNA microarray analysis showed that senescent fibroblasts express reduced levels of collagen I and III, as well as increased levels of a series of markers associated with the destruction of dermal matrix and inflammatory processes, and that the expression of telomerase results in mRNA expression patterns that are substantially similar to early passage cells. Thus, telomerase activity not only confers replicative immortality to skin fibroblasts, but can also prevent or reverse the loss of biological function seen in senescent cell populations., (Copyright 2000 Academic Press.)

Background: Limited replicative capacity is a defining characteristic of most normal human cells and culminates in senescence, an arrested state in which cells remain viable but display an altered pattern of gene and protein expression. To survey widely the alterations in gene expression, we have developed a DNA microarray analysis system that contains genes previously reported to be involved in aging, as well as those involved in many of the major biochemical signaling pathways., Results: Senescence-associated gene expression was assessed in three cell types: dermal fibroblasts, retinal pigment epithelial cells, and vascular endothelial cells. Fibroblasts demonstrated a strong inflammatory-type response, but shared limited overlap in senescent gene expression patterns with the other two cell types. The characteristics of the senescence response were highly cell-type specific. A comparison of early- and late-passage cells stimulated with serum showed specific deficits in the early and mid G1 response of senescent cells. Several genes that are constitutively overexpressed in senescent fibroblasts are regulated during the cell cycle in early-passage cells, suggesting that senescent cells are locked in an activated state that mimics the early remodeling phase of wound repair., Conclusions: Replicative senescence triggers mRNA expression patterns that vary widely and cell lineage strongly influences these patterns. In fibroblasts, the senescent state mimics inflammatory wound repair processes and, as such, senescent cells may contribute to chronic wound pathologies.

We have identified and cloned a cDNA encoding a new member of the monooxygenase family of enzymes. This novel enzyme, which we call MOX (monooxygenase X; unknown substrate) is a clear sequence homologue of the enzyme dopamine beta-hydroxylase (DBH). MOX maintains many of the structural features of DBH, as evidenced by the retention of most of the disulfide linkages and all of the peptidyl ligands to the active site copper atoms. Unlike DBH, MOX lacks a signal peptide sequence and therefore is unlikely to be a secreted molecule. The steady-state mRNA levels of MOX are highest in the kidney, lung, and adrenal gland, indicating that the tissue distribution of MOX is broader than that of DBH. Antisera raised to a fusion protein of MOX identifies a single band of the expected mobility by Western blot analysis. MOX mRNA levels are elevated in some fibroblast cell strains at replicative senescence, through this regulation is not apparent in all primary cell strains. The gene for MOX resides on the q arm of chromosome 6 and the corresponding mouse homolog has been identified.

Eukaryotic chromosomes are capped with repetitive telomere sequences that protect the ends from damage and rearrangements. Telomere repeats are synthesized by telomerase, a ribonucleic acid (RNA)-protein complex. Here, the cloning of the RNA component of human telomerase, termed hTR, is described. The template region of hTR encompasses 11 nucleotides (5'-CUAACCCUAAC) complementary to the human telomere sequence (TTAGGG)n. Germline tissues and tumor cell lines expressed more hTR than normal somatic cells and tissues, which have no detectable telomerase activity. Human cell lines that expressed hTR mutated in the template region generated the predicted mutant telomerase activity. HeLa cells transfected with an antisense hTR lost telomeric DNA and began to die after 23 to 26 doublings. Thus, human telomerase is a critical enzyme for the long-term proliferation of immortal tumor cells.

Recently, a novel PCR-based technique, differential display (DD), has facilitated the study of differentially expressed genes at the mRNA level. We report here an improved version of DD, which we call Enhanced Differential Display (EDD). We have modified the technique to enhance reproducibility and to facilitate sequencing and cloning. Using EDD, we have generated and verified a catalog of genes that are differentially expressed between young and senescent human diploid fibroblasts (HDF). From 168 genetags that were identified initially, 84 could be sequenced directly from PCR amplified bands. These sequences represent 27 known genes and 37 novel genes. By Northern blot analysis we have confirmed the differential expression of a total of 23 genes (12 known, 11 novel), while 19 (seven known, 12 novel) did not show differential expression. Several of the known genes were previously observed by others to be differentially expressed between young and senescent fibroblasts, thereby validating the technique.

The gene encoding the human erythrocyte form of cytochrome b5 (97 residues in length) has been prepared by mutagenesis of an expression vector encoding lipase-solubilized bovine liver microsomal cytochrome b5 (93 residues in length) (Funk et al., 1990). Efficient expression of this gene in Escherichia coli has provided the first opportunity to obtain this protein in quantities sufficient for physical and functional characterization. Comparison of the erythrocytic cytochrome with the trypsin-solubilized bovine liver cytochrome b5 by potentiometric titration indicates that the principal electrostatic difference between the two proteins results from two additional His residues present in the human erythrocytic protein. The midpoint reduction potential of this protein determined by direct electrochemistry is -9 +/- 2 mV vs SHE at pH 7.0 (mu = 0.10 M, 25.0 degrees C), and this value varies with pH in a fashion that is consistent with the presence of a single ionizable group that changes pKa from 6.0 +/- 0.1 in the ferricytochrome to 6.3 +/- 0.1 in the ferrocytochrome with delta H degrees = -3.2 +/- 0.1 kcal/mol and delta S degrees = -11.5 +/- 0.3 eu (pH 7.0, mu = 0.10). The 1D 1H NMR spectrum of the erythrocytic ferricytochrome indicates that 90% of the protein binds heme in the "major" orientation and 10% of the protein binds heme in the "minor" orientation (pH 7.0, 25 degrees C) with delta H degrees = -2.9 +/- 0.3 kcal/mol and delta S degrees = -5.4 +/- 0.9 eu for this equilibrium.

The objective of this work is to determine the molecular mechanism and regulation of short-chain acyl-CoA dehydrogenase (SCAD) from Megasphaera elsdenii. To achieve this, the gene coding for SCAD from M. elsdenii was cloned and sequenced. Site-directed mutagenesis was then used to identify an amino acid residue that is required for the proposed mechanism. To clone the gene, the amino acid sequence of the 50 N-terminal residues of SCAD from M. elsdenii was determined. This sequence information was utilized to synthesize two sets of mixed oligonucleotide primers which were then used to generate a 120-bp specific probe from M. elsdenii DNA by the polymerase chain reaction (PCR) method. The 120-bp probe was used to screen a M. elsdenii genomic DNA library cloned into Escherichia coli. The gene encoding M. elsdenii SCAD was identified from this library, sequenced, and expressed. The cloned SCAD gene contained an open reading frame which revealed a high degree of sequence identity with an open reading frame protein sequence of the human SCAD and the rat medium-chain acyl-CoA dehydrogenase (MCAD) (44% and 36% identical residues in paired comparisons for human SCAD and rat MCAD, respectively). Recombinant SCAD expressed from a pUC119 vector accounted for 35% of the cytosolic protein in the Escherichia coli crude extract. The expressed protein had similar activity, redox potential properties, and nearly identical amino acid composition to native M. elsdenii SCAD. In addition, a site-directed Glu367 Gln mutant of SCAD expressed from a pUC119 vector was shown to have minimal reductive and oxidative pathway activity with butyryl-CoA and crotonyl-CoA, respectively.(ABSTRACT TRUNCATED AT 250 WORDS)

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.

Transcriptional activity of p53 was monitored by cotransfection of pCMV expression vectors containing wild-type and mutant p53 cDNAs into the p53-null H1299 lung cancer cells along with luciferase reporter plasmids containing different p53 target sequences in the 5' regulatory region: fragment A of the ribosomal gene cluster (RGC); p53 consensus sequence (p53CON); or a tandemly linked RGC+p53CON sequence. Our results show: (1) wild-type p53 stimulates the transcription of reporter genes with p53CON and RGC in their 5' region while most p53 mutants occurring in human cancers have lost this activity; (2) the R273H mutant retains transcriptional activity for the p53CON sequence but not RGC; (3) some mutants are temperature-sensitive for the transcriptional activity with the p53CON but not the RGC sequence; (4) p53 mutants vary in their ability to inhibit wild-type p53 transactivation but there is no difference between p53CON and RGC sequences; (5) lung cancer cells with endogenous mutant p53 proteins (M246I in H23 cells and R248L in H322 cells) retain transcriptional activity for the p53CON but not the RGC sequence. We conclude that p53 DNA target sequences vary in their response to mutant p53 proteins, and that p53 mutants vary in several transactivation related functions.

The coding sequence for human serum transferrin was assembled from restriction fragments derived from a full-length cDNA clone isolated from a human liver cDNA library. The assembled clone was inserted into the expression vector pNUT and stably transfected into transformed baby hamster kidney (BHK) cells, leading to secretion of up to 125 mg/L recombinant protein into the tissue culture medium. As judged by mobility on NaDodSO4-PAGE, immunoreactivity, spectral properties (indicative of correct folding and iron binding), and the ability to bind to receptors on a human cell line, initial studies showed that the recombinant transferrin, is identical to three commercial human serum transferrin samples. Electrospray mass spectrometry (ESMS), anion-exchange chromatography, and urea gel analysis showed that the recombinant protein has an extremely complex carbohydrate pattern with 16 separate masses ranging from 78,833 to 80,802 daltons. Mutation of the two asparagine carbohydrate linkage sites to aspartic acid residues led to the expression and secretion of up to 25 mg/L nonglycosylated transferrin. ESMS, anion-exchange chromatography, and urea gel analysis showed a single molecular species that was consistent with the expected theoretical mass of 75,143 daltons. In equilibrium binding experiments, the nonglycosylated mutant bound to HeLa S3 cells with the same avidity and to the same extent as the glycosylated protein and the three commercial samples. These studies demonstrate conclusively that carbohydrate has no role in this function.

Degenerate oligonucleotides and polymerase chain reaction-based reiterative selection techniques have been used to define the consensus binding sites for an increasing number of transcription factors. The use of crude nuclear extracts rather than purified proteins permits multicomponent complexes to form, and allows the technique to generate information about the combinatorial interactions involved in gene regulation.

The N-terminal lobe of recombinant human serum transferrin (residues 1 to 337) has been crystallized in a form suitable for high-resolution three-dimensional X-ray crystallographic analyses. Crystals are of the orthorhombic space group P2(1)2(1)2(1), with unit cell dimensions of a = 44.9 A, b = 57.0 A and c = 135.9 A, and diffract to beyond 2 A resolution. Further studies show that isomorphous crystals of specifically designed mutants of this protein can also be grown. Structural studies of both recombinant and mutant protein forms will provide a basis for understanding the mechanism by which human serum transferrin functions.

The finding that in many human tumors there is allelic loss and/or mutations in p53, in combination with recognition that these events may play a role in multi-stage carcinogenesis, has focused considerable interest on this gene. To help keep abreast of this rapidly expanding field, recent experiments on the role and potential regulation of p53 are described: these include discussions of p53 as an anti-proliferative agent, the p53 mutations found in human tumors and tumor cell lines, the conformational states of p53, phosphorylation of p53 by p34cdc2, and signals for the nuclear localization of p53. p53 may act as a transcriptional activator and the specific DNA sequences to which p53 protein binds are also discussed as is the importance of abrogation of p53 function in overcoming cellular senescence.

Five site-directed mutants of the N-terminal half-molecule of human serum transferrin have been expressed in baby hamster kidney cells and purified to homogeneity. Expression levels and overall yields varied considerably from the wild-type protein, depending on the mutant in question. The mutants are D63S, D63C, G65R, K206Q, and H207E and are based on mutations observed in a variety of transferrins of known sequence. Their molecular masses, determined by electrospray mass spectrometry, agree with theory, except for the D63C mutant, which appears to be cysteinylated. All mutants bind iron but with varying affinities; qualitatively, in increasing order D63S approximately D63C approximately G65R much less than wild type less than or equal to H207E much less than K206Q. In general, reduction of formal negative charge within the binding cleft shifts the visible spectral maximum of the iron complex toward the blue and reduces the affinity for iron, and increasing the formal negative charge shifts the visible maximum toward the red and increases the affinity for iron. The K206Q mutant is exceptional inasmuch as its visible maximum shows a blue shift, but its affinity for iron is the greatest of all of the mutants studied. All mutants reported, in addition to the wild-type protein, exhibit very similar visible molar extinction coefficients for the iron complex and very similar changes in extinction coefficients at 240 nm on binding Fe(III) or Ga(III). These results suggest that in all cases the bound metal ion is coordinated by two tyrosyl side chains.

The cDNA sequence of rabbit liver transferrin has been determined. The largest cDNA was 2279 base pairs (bp) in size and encoded 694 amino acids consisting of a putative 19 amino acid signal peptide and 675 amino acids of plasma transferrin. The deduced amino acid sequence of rabbit liver transferrin shares 78.5% identity with human liver transferrin and 69.1% and 44.8% identity with porcine and Xenopus transferrins, respectively. At the amino acid level, vertebrate transferrins share 26.4% identity and 56.5% similarity. The most conserved regions correspond to the iron ligands and the anion binding region. Optimal alignment of transferrin sequences required the insertion of a number of gaps in the region corresponding to the N-lobe. In addition, the N-lobes of transferrins share less amino acid sequence similarity than the C-lobes.

A family of proteins has recently been identified, each member of which has the capacity to initiate muscle differentiation in many non-muscle cell types. These factors, which include MyoD1, myogenin, myf-5 and MRF4, share homologies with each other and belong to a superfamily of Myc-related proteins. Expression of these regulatory proteins results in auto-activation and cross-activation of other members of the family and in the transcriptional activation of the markers of terminal differentiation. Sequence analysis has shown a conserved basic domain in each protein that is required for binding to specific DNA sequences of the E-box type and for myogenic activation. A conserved helix-loop-helix (HLH) domain allows homo- and heterodimerization of these muscle-specific proteins with each other and with ubiquitously expressed proteins such as the E2A gene products (E12/E47). This review describes the discovery and characterization of these muscle regulatory proteins and their actions in the context of proposed models for the determination and differentiation of muscle tissue.

Expression of the amino-terminal lobe of human serum transferrin secreted into the culture medium by transformed baby hamster kidney (BHK) cells has been increased from the levels reported originally of 10-15 micrograms/ml to 55-120 micrograms/ml. Use of the serum substitute, Ultraser G, has facilitated isolation of the recombinant protein, resulting in approximately 80% recovery of expressed hTF/2N from the culture medium. In the three experiments described, 300-750 mg of recombinant protein was collected over a period of 25 days from five expanded surface roller bottles each containing 200 ml of medium (seven to nine collections). The use of alginate beads to encapsulate the transformed BHK cells provided no advantage over normal culturing over 25 days. A lag in production resulting in 30% less recombinant protein over this time period was observed. The production and isolation procedures described are easily handled by one person. The system is amenable to incorporation of isotopically substituted amino acids useful in NMR studies.

A gene coding for lipase-solubilized bovine liver microsomal cytochrome b5 has been synthesized, expressed in Escherichia coli, and mutated at functionally critical residues. Characterization of the recombinant protein revealed that it has a reduction potential that is approximately 17 mV lower than that of authentic wild-type protein at pH 7 (25 degrees C). Structural studies determined that the recombinant protein differed in sequence from authentic wild-type cytochrome b5 owing to three errors in amidation status in the published sequence for the protein on which the gene synthesis was based. The structural origin of the lower reduction potential exhibited by the triple mutant has been investigated through X-ray crystallographic determination of the three-dimensional structure of this protein and is attributed to the presence of Asp-57 within 3.3 A of heme vinyl-4 in the mutant. In addition, the model developed by Argos and Mathews [Argos, P., & Mathews, F.S. (1975) J. Biol. Chem. 250, 747] for the change in cytochrome b5 oxidation state has been studied through mutation of Ser-64 to Ala. In this model, Ser-64 is postulated to stabilize the oxidized protein through H-bonding interactions with heme propionate-7 that orients this propionate group 6.2 A from the heme iron. Spectroelectrochemical studies of a mutant in which Ser-64 has been changed to an alanyl residue demonstrate that this protein has a reduction potential that is 7 mV lower than that of the wild-type protein; moreover, conversion of the heme propionate groups to the corresponding methyl esters increases the potential by 67 mV.(ABSTRACT TRUNCATED AT 250 WORDS)

The complex formed in solution by native and chemically modified cytochrome c with cytochrome b5 has been studied by 1H and 13C nuclear magnetic resonance spectroscopy (NMR). Contrary to predictions of recent theoretical analysis, 1H NMR spectroscopy indicates that there is no major movement of cytochrome c residue Phe82 on binding to cytochrome b5. The greater resolution provided by 13C NMR spectroscopy permits detection of small perturbations in the environments of cytochrome c residues Ile75 and Ile85 on binding with cytochrome b5, a result that is in agreement with earlier model-building experiments. As individual cytochrome c lysyl residues are resolved in the 1H NMR spectrum of N-acetimidylated cytochrome c, the interaction of this modified protein with cytochrome b5 has been studied to evaluate the number of cytochrome c lysyl residues involved in binding to cytochrome b5. The results of this experiment indicate that at least six lysyl residues are involved, two more than predicted by static model building, which indicates that cytochrome c and cytochrome b5 form two or more structurally similar 1:1 complexes in solution.

A human liver cDNA library was screened with a synthetic oligonucleotide, complementary to the 5' region of human transferrin mRNA, as a hybridization probe. The full-length human cDNA clone isolated from this screen contained part of the 5' untranslated region, the complete coding region for the signal peptide and the two lobes of transferrin, the 3' untranslated region, and a poly(A) tail. By use of oligonucleotide-directed mutagenesis in vitro, two translational stop codons and a HindIII site were introduced after the codon for Asp-337. This fragment was inserted into two different expression vectors that were then introduced into Escherichia coli. As judged by NaDodSO4-polyacrylamide gel electrophoresis and Western blot analysis, however, recombinant hTF/2N was undetectable in bacteria transformed by these plasmids. Concurrently, we developed a plasmid vector for the expression of recombinant hTF/2N in eukaryotic cells. In this case, a DNA fragment coding for the natural signal sequence, the hTF/2N lobe, and the two stop codons was cloned into the expression vector pNUT, such that the expression of hTF/2N was controlled by the mouse metallothionein promoter and the human growth hormone termination sequences. Baby hamster kidney cells containing this hTF/2N-pNUT plasmid secreted up to 20 mg of recombinant hTF/2N per liter of tissue culture medium. Recombinant hTF/2N was purified from the medium by successive chromatography steps on DEAE-Sephacel, Sephadex G-75, and FPLC on Polyanion SI. The purified protein was characterized by NaDodSO4-PAGE, urea-PAGE, amino-terminal sequence analysis, UV-visible spectroscopy, iron-binding titration, and proton NMR.(ABSTRACT TRUNCATED AT 250 WORDS)