Search

© 2018 The Authors., [Background]: The present prospective, multinational, noninterventional study aimed to document and describe real-world treatment regimens and disease progression in multiple myeloma (MM) patients. [Patients and Methods]: Adult patients initiating any new MM therapy from October 2010 to October 2012 were eligible. A multistage patient/site recruitment model was applied to minimize the selection bias; enrollment was stratified by country, region, and practice type. The patient medical and disease features, treatment history, and remission status were recorded at baseline, and prospective data on treatment, efficacy, and safety were collected electronically every 3 months., [Results]: A total of 2358 patients were enrolled. Of these patients, 775 and 1583 did and did not undergo stem cell transplantation (SCT) at any time during treatment, respectively. Of the patients in the SCT and non-SCT groups, 49%, 21%, 14%, and 15% and 57%, 20%, 12% and 10% were enrolled at treatment line 1, 2, 3, and ≥ 4, respectively. In the SCT and non-SCT groups, 45% and 54% of the patients had received bortezomib-based therapy without thalidomide/lenalidomide, 12% and 18% had received thalidomide/lenalidomide-based therapy without bortezomib, and 30% and 4% had received bortezomib plus thalidomide/lenalidomide-based therapy as frontline treatment, respectively. The corresponding proportions of SCT and non-SCT patients in lines 2, 3, and ≥ 4 were 45% and 37%, 30% and 37%, and 12% and 3%, 33% and 27%, 35% and 32%, and 8% and 2%, and 27% and 27%, 27% and 23%, and 6% and 4%, respectively. In the SCT and non-SCT patients, the overall response rate was 86% to 97% and 64% to 85% in line 1, 74% to 78% and 59% to 68% in line 2, 55% to 83% and 48% to 60% in line 3, and 49% to 65% and 36% and 45% in line 4, respectively, for regimens that included bortezomib and/or thalidomide/lenalidomide., [Conclusion]: The results of our prospective study have revealed great diversity in the treatment regimens used to manage MM in real-life practice. This diversity was linked to factors such as novel agent accessibility and evolving treatment recommendations. Our results provide insight into associated clinical benefits., Writing support during the development of our report was provided by Laura Mulcahy and Catherine Crookes of FireKite, an Ashfield company, a part of UDG Healthcare plc, which was funded by Millennium Pharmaceuticals, Inc, and Janssen Global Services, LLC. The EMMOS study was supported by research funding from Janssen Pharmaceutical NV and Millennium Pharmaceuticals, Inc.

Background and aim Tetracosactide Acetate (SR-TA) stimulates the release of corticosteroids such as cortisol from the adrenal gland. It is absorbed on to a zinc phosphate complex which ensures the sustained release of the active substance from the intramuscular injection site. SR-TA is currently used in the management of ulcerative colitis and Crohn's disease, juvenile/adult rheumatoid arthritis and osteoarthrosis. However, its properties indicate that this compound may be particularly useful in patients unable to tolerate oral glucocorticoid therapy or where normal therapeutic doses of glucocorticoids turned to be ineffective. Eltrombopag is an oral, non-peptide thrombopoietin receptor agonist that has been shown efficacy and safety in chronic immune thrombocytopenia (ITP) patients not responding to previous therapy. Based on these premises, we treated with a combination of Eltrombopag and SR-TA selected ITP patients undergoing a platelet count fluctuation despite a standard eltrombopag dose was given . Material and methods A total of 6 adult patients, female (60%),median (range) age 37 (28 - 54) years, median (range) baseline platelet count 31 (28 - 46) × 109/L, median of 3 (2 - 4) prior ITP therapies, received a combo of Eltrombopag 50 mg by mouth daily and SR-TA 1 mg intramuscularly daily until the target platelet count of 50× 109/L was reached, then a dose of 1mg of SR-TA was given every 3 days; in responding patients , i.e. without platelet count fluctuation, the dose was further reduced to 1mg per week. Results 5 out of six patients responded to treatment reaching and maintaining the platelet count between 50× 109/L and 100× 109/L. After a median follow-up of 6 months with combo treatment, all patients maintained their response. Self-administration was started by 100% of patients (6/6). No adverse events have been observed. Our experience has shown that eltrompopag/SR-TA combo is effective and safe in maintaining the platelet count above 50x109/L in those patients not reaching this target with the TPO mimetic alone. Disclosures No relevant conflicts of interest to declare.

e14566Background: CIT is provided with a platelet count < 100×109/μL with or without bleeding in cancer patients receiving chemotherapy .CIT can prevent the administration of the optimal dose and s...

In a series of 84 chronic lymphocytic leukemia (CLL) patients we sought to establish whether BAFF (B-cell activating factor of the TNF family) circulating levels correlated with clinical characteristics of disease. BAFF serum levels were significantly higher in 20 healthy controls (i.e., median 695 ng/mL, range 389-1040) in comparison to the whole population of CLL patients (median 376, range 93-8914; P

Chemotherapy-induced-thrombocytopenia (CIT) can prevent the administration of the optimal dose and schedule of anticancer treatment and limit its benefits in the adjuvant or metastatic setting. Therapeutic approaches will include dose delays or reduction ,platelet transfusion and consideration of platelet-stimulating agents. In a review of chemotherapy-induced thrombocytopenia including >47 000 patients with solid tumors, CRC was associated with the highest prevalence of thrombocytopenia by cancer type, and most patients had received a platinum-based chemotherapy regimen. Experimental data demonstrated that Platinum is one of the heavy metals which may induce immune manifestations in humans and in experimental animals. However, novel mechanisms of oxaliplatin-related thrombocytopenia have been implicated and include an immune-dependent mechanism, as well as portal hypertension related to sinusoidal injury yielding splenic sequestration of platelets. Eltrombopag is an oral, non-peptide thrombopoietin receptor agonist that has been shown efficacy and safety in chronic immune thrombocytopenia (ITP) patients not responding to previous therapy .Moreover,some clinical studies demonstrate a role for thrombopoietin agonists in improving compliance with cytotoxic regimens in cancer patients whose chemotherapy was delayed due to thrombocytopenia,[and they suggest that prophylactic use of eltrombopag or romiplostim might reduce the degree and duration of chemotherapy-induced thrombocytopenia. Here, we report on a series of 22 patients at high risk of CIT because of platinum chemotherapy schedules who received low doses eltrombopag as prophilaxis .The aim of the study was to prevent CIT in patients who cannot be supported by platelet transfusions and for whom the maintenance of dose intensity is crucial for remission or survival Methods A total of 22 consecutive adult patients, female (60 %), median age 47 years (range 28 - 67) were enrolled in the study. The reason of chemotherapy has been ovary cancer in 5 patients, colon cancer in 8 patients, relapsed DLBC lymhoma in 4 patients,, TNBC in 2 patients, pancreatic cancer in 3 pts. All patients received eltrombopag 25 mg by mouth twice a weekly as soon as the platelet count falls below 80000 mmc, and continued on treatment until completion of cycles of chemotherapy. Results The mean platelet count nadir was 60000 mmc; the number of days with platelet count < 80000/µL was 4 days; The maximum value reached was 270,000 mmc. No treatment-related toxicity was observe. 1 out of 22 pts , did not respond to the planned dose and received 50 mg for eight consecutive days before each course of chemotherapy.The principal endpoints of the study : avoid nadir platelet counts < 50,000/µL,platelet transfusions, bleeding events, chemotherapy dose reductions , chemotherapy delays. were achieved in all patients. Conclusion In our opinion low dose eltrombopag prophilaxis can be an effective and safe strategy for preventing the CIT. Disclosures No relevant conflicts of interest to declare.

e22539Background: Kaposi's sarcoma (KS) is a potentially life-threatening multifocal neoplasm that may represent a difficult therapeutic challenge in disseminated stages. Liposomal anthracyclines, or combination chemotherapy are widely used to treat this kind of patients.. The efficacy of taxanes (paclitaxel and docetaxel), as agents with antiangiogenic properties,has been described previously in the treatment of KS patients but the length of the infusion, the need for pre-medication with steroids and toxicity caused by solvents can limit their utilization , especially in elderly patients. Nab-paclitaxel has efficacy comparable with solvent-based taxanes without need for steroid premedication which can make it easier to tolerate .At the moment there are no studies on its efficacy and safety in older KS patients . Methods: After written informed consent was obtained a phase II trial was conducted with nab-paclitaxel in 6 patients with advanced-stage KS to assess its safety and antitumor activity. The mean ...

Abstract 648 Introduction: Imatinib (IM) 400mg daily is the standard treatment for chronic myeloid leukemia (CML) patients and a complete cytogenetic response (CCyR) is achieved in the majority of patients within one year of treatment. In addition, a considerable number of patients reach a major molecular response (i.e BCR-ABL/ABL ratio Results: Current interim analysis shows that vaccinations (a total of over 400 shots) were very well tolerated, with CMLVAX100-GMCSF toxicity consisting exclusively of some redness and itching at the site of injection and with only 4/43 patients (9%) experiencing a mild fever. Regarding immune response induced by vaccination, 29/43 patients (67%) showed a significant in vitro b3a2-peptide-specific CD4+ T cell proliferation. With respect to MRD response, we observed a reduction of at least 50% of pre-vaccine BCR-ABL/ABL values after 6 months of treatment (i.e. after 9 vaccinations) in 22/43 (51%) patients and the reduction was confirmed in 14/29 (48%) patients who reached the 9th month evaluation (i.e. after 10 vaccinations); 14/43(32%) patients had at least one documented undetectable transcript during this time period. In 2/43 patients we observed a significant raise of BCR-ABL transcript level, after 3 and 18 months from starting vaccinations with subsequent loss of CCyR. Conclusions: CMLVAX100 vaccine appears to induce a reduction of long lasting molecular MRD surviving IM in about half of vaccinated CML patients, thus confirming preliminary results. If this BCR-ABL-specific immune control of MRD will have a substantial impact on the rate of BCR-ABL mutations, disease evolution and ultimately survival needs longer observation time to be determined. Disclosures: Baccarani: Novartis Pharma: Consultancy, Honoraria, Research Funding, Speakers Bureau; Bristol-Mayer Squibb: Consultancy, Honoraria, Research Funding, Speakers Bureau.

Background: In the past years the bone seeking radiopharmaceutical samarium lexidronam (153Sm-EDTMP) has been increasingly used alone or in conjunction with chemotherapy and/or bisphosphonates for the treatment of painful bone metastasis. Objective: Its use has been explored in different solid tumours. In this report we explore its interesting characteristics and describe our experience in multiple myeloma (MM). Methods: 153Sm-EDTMP has an affinity for bone and concentrates in areas of bone turnover. It decays as a therapeutic β-emission and at the same time as γ-photon that can be used for tracking its concentration with bone scan imaging. Ten patients with symptomatic MM were treated to achieve pain control. Results: Encouraging results were obtained in MM patients. The use of this radioisotope could be largely improved.

Purpose Imatinib mesylate is a potent inhibitor of BCR-ABL, the constitutively active tyrosine kinase protein critical for the pathogenesis of chronic myeloid leukemia. Patients and Methods We reviewed 284 patients with late chronic-phase Philadelphia chromosome (Ph) –positive chronic myeloid leukemia treated with imatinib 400 mg daily after interferon-α failure. In a retrospective study, we evaluated the pattern and rapidity of the response to imatinib, comparing the cytogenetic and molecular responses, progression-free and overall survival rates in patients who obtained a complete cytogenetic response within 1 year of treatment (early responders), and in patients where a complete cytogenetic response was detected after 12 months (late responders). Results After 3 or 4 years of treatment, the molecular response of the late cytogenetic responders was similar to that of the early cytogenetic responders. At 36 months of treatment the amount of residual disease measured by standardized quantitative reverse-transcriptase polymerase chain reaction was 0.00047 in late responders versus 0.00022 in early responders, and at 48 months it was 0.00019 versus 0.00026 (median values, P value = nonsignificant). The estimated 4-year progression-free survival rate was 88% for early responders and 100% for late responders, while the estimated 4-year overall survival rates were 92% and 100% for early and late responders, respectively. Conclusion The sensitivity and the response (cytogenic and molecular) to imatinib may require 1 year or more. Long-term follow-up results continue to improve in terms of rates and durability of the complete cytogenetic response, major or complete molecular response, and progession-free and overall survival.

Introduction. Eltrombopag is an oral, non-peptide thrombopoietin receptor agonist that has been shown efficacy and safety in chronic immune thrombocytopenia (ITP) patients not responding to previous therapy , by raising the platelets count in both continued long-term administration and in a repeated short-term administration. However, when eltrombopag is discontinued, platelet counts usually return to baseline within 2 weeks. As reported in different case series only 15 % of patients achieve a durable response after treatment discontinuation. The aims of this study was to evaluate the efficacy and safety of eltrombopag given at a dose of 25 mg every 3 days as maintenance therapy in responding patients after an initial standard dose of 50 mg orally once daily. Methods. A total of 7 consecutive adult patients, female (70 %), median age 47 years (range 28 - 79) were enrolled in the study. Patients had ITP for a median of 3.5 years and had failed a median of four prior therapies. Splenectomy was not taken into account because contraindicated or refused. All patients received eltrombopag 50 mg by mouth once a day as induction treatment .A complete blood count was performed at baseline, on day 5, then weekly for 28 days, every 2 weeks during maintenance. Complete Response ( CR) was defined as platelet count ≥ 100 * 10^9/L measured on two occasions > 7 days apart and the absence of bleeding. Relapse Free Survival (RFS) was considered to be from the day of initial response until relapse (Plt Results. 7 out of 7 pts achieved CR after eltrombopag induction therapy and were enrolled in the study. 1 out of 7 pts was too early to be evaluated. 6 pts were eligible for the maintenance phase. The median (range) follow-up of this case series was of 13.5 months (4-22), during which all patients maintained a safe platelet count without the need to increase the dose or frequency of administration. No patient relapsed . No adverse events were observed. Conclusions. Maintenance therapy was manageable and well-tolerated. Maintenance can allow for improved health care resource allocation providing cost savings and potentially improves patients' quality of life by by reducing the need of food restriction/dairy products required when taking eltrombopag.Moreover , maintenance therapy improves adhesion to the treatment and may be an effective alternative for patients who can not discontinue the drug Disclosures Abruzzese: novartis, bristol myers squibb, ariad, pfizer, takeda: Consultancy, Membership on an entity's Board of Directors or advisory committees.

Introduction. Immune thrombocytopenia (ITP) is characterized by platelet destruction due to the presence of platelet antibodies. This phenomenon is associated with impaired platelet production by bone marrow. Short-course corticosteroids and high-dose intravenous immunoglobulins remain the first-line treatments. Aim of this study was to test if SCIG is equally effective and can be less expensive than hospital-based IVIG in treating chronic-ITP Methods Seven-ITP patients aged between 13-52 years were given liquid intravenously immunoglobulin (IVIg) stabilized with proline in a dose of 400 mg/kg per day for 5 consecutive days.The median time since ITP diagnosis was 18 months (range, 16 – 38) Median (range) baseline platelet count 19 (3 – 32) x 109/L.,median of 2 (1 – 3) prior ITP therapies. Furthermore, none of of the subjects was a good candidate for TPO-receptor agonists (romiplostim and eltrombopag) because of age or other comorbidities.6 / 6 had a good response to the first 5 day course of gammaglobulin therapy, (platelet count ≥50 × 10(9) /l and ≥2× baseline). The peak platelet count occurred within 7 days from the beginning of the therapy. Only in one patient the platelet count peak took place after 12 days. During the first year of treatment, only one of seven initial responder patients achieved CR(defined as platelet count ≥ 100 * 10^9/L measured on two occasions > 7 days apart and the absence of bleeding) and was excluded from the study. After a loading dose of 2 g/kg over 2 days of IVIg, home SCIG of 8 gr total weekly dose was started by 87,3% (6/7) to maintain platelet counts in the target range of 50–100x109/L. Results 5/6 patients reached the target. One patient achieved CR during the maintenance therapy.No untoward reactions necessitating cessation of therapy were encountered during this study. The most common side effect observed was headache. Conclusion Application of SCIG was well tolerated, easy to manage, and led to stabilization of the disease course.The therapy facilitates home therapy, as the infusion technique is easy for children, adults and elderly people to learn and there is no need for venous access. SCIG home therapy leads to significantly improved life situations for the patients; the SCIG home therapy regimen in particular reduces the costs of treatment. Overall costs per patient were strongly reduced in SCIG in comparison to IVIg.SCIG may represent an effective new therapeutic option in chronic ITP. Disclosures Abruzzese: novartis, bristol myers squibb, ariad, pfizer, takeda: Consultancy, Membership on an entity's Board of Directors or advisory committees.

Although imatinib is the standard treatment for chronic myeloid leukaemia, not all patients reach complete cytogenetic remission (CCR) and most maintain detectable disease at the molecular level. We investigated whether a vaccine targeting the BCR-ABL-derived p210 fusion protein was an active and specific immunotherapy.We recruited 16 patients who had chronic myeloid leukaemia (with the b3a2 fusion point of p210), stable residual disease, a minimum treatment of 12 months of imatinib or 24 months of interferon alfa, and no further reduction of residual disease for at least 6 months preceding enrollment. They were given six vaccinations with a peptide vaccine derived from the sequence p210-b3a2 plus molgramostim and QS-21 as adjuvants (CMLVAX100) before assessment of immunological and disease response, which included detecting amounts of b3a2 transcripts by standardised quantitative real-time reverse-transcriptase PCR.Of ten patients on imatinib, nine started CMLVAX100 having had a median of 10 months' stable cytogenetic disease (median 10% Philadelphia-chromosome-positive metaphases), whereas one started in stable CCR. All patients' cytogenetic responses improved after six vaccinations, with five reaching CCR. Notably, three of these five patients also had undetectable amounts of b3a2 transcript (BCR-ABL:beta2 microglobulin ratio0.00001). Six patients on interferon alfa treatment with a median of 17 months' stable residual disease (median 13% Philadelphia-chromosome-positive cells) were also vaccinated. All but one had improved cytogenetic responses, and two reached CCR. Overall, we recorded peptide-specific delayed-type hypersensitivity (in 11 of 16 patients), CD4 cell proliferation (13 of 14 assessed), and interferon gamma production (five of five assessed).Addition of CMLVAX100 to conventional treatment in patients with chronic myeloid leukaemia might favour further reduction of residual disease and increase the number of patients reaching a molecular response.

Abstract 50623 Background: Bone marrow karyotype in myelodysplastic syndromes (MDS) is essential to define the prognosis and to guide treatment decisions, including targeted therapies. Due to the lack of an extensive national MDS registry in Italy, epidemiological data on MDS, including cytogenetics, throughout the territory is unknown. Objective: We evaluated the incidence of cytogenetic abnormalities amongst newly diagnosed MDS patients in in 2 southern Italian regions (Calabria and Puglia). Methods: A pilot project, denominated ANDROMEDA (ANalysis of cytOgenetics alteRatiOn in the MyEloDysplAstic syndromes) was developed in 17 centers to offer a service of conventional cytogenetic analysis for all consecutive patients undergoing diagnostic evaluation for cytopenia and suspected MDS between January 1 and December 31, 2011. The study conformed to the ethical standards set out in the Declaration of Helsinki and was approved by institutional review boards at each participating center. Patients were required to provide their written informed consent. Clinical characteristics of patients and bone marrow morphology, iron staining and histology were registered. Bone marrow samples were centralized for standard cytogenetic studies and fluorescence in situ hybridization to two dedicated genetics laboratories (one for each region), blind to patients' data. Results: Two hundred and thirty-five patients were evaluated and MDS diagnosis was confirmed in 220 cases (88. 3%), according to WHO criteria. The overall incidence of clonal chromosome abnormalities detected by conventional analysis was 36. 9%. Single abnormalities included +8 (13 cases, 5. 8%), del(5q) (12 cases, 5. 4%), –Y (11 cases, 5. 0%) and del(7)/-7 (4 cases, 1. 8%). Complex karyotypes were detected in 18 (8. 1%) cases. Among all cases only 10 (4. 5%) bone marrow samples were not evaluable for cytogenetic analysis. FISH revealed additional abnormalities not identified by conventional analysis only in 3 (1. 3%) out of 72 cases. Patients were classified in WHO subtypes: 39. 2% refractory cytopenia with unilineage dysplasia (RCUD), 1. 5% refractory anemia with ring sideroblasts (RARS), 32. 5% refractory cytopenia with multilineage (RCMD), 10. 8% refractory anemia with excess of blast-1 (RAEB-1), 9. 3% refractory anemia with excess of blast-2 (RAEB-2), 4. 1% MDS with deletion 5q (MDS 5q-) and 2. 6% MDS unclassifiable (MDS-U). Conclusions: These preliminary results demonstrate that the incidence of abnormal karyotype patterns and WHO subgroups in MDS patients in Southern Italy is comparable with that described in other geographical areas. It is confirmed that conventional cytogenetic analysis is a standard in the diagnostic workup of MDS of patients with a suspected myeloid malignancy in order to identify primary abnormalities and prognostic models. Disclosures: No relevant conflicts of interest to declare.

Abstract 4665 Introduction The thrombopoietic growth factors (TGFs) are a novel class of compounds for the treatment of chronic immune thrombocytopenia (ITP). The first of these agents to receive regulatory approval, romiplostim and eltrombopag, have demonstrated impressive efficacy and tolerability in randomized controlled trials and open-label extension studies of several years duration and stand poised to revolutionize the management of ITP. Nonetheless, critical questions regarding the safety of these agents, remain partially unanswered. The aim of this report is to focus on the incidence of thrombocytosis and rebound thrombocytopenia mimicking cyclic thrombocytopenia in a series of 15 patients treated with romiplostim in a single institution. Methods 15 patients (8 M and 7 F, median age 45 years range 21–76) with chronic ITP (median onset 6 years, range 1–11), 1/15 splenectomized, plts median 2 ×109/L, (range 18–24) were treated with Romiplostim initial dose of 1 mg/kg, weekly checks, with only weekly increase of 1 mg/kg to reach a platelet count ≥ 50 × 109/L. The target platelet count range was 50 to 250 × 109/L. Twenty-two percent of patients (3/15) were receiving concurrent treatment for ITP (corticosteroids, danazol) at the time of first romiplostim dose. These medications were discontinued after platelet counts reached 50 × 109/L. Results A platelet response had been achieved by 30% of patients after the first dose and by 51% of patients after the third dose. Treatment response was observed in 100% of pts treated after 6 weeks. In three patients after the eighth week, with average values plts 120×109/l, the subsequent administration of the drug led to an increase in platelet count > 1000×109/l, with rapid fall to Conclusion According to an analysis of all patients with ITP treated with romiplostim in 4 controlled trials have been reported 3 thrombocytosis events in 271 pts (1.1%). In our series the percentage was 20% (3/15), much higher than that reported in the literature, with no thrombotic complications related. Interesting in a case CR was still maintained at 8 months of follow-up despite cessation of treatment. It would be very useful to create a network of information between users of romiplostim to evaluate on a larger series, the true incidence of thrombocytosis and any related thrombotic phenomena associated in a day by day clinical practice. Disclosures: No relevant conflicts of interest to declare.

e18556 Background: Waldenstrom macroglobulinemia (WM) is a distinct B-cell lymphoproliferative disorder characterized by lympho plasmacytic bone marrow infiltration along with an immunoglobulin M (...

Abstract 4401 Background Waldenström macroglobulinemia (WM) is a distinct B-cell lymphoproliferative disorder characterized by lymphoplasmacytic bone marrow infiltration along with an immunoglobulin M (IgM) monoclonal gammopathy. Asymptomatic patients with monoclonal IgM and without morphologic evidence of bone marrow infiltration < 10% clonal marrow cells) are classified as having IgM-MGUS.Therapy is postponed for asymptomatic patients, and progressive anemia is the most common indication for initiation of treatment. Resveratrol (3,4',5-tri-hydroxy-trans-stilbene) is an antioxidant constituent of a wide variety of plant species including grapes. It has gained considerable attention because of its anticancer properties, as shown in solid and hematologic malignancies. Published data show that resveratrol has significant antitumor activity in WM cells line. Moreover, simvastatin, a 3-hydroxy-3-methyl-glutaryl-CoA reductase inhibitor, induced inhibition of proliferation, cytotoxic effect and apoptosis in IgM secreting cell lines as well as in primary CD19(+) WM cells. With this background we have treated 4 patients with asymptomatic WM with an association of simvastatin and resveratrol to test the efficacy of such of drugs in asymptomatic Waldenstrom macroglobulinemia Methods 4 pts (3 males and 1 female), median age 42,3 yrs (range, 42–73) and asymptomatic WM were treated with a schedule containing resveratrol 40 mg/die and simvastatin 20 mg/die for at least 90 days. At enrollment patients characteristic were hemoglobin level median, 12.1 g/dL,serum beta(2)-microglobulin level median, 2.4 mg/L, and IgM peaks median, 1.8 g/dL. All patients have taken regularly the drugs and there have been no adverse events.CK and LDH serum levels were kept in the normal range. Results In all IgM-MGUS patients a reduction of more than 50% of the IgM peak was observed after 3 months of therapy and it was still maintained at 12 months of follow-up. In SWM patient the reduction was about 25% and it was manteined over time. Striking, another patient with Waldentrom disease resistant to the previous therapy with EDX and anti-CD20 MoAb achieved a CR only after adding resveratrol and simvastatin. Conclusions Our data demonstrate clearly that the association between resveratrol with simvastatin decreases IgM secretion in Waldenstrom macroglobulinaemia and can be useful in asymptomatic or low risk patients not having any adverse effects. Disclosures: Off Label Use: Simvastatin showed in vitro activity on waldentrom cell lines Resveratrol showed in vitro activity on waldenstro cell lines.

Background: Dasatinib (SPRYCEL®, formerly BMS-354825) is a novel, oral, multitargeted kinase inhibitor of BCR-ABL, SRC, and other kinases that is approximately 300 times more potent than Imatinib in vitro. Dasatinib has been shown to be effective and safe in pts with CML resistant or intolerant to Imatinib, As might be expected, older patients experienced more adverse events, both hematologic and non-hematologic with the standard dosage of 100 mg once daily. Data regarding tolerability in elderly pts are scanty The aim of this study is to test if escalated dasatinib dose up to 60 mg once daily is as effective as standard dose of 100 mg QD with a better toxicity profile in elderly patients with chronic myeloid leukemia in late chronic phase resistant to or intolerant of Imatinib. Patients and Methods: As of July 2007, 4 eligible patients have been enrolled and treated :4F ; median age 77 y [range 73–82]; 1 imatinib-resistant, 3 imatinib-intolerant). Dasatinib was given at 20 mg once daily (QD) starting dose with dose escalation to 40 mg QD or 60 mg QD in pts tolerant or lacking response. Complete blood counts were obtained weekly for the first 12 weeks; bone marrow cytology and cytogenetics every 1 months, and molecular monitoring of BCR-ABL transcript levels by real-time qPCR every 12 weeks. The primary endpoint was toxicity. Median time from diagnosis of CML was 62 months (range 36 – 88). Prior therapy included interferon-alpha in 1/4. 50 percent of pts had 400 mg of prior imatinib. 25% had 600 mg. 100 % of pts received imatinib for >3 yrs. Best response to prior imatinib therapy was a CHR in 100, and partial (PCyR) cytogenetic responses in 75 % of pts. No BCR-ABL baseline mutations were found. Results: The analyses with a median follow-up of 12 months (7–12) months show hematologic toxicity (grade 3 thrombocytopenia and leukopenia) at 60 mg OD in 2 out 4 pts. Dose interruptions occurred in 1/4 pts at 60 mg One pts was intolerant to dasatinib and switched to HU Patients received an average daily dose of 40 mg/day (range 20–60 mg). Non-hematologic toxicity consisted mainly of grade 1 diarrhea, headache 2 patients experienced grade II muscolo-skeletal toxicity and fatigue at 60 mg/day.) 100% pts had a CHR, and 50% a PCyR. Conclusions: Dasatinib demonstrated substantial hematologic activity in elderly patients with late CP-CML. Despite the maximum dose reached was 60 mg QD only the 75% of pts were able to continued the treatment. because of toxicity. The novel TKIs therapies constitute an important therapeutic challenge in this particularly subset of patients when compared with younger patients

Introduction: Chronic myeloid leukaemia (CML) is a myeloid neoplasm defined by the Bcr/Abl oncoprotein that is considered essential for leukaemogenesis and accumulation of neoplastic cells. Evidence exists showing that extracts of antichoke Cynara cardunculus L. (CCE) are able to inhibit cancer cell growth in vitro (1). In the present study we have investigated the antiproliferative effect of methanolic extract of CEE on K562 Bcr-Abl positive leukemia cell line. In addition we evaluated whether the extract of CEE also affects the mRNA levels of Bcr-Abl and p210 expression in this cell line. Materials and Methods: Preparation of methanolic extract of CEE. The aerial parts of CEE were air dried until dryness at room temperature, cut into small pieces and then extracted with methanol through maceration (48 h for 3 times). The resultant total extracts were dried under reduced pressure and their weight was determined. Cell culture. The K562 cells were grown in RPMI 1640 with L-glutamine supplemented with 10% (v/v) heat-inactivated FBS, 1% penicillin/streptomycin in humidified atmosphere of 5% CO2 at 37°C. In all experiments growing cells at optimal concentration were placed in 24 or 96 well plate and then treated with vehicle or 5–100–200 μg/ml methanolic extract of CEE. 48h after the treatment cultures were tested for proliferative activity, mRNA level of Bcr-Abl by RT-PCR and p210 protein expression by western blotting analysis. Proliferative activity. Proliferative activity was determined using the MTT technique according to the method described by Tubaro et al. (1996). The assay was performed in triplicate and absorbance values at 550 nm were measured using a microplate reader. RT-PCR Analysis. The total cellular mRNA was isolated from treated and control cells using an silica coloumns. Using equal amounts of the RNA from each sample, the cDNA was synthesized by Superscript VILO™ cDNA kit. PCR was performed using Platinum® Taq DNA polymerase and specific primers for t(9;22) p210 transcripts (b3a2): GAAGTGTTTCAGAAGCTTTCC (sense) and GTTTGGGCT-TCACACCATTCC (antisense). 35 amplification cycles were performed at 94°C for 30s, 55°C for 30s and 72°C for 1min. Gel electrophoresis and ethidium bromide staining was used to visualize the PCR products. Western Blot Analysis. Cell pellets from control and treated cultures were lysed using lysis buffer with protease and phosphatase inhibitors. The proteins were then quantified and equal amounts (30 ug) were separated by SDS-PAGE and electro-blotted to nitrocellulose. After blocking procedure the blots were incubated with specific primary antibody against p210 protein and then challenged with specific horseradish peroxidase-conjugated secondary antibody. The reactive protein was visualized using an enhanced chemiluminescence detection system. Results: The results have shown that treatment of K562 cell line with methanolic extract of CEE reduced cell viability in a dose-dependent fashion (IC50=41.7 μg/ml) as demonstrated by MTT assay. PCR and Western blot analysis revealed that the cell growth inhibition was associated to a dramatic decrease of mRNA levels of Bcr-Abl and to a significant reduction of p210 protein expression suggesting that the antiproliferative effect of methanolic extract of CEE likely due to the inhibition at transcriptional level of Bcr-Abl oncoprotein. Further studies are needed to better elucidate this mechanisms and to identify the compound of crude extract which is responsible of cancer growth suppression.

Background: The management of AIHA, based mainly on empirical data and uncontrolled studies, relies principally on corticosteroids as a first-line therapy. Patients who are refractory or intolerant to these therapies (approximately 5–10% of the cases) constitute an important therapeutic challenge. The most frequent second-line options are splenectomy or immunosuppressive agents. Rituximab (R), an anti-CD20 chimeric monoclonal antibody being increasingly used in autoimmune disorders. Transfusion in patients with autoimmune hemolytic anemia generally is unwise, because the autoantibody in the serum usually reacts with the RBCs of all potential donors, making a satisfactory cross match impossible. Moreover, the erythroid response, can be inappropriately low, and several reports or senies’ have highlighted cases that have been associated with reticulocytopenia. Aim of this study is to test if the introduction of Rh-Epo in the refractory AIHA treatment may reduce the blood transfusion need and related risks Methods: 14 pts (M 7, F 7) median age 59.2 yr (range, 18–82) and AIHA resistant to standard treatment were treated with a schedule containing Rituximab, rh-EPO and prednisone (R-EP) 6 pts were idiopathic and the remaining 8 were associated with chronic lymphoproliferative syndromes (3), connective tissue diseases (2), primary antiphospholipid syndrome (APS)(1) and ulcerative colitis (2). mean Hb value and Ht at presentation were 6.3 g/dL ± 1.2, and 24 mL/dL, Median reticulocyte percentage was 9%, and median reticulocyte production index was 2.8 times basal. 24 % of cases had an initial reticulocyte count less than 4%, and 40% had an initial reticulocyte production index less than 2.0 times basal. These reticulocytopenic patients were prevalent in secondary cases. Serum erythropoietin level at baseline was (14 +/− 11 mU/mL)) Pts had altered hemolysis markers and direct antiglobulin test (DAT) was positive for both complement and IgG (IgA 1 pts). All cases had a bone marrow examination during hospitalization Erythroid hypoplasia was seen only in CLL pts.14/14 pts had serial reticulocyte measurements, Rituximab was administered intravenously at a dose of 375mg/m2 weekly for 4 weeks; prednisone 1 mg/Kg/day /for 30 days ; rh-EPO 30.000U/weekly for 4 weeks. Results: All pts completed treatment. No major infusion related side effects to R-EP were observed. Response criteria to R-EP were defined as follows: Complete Response (CR): Hb >10 g/dl or Hb increase >1.5 g/dl, resolution of symptoms of anemia, transfusion independent; Partial Response (PR): Hb > 9 g/dl or Hb increase of 1–1.5 g/dl. improvement in symptoms of anemia, transfusion independent; NR (failure to meet CR/PR). 100% were eligible for response. Responses were seen in 14/14 pts. CR in 13/14 and PR in 1/14, median follow up of 25.8 months (range 5–66 months). At the end of treatment DAT became negative in 12/14 pts, concentration of lactic dehydrogenase, total bilirubin and indirect bilirubin began to decrease at 12 days after the first dose of rituximab, and decreased to normal range after 22 days.. Three patients required packed red cell transfusions before starting R-EP and all became transfusion-free. A moderate hemolysis still persisted only in one patient. In the cases that were initially reticulocytopenic, reticulocyte production index rapidly increased, indicating a marrow erythropoietic response to REP Conclusion: Our experience demonstrates that R-EP is an effective and safe alternative for the treatment of refractory autoimmune hemolytic anemia. Awareness of the frequency of an initial reticulocytopenia in cases of autoimmune hemolysis may be important in initial diagnosis and treatment, because low reticulocyte production index may represent a lag in marrow responsiveness to hemolytic stress. Striking, the introduction of rh-Epo clearly avoids blood transfusions and overcame inappropriately low erythroid response in reticulocytopenic patients

18007 Background: Recently published data suggest that high doses of imatinib mesylate (IHD) (800 mg/daily) may be more effective than standard dose (400 mg/daily) in newly diagnosed Philadelphia c...

Background Recently published data suggest that high doses of imatinib mesylate (IHD) (800 mg/daily) may be more effective than standard dose (400 mg/daily) in newly diagnosed Philadelphia chromosome-positive chronic phase CML. Furthermore escalating the dose of imatinib to 800 mg per day can overcome some cases of resistance to imatinib but tolerability of high-dose imatinib continues to be an issue. Aims To evaluate the efficacy and safety of pregabalin dosed twice daily (BID) for relief of musculoskletal and neuropathic pain associated with IHD. Methods 13 patients in chronic phase (CP) were enrolled because complained of severe, persistent pain, requiring nonoppioid analgesics. Patients were asked to quantify their pain using a visual analogue scale (VAS) (numeric range 0–10). QoL assessment was based on Therapy Impact Questionnaire. At baseline, the median pain-rate was 5 (range 3–8). Pts received pregabalin in doses ranging from 75 to 300 mg twice daily for 12 weeks. Results Despite a short study duration, a significant reduction was seen in weekly pain score (p < 0.0001), as well as VAS score (p < 0.0001) allowed pts to receive the scheduled dose of imatinib. Pregabalin was well tolerated, and the most common adverse event was only somnolence. The short study duration precluded the assessment of longer term safety issues such as weight gain. Conclusions Pregabalin was safe and effective in decreasing pain associated with high dose of imatinib, and also improved mood, sleep disturbance, and quality of life.

8115 Background: Bisphosphonates are commonly used for metastatic bone disease in order to prevent skeletal-related events, to reduce bone pain and to improve quality of life. Zoledronic acid is commonly used in myeloma patients (pts), but additional studies are needed to determine the optimal timing, schedule and duration of treatment. Aim of the present study is to assess bone mineral density (BMD) in patients with high-risk MGUS and myeloma receiving zoledronic acid, using quantitative ultrasound analysis in transmission through phalanges. Methods: DBM Sonic Bone Profiler is the only ultrasound device that applies the method of signal analysis in transmission through phalanges. This technique has proven to be particularly effective in the diagnosis and treatment monitoring of post-menopausal osteoporosis. Measurements of BMD were performed by ultrasonography at distal metaphysis of the first phalanx of the II, III, IV and V hand finger, at baseline and at 1, 3, 6, 9, 12, 15 and 18 months. Results: 12 pts with high-risk MGUS (8 IgG k, 4 IgG lambda) and 4 pts with myeloma IIIA (3 IgG k, 1 IgA lambda), 6 males/ 10 females, median age 69 years, received zoledronic acid 4 mg intravenously every 4 weeks for at least 12 courses. All subjects took daily oral supplements containing elemental calcium (1 g) and vitamin D (400 IU). Myeloma patients also received chemotherapy. 4/6 males (66%) and 5/10 females (50%) improved amplitude-dependent speed of sound (AD-SoS) over the least significant change after 6 months. Mean difference from baseline value of AD-SoS shows a trend after 4 months of treatment, and became significant after 16 months (p No significant financial relationships to disclose.

MMM is a chronic myeloproliferative disorder accompanied by an intense bone marrow stromal reaction that includes collagen fibrosis, osteosclerosis, and angiogenesis. The molecular pathogenesis of MMM has not been fully characterized despite the recent discovery of an activating JAK2 mutation (JAK2V617F) in approximately half of the patients. Conventional drug therapy in MMM not improves survival and is used for palliative purposes only. Myocet™ is a proprietary liposomal formulation of doxorubicin designed to enhance delivery of the drug to tumor cells and reduce side effects while maintaining equivalent anti-tumor efficacy. Moreover liposomes are avidly removed from circulation by the macrophages of the RES or MPS and are taken up in the spleen, liver and bone marrow were show both a cytotoxic and anti-angiogenic activity We thus designed a phase II study for patients with primary MMM. The treatment program consisted of 25 mg total dose of Myocet™ given I.V. every two weeks for six months. Study eligibility criteria included a histologically confirmed diagnosis of MMM, platelet count ≥ 100 × 109/L, and neutrophil count ≥ 1 × 109/L, PS ≤ 2, LVEF > 50%, normal liver and renal function. 8 patients (median age, 66 years; range, 60–73) were enrolled to the trial. Median duration of disease prior to protocol treatment was 45 months (range, 24–144). All pts (100%) had received prior therapy for MMM, including thalidomide 3 (37%), hydroxyurea 8 (100%), interferon 2 (25%)), anagrelide 2 (25%), and erythropoietin 8 (100%). 3 patients (37%) were RBC transfusion-dependent and 1 had severe constitutional symptoms (night sweats or disease related fever). Baseline median (range) values for palpable spleen size, leukocyte count, platelet count, CD34 cell count, and serum lactate dehydrogenase (LDH) were 10 cm BCM (median, range 6 to 30), 8.5 × 109/L (3–36.2), 250 × 109/L (160–950), 151.1 × 106/L (1.9–356), and 680 U/L (316–868), respectively. 8/8 pts had JAK2 V617F mutation. In addition, pre-treatment and post-treatment quantitative assessment by real-time quantitative polymerase chain reaction (RQ-PCR) of WT1 transcripts in the peripheral blood were performed and the values were expressed as WT1 copies every 104 copies of ABL. 7/8 pts are evaluable for response and toxicity (i.e., received six months of therapy) 1 pt discontinued because of progression. Clinico-hematologic responses have been observed in 7/7 (100%) pts and were evaluated according to European Myelofibrosis Network criteria These include 1 CR, 5 Major Response,1 Minor Response 1 of 3 transfusion-dependent pts have become transfusion independent. The median time to response was 12 weeks (range, 4 to 18). Therapy has been well tolerated. Only a Grade 3 thrombocytopenia was seen. Striking WT1 gene expression levels in samples that were obtained after treatment were found to be significantly lower (median 480 range 210–520) than those before (median 1000, range 560–1230) (P < .0001, Mann-Whitney U test) The median post-treatment follow up at the time of this writing was 10 months (range 8–13) We conclude that Myocet has clinical activity in a subset of patients with myelofibrosis with an acceptable toxicity profile.

6593 Background: MMM is a chronic myeloproliferative disorder with bone marrow fibrosis, hepato-splenomegaly, extramedullary hematopoiesis,increase angiogenesis both in bone marrow and spleen. Myocet is a proprietary liposomal formulation of doxorubicin designed to enhance delivery of the drug to tumor cells and reduce side effects while maintaining equivalent anti-tumor efficacy. Liposomes are avidly removed from circulation by the macrophages of the RES or MPS and are taken up in the spleen, liver and bone marrow were show both a cytotoxic and antiangiogenic activity. Methods: We thus designed a phase II study for pts with MMM. The treatment program consisted of 25 mg total dose of Myocet given I.V. every two weeks for six months. Eligibility criteria included a histologically confirmed diagnosis, platelets ≥ 100 × 109/L, neutrophils ≥ 1 × 109/L, PS ≤ 2, LVEF > 45%, normal liver and renal function. Eight patients (median age, 66 years; range, 60–73) were enrolled to the trial. Median duration of disease prior to protocol treatment was 45 months (range, 24–144). All pts had received prior therapy for MMM, including thalidomide (37%) hydroxyurea (100%), interferon (25%), anagrelide (25%), erythropoietin (100%). 3 pts were RBC transfusion-dependent and 1 had severe constitutional symptoms. Baseline median (range) values for palpable spleen size, leukocyte count, platelet count, CD34 cell count, and serum lactate dehydrogenase (LDH) were: 10cm BCM (median, range 6 to 30), 8.5 × 109/L (3–36.2), 250 × 109/L (160–950), 151.1 × 106/L (1.9–3568), and 680 U/L (316–868), respectively. 8/8 pts had JAK2 V617F mutation. Results: 7/8 pts are evaluable (i.e., received six months of therapy), 1 pt discontinued for progression. Clinico-hematologic responses have been observed in 7/7 (100%) pts and were evaluated according to European Myelofibrosis Network criteria. These include CR in 1 pt, major response in 5/7 pts, minor response in one. The median time to response was 12 weeks (range, 4 to 18). Therapy has been well tolerated. Only a Grade 3 thrombocytopenia was seen. Conclusions: We conclude that Myocet has clinical activity in a subset of patients with myelofibrosis with an acceptable toxicity profile. No significant financial relationships to disclose.

Recently, a JAK2V617F mutation has been described in the majority of patients with polycythemia vera (PV), and in a subset of patients with essential thromocythemia (ET) and idiopathic myelofibrosis (IMF). Similarly, PRV-1 has been found overexpressed in many of these patients. The aim of the study was to correlate PRV-1 and WT1 expression with the presence of JAK2 mutation in order to establish whether these markers identify the same subset of patients. Using a Real Time PCR we studied the expression level of PRV1 and WT1 in 330 patients including 26 IMF, 156 PV, 122 ET, 16 HES. 10 familiar forms of PV were included. In addition a control group of 50 healthy subject and 60 reactive conditions were studied All the patients were analyzed for the presence of JAK2 mutation using the ABI Prims 3100 genetic analyzer. We found that JAK2 mutation was present in 50 % of IMF, 93% of PV and 55% of ET and 6% of HES. PRV-1 was increased in 84% of IMF, 98% of PV and 90% of ET and it was not increased in HES. WT1 was increased in 99% of IMF, 45% of PV and 42% of ET and 100% of HES. No mutations of JAK2 were detected in normal subjects or in reactive conditions. Both WT1 and PRV1 were expressed at low levels in normal subject (for PRV1 the mean value of 2-Delta Delta Ct was 2,05; range 0,05–5,46; for WT1 mean value WT1 copies/104 ABL copies of 4; range 0–20). The mean value of WT1 copies/104 ABL copies in IMF was 306 (p=0,00004 compared to normal controls), in PV was 156 (p=0,0001), in ET was 202 (p=0,0002) and in HES was 161 (p=0,0004). PRV1 mean value in IMF was 144 expressed as 2−Delta Delta Ct, and it was 423 in PV and 290 in ET. Moreover the correlation between the three markers allowed to establish that both WT1 and PRV1 were higher in JAK2 mutated samples when compared to wild type JAK2 with a p value of 0,001 for WT1 and 0,004 for PRV1. In spite of these we were able to identify a subset of patients affected by IFM characterized by increased values of PRV1 and WT1 but not by JAK2 mutation (34%) and a small subset 15% characterized only by WT1 overexpression. Only 5% of PV and 35% of ET patients expressed only PRV-1 but not JAK2 mutation and WT1 expression. HES patients overexpressed WT1 but not PRV1 and only one patient presented the JAK2 mutation. Finally 10 patients affected by familiar form of PV were studied. All the subjects showed normal PRV-1 expression but high level of WT1 transcript and 9 out of 10 presented the JAK2 mutation. This study demonstrates that the combination of all these markers is probably useful for a correct diagnosis of these patients but further studies are required to stratify these patients and to better classify them according to the presence of molecular lesions.

WT1 is a tumor-suppressor gene coding for a zinc-finger transcription factor located on chromosome 11p13, which was originally identified for its involvement in the pathogenesis of the Wilms’ tumor. In normal bone marrow and peripheral blood(PB)WT1 expression is extremely low and often undetectable even by RT-PCR. By contrast WT1 expression has been previously reported to be increased in MDS, AML, ALL and PNH. In CMPDs, little data are available only in CML. With this background we analyze by RQ-PCR the WT1 transcript amount in 13 patients with myelofibrosis with myeloid metaplasia (MMM) in comparison with a group of 32 age- and sex-matched healthy controls. All measurements were carried out only on PB and performed as previous published. All MMM patients were under cytoreductive treatment and at different time from diagnosis ( range 1 – 7 yrs). In MMM WT1 transcript amount is consistently higher (range 23–2518 WT1 copies/104 ABL copies, mean 382±692) than controls ( range 0 – 22, mean 5,6 ± 5,87) ( P < 0.0001 Mann-Whitney U test). To assess the significance of the WT1 expression as a marker for disease features, the following variables were analyzed and compared : age, hemoglobin level, white blood cell count, circulating blasts, LDH serum levels, number of peripheral CD 34 cells, Dupriez score and, according to Barosi published data, myeloproliferation index, myelodepletion index, severity score. We did not found any significant correlation between WT1 and all these variables, probably because the patients were studied during the course of their disease. Moreover, cytoreductive treatment might have modified the disease characteristics. Stricking, when analyzed WT1 expression according to the therapeutic need, we found a subset of patients with a WT1 overexpression ( range 132–2518, mean 758±911; p 1,5 gr/daily of hydroxyurea or more than 1 drug. In such of patients WT1 over-expression allowed an almost complete discrimination between MMM in stable phase and MMM with “high metaplastic index”. In conclusion, our results, although based on a relatively small number of patients, provide an interesting profile of WT1 expression in MMM. The possible clinico-therapeutic implications of these observations are worthy of investigation in well-designed studies.

Carbonic anhydrase family (CAs) plays an important role in the extracellular acidification and several studies suggest a possible involvement of such enzymes in the increased tumor progression due to the acidic extracellular pH. We measured the activities of carbonic anhydrase I and II isoforms in a group of patients affected by four specific chronic haematological diseases, sharing a common origin but characterized by a different neoplastic evolution: agnogenic myeloid metaplasia (AMM), essential thrombocythemia (ET), chronic myeloid leukemia (CML) and polycythemia vera (PV) in order to understand the correlation between CAs activities and neoplastic outcome. In comparison to controls, our data demonstrate an increase of CAI and CAII activities in all our patients with a specific increase of the CAI activity in the group of the diseases with major malignancy (CML and AMM). These results suggest a possible role of such isozymes in the progression of the myeloid disorders and CAs specific inhibitors should be useful in slowing the progression of the disease.

In 2004, we reported the short-term results of a multicentric, phase 2 study of imatinib 400 mg daily and pegylated interferon-alpha in the treatment of 76 early chronic phase Philadelphia-positive chronic myeloid leukemia patients. In this report, we update the results with an observation time of five years. After two years of treatment, all but 10 patients (13%) had discontinued pegylated interferon-alpha. The complete cytogenetic response rate at five years was 87%, and 94% of complete cytogenetic responders maintained the complete cytogenetic response after five years. All but one complete cytogenetic response also achieved a major molecular response. These data confirm the excellent response to imatinib front-line and the stability of the complete cytogenetic response. Any possible additional benefit of the combination with interferon-alpha remains uncertain, due to low patient compliance.