Search

Abstract The antiferroelectric-ferroelectric phase transition is a basic principle that holds promise for antiferroelectric ceramics in high capacitance density nonlinear capacitors. So far, the property optimization based on antiferroelectric-ferroelectric transition is solely undertaken by chemical composition tailoring. Alternately, here we propose a phase transition engineering tactic by applying pulsed electric stimulus near the critical electric field, which finally results in ~54.3% enhancement and quick stabilization of capacitance density in Pb0.97La0.02(Zr0.35Sn0.55Ti0.10)O3 antiferroelectric ceramics. Ex-situ and in-situ structural characterizations show that electric stimuli can induce the charming successive structural evolution, including domain evolution from multidomain to monodomain state, and modulation period change from 7.49 to 7.73. Structure-property correlation indicates that the antiferroelectric-ferroelectric phase transition engineering mainly stems from the unexpected irreversible recovery of the modulated structures. The present findings would deepen the understanding of the structural phase transition and provoke composition-independent post-treatment property innovation in the incommensurate antiferroelectric materials and devices.

Abstract Intermetallic compounds (IMCs) with ordered atomic structure have gained great attention as nanocatalysts for its enhanced activity and stability. Although the reliance of IMC preparation on high-temperature annealing is well known, a comprehensive understanding of the formation mechanisms of IMCs in this process is currently lacking. Here, we employ aberration-corrected high-angle annular dark-field scanning transmission electron microscopy (AC-HAADF-STEM) to track the formation process of IMCs on carbon supports during in-situ annealing, by taking PtFe as a case study within an industry-relevant impregnation synthesis framework. We directly discern five different stages at the atomic level: initial atomic precursors; Pt cluster formation; Pt-Fe disordered alloying; structurally ordered Pt3Fe formation, and final Pt3Fe-PtFe IMC conversion. In particular, we find that the crucial role of high-temperature annealing resides in facilitating the diffusion of Fe towards Pt, enabling the creation of alloys with the targeted stoichiometric ratio, which in turn provides the thermodynamic driving force for the disorder-to-order transition.

Abstract Dielectric ceramic capacitors with ultrahigh power densities are fundamental to modern electrical devices. Nonetheless, the poor energy density confined to the low breakdown strength is a long-standing bottleneck in developing desirable dielectric materials for practical applications. In this instance, we present a high-entropy tungsten bronze-type relaxor ferroelectric achieved through an equimolar-ratio element design, which realizes a giant recoverable energy density of 11.0 J·cm−3 and a high efficiency of 81.9%. Moreover, the atomic-scale microstructural study confirms that the excellent comprehensive energy storage performance is attributed to the increased atomic-scale compositional heterogeneity from high configuration entropy, which modulates the relaxor features as well as induces lattice distortion, resulting in reduced polarization hysteresis and enhanced breakdown endurance. This study provides evidence that developing high-entropy relaxor ferroelectric material via equimolar-ratio element design is an effective strategy for achieving ultrahigh energy storage characteristics. Our results also uncover the immense potential of tetragonal tungsten bronze-type materials for advanced energy storage applications.

Abstract The Golden2-like (GLK) transcription factor family is a significant group of transcription factors in plantae. The currently available studies have shown that GLK transcription factors have been studied mainly in chloroplast growth and development, with fewer studies in abiotic stress regulation. In this study, all tea plant GLK transcription factors were identified for the first time in tea plants, and genome-wide identification, phylogenetic analysis, and thematic characterization were performed to identify 66 GLK transcription factors in tea plants. These genes are categorized into seven groups, and an amino acid sequence comparison analysis is performed. This study revealed that the structure of GLK genes in tea plants is highly conserved and that these genes are distributed across 14 chromosomes. Collinearity analysis revealed 17 pairs of genes with fragment duplications and one pair of genes with tandem duplications, and the analysis of Ka/Ks ratios indicated that most of the genes underwent negative purifying selection. Analysis of promoter cis-elements revealed that the promoters of tea plant GLK genes contain a large number of cis-acting elements related to phytohormones and stress tolerance. In addition, a large number of genes contain LTR elements, suggesting that tea plant GLK genes are involved in low-temperature stress. qRT‒PCR analysis revealed that the expression of CsGLK17, CsGLK38, CsGLK54, CsGLK11 and CsGLK60 significantly increased and that the expression of CsGLK7 and CsGLK13 decreased in response to low-temperature induction. Taken together, the results of the transcription profile analysis suggested that CsGLK54 may play an important regulatory role under low-temperature stress. The subcellular localization of CsGLK54 was in the nucleus. Furthermore, CsGLK54 positively regulated the transcription levels of the NbPOD and NbSOD genes under low-temperature stress, which led to an increase in POD and SOD enzyme activities and a decrease in MDA content. These findings provide valuable insights into the regulatory mechanism of low-temperature stress in tea plants.

Abstract L-type calcium channels (LTCCs), the largest subfamily of voltage-gated calcium channels (VGCCs), are the main channels for Ca2+ influx during extracellular excitation. LTCCs are widely present in excitable cells, especially cardiac and cardiovascular smooth muscle cells, and participate in various Ca2+-dependent processes. LTCCs have been considered as worthy drug target for cardiovascular, neurological and psychological diseases for decades. Natural products from Traditional Chinese medicine (TCM) have shown the potential as new drugs for the treatment of LTCCs related diseases. In this review, the basic structure, function of LTCCs, and the related human diseases caused by structural or functional abnormalities of LTCCs, and the natural LTCCs antagonist and their potential usages were summarized.

Abstract Background the AMORAL model emphasizes the close connection of individuals’ belief system and malevolent creativity. Belief in a just world theory (BJW) states that people have a basic need to believe that the world they live in is just, and everyone gets what they deserve. Therefore, justice matters to all people. Justice sensitivity, as one of individual trait, has been found associated with negative goals. However, relevant studies have not tested whether justice sensitivity can affect malevolent creativity and its psychological mechanisms. Additionally, researchers have found that both anger and emotion regulation linked with justice sensitivity and malevolent creativity, but their contribution to the relationship between justice sensitivity and malevolent creativity remained unclear. The current study aims to explore the influence of justice sensitivity on malevolent creativity, the mediating effect of trait anger/state anger on the relationship between justice sensitivity and malevolent creativity, and the moderating effect of emotion regulation on this mediating effect. Methods A moderated mediating model was constructed to test the relationship between justice sensitivity and malevolent creativity. A sample of 395 Chinese college students were enrolled to complete the questionnaire survey. Results Justice sensitivity positively correlated with malevolent creativity, both trait anger and state anger partly mediated the connection between justice sensitivity and malevolent creativity. Moreover, emotion regulation moderated the indirect effect of the mediation model. The indirect effect of justice sensitivity on malevolent creativity through trait anger/state anger increased as the level of emotion regulation increased. The results indicated that justice sensitivity can affect malevolent creativity directly and indirectly through the anger. The level of emotion regulation differentiated the indirect paths of justice sensitivity on malevolent creativity. Conclusions Justice sensitivity and malevolent creativity was mediated by trait anger/state anger. The higher sensitivity to justice, the higher level of trait anger/state anger, which in turn boosted the tendency of malevolent creativity. This indirect connection was moderated by emotion regulation, individuals with high emotion regulation are better able to buffer anger from justice sensitivity.

Abstract PbZrO3 has been broadly considered as a prototypical antiferroelectric material for high-power energy storage. A recent theoretical study suggests that the ground state of PbZrO3 is threefold-modulated ferrielectric, which challenges the generally accepted antiferroelectric configuration. However, such a novel ferrielectric phase was predicted only to be accessible at low temperatures. Here, we successfully achieve the room-temperature construction of the strongly competing ferrielectric and antiferroelectric state by strain-mediated phase separation in PbZrO3/SrTiO3 thin film. We demonstrate that the phase separation occurs spontaneously in quasi-periodic stripe-like patterns under a compressive misfit strain and can be tailored by varying the film thickness. The ferrielectric phase strikingly exhibitsa threefold modulation period with a nearly up-up-down configuration, which could be stabilized and manipulated by the formation and evolution of interfacial defects under applied strain. The present results construct a fertile ground for further exploring the physical properties and applications based on the novel ferrielectric phase.

Background: Coronary heart disease (CHD) is a common heart disease and a leading cause of death in developed countries and some developing countries such as China. It is recognized as a multifactorial disease, with dyslipidemia being closely associated with the progression of coronary atherosclerosis. Numerous studies have confirmed the relationship between a single indicator of low-density lipoprotein cholesterol (LDL-C) or high-density lipoprotein cholesterol (HDL-C) and CHD. However, the association between LDL-C to HDL-C ratio (LHR) and CHD remains unclear. This study aimed to comprehensively explore the association between LHR and CHD. Methods: This meta-analysis was performed according to the Preferred Reporting Items for Systematic Reviews and Meta-analyses. PubMed, Embase, Web of Science, and China National Knowledge Infrastructure databases were comprehensively searched up to June 15, 2023, to find the studies that indicated the connection between LHR and CHD. A total of 12 published studies were selected. The random-effects model was used to pool the data and mean difference (MD), and the 95% confidence intervals (CI) were taken as the overall outcome. No language restrictions existed in the study selection. The Review Manager 5.4 and Stata 12 were used to analyze the data. Results: Twelve high-quality clinical studies involving 5544 participants, including 3009 patients with CHD, were enrolled in the meta-analysis. The findings revealed that the LHR was higher by 0.65 in patients with CHD than in those without CHD (MD, 0.65; 95% CI, 0.50–0.80). Conclusion: The LHR was found to be positively correlated with CHD, suggesting that it may serve as a potential indicator of CHD.

Abstract Background Premature ovarian failure (POF) has a profound impact on female reproductive and psychological health. In recent years, the transplantation of umbilical cord-derived mesenchymal stem cells (UC-MSCs) has demonstrated unprecedented potential in the treatment of POF. However, the heterogeneity of human UC-MSCs remains a challenge for their large-scale clinical application. Therefore, it is imperative to identify specific subpopulations within UC-MSCs that possess the capability to improve ovarian function, with the aim of reducing the uncertainty arising from the heterogeneity while achieving more effective treatment of POF. Methods 10 × Genomics was performed to investigate the heterogeneity of human UC-MSCs. We used LRP1 as a marker and distinguished the potential therapeutic subpopulation by flow cytometry, and determined its secretory functions. Unsorted UC-MSCs, LRP1high and LRP1low subpopulation was transplanted under the ovarian capsules of aged mice and CTX-induced POF mice, and therapeutic effects was evaluated by assessing hormone levels, estrous cycles, follicle counts, and embryo numbers. RNA sequencing on mouse oocytes and granulosa cells after transplantation was performed to explore the mechanism of LRP1high subpopulation on mouse oocytes and granulosa cells. Results We identified three distinct functional subtypes, including mesenchymal stem cells, multilymphoid progenitor cells and trophoblasts. Additionally, we identified the LRP1high subpopulation, which improved ovarian function in aged and POF mice. We elucidated the unique secretory functions of the LRP1high subpopulation, capable of secreting various chemokines, cytokines, and growth factors. Furthermore, LRP1 plays a crucial role in regulating the ovarian microenvironment, including tissue repair and extracellular matrix remodeling. Consistent with its functions, the transcriptomes of oocytes and granulosa cells after transplantation revealed that the LRP1high subpopulation improves ovarian function by modulating the extracellular matrix of oocytes, NAD metabolism, and mitochondrial function in granulosa cells. Conclusion Through exploration of the heterogeneity of UC-MSCs, we identified the LRP1high subpopulation capable of improving ovarian function in aged and POF mice by secreting various factors and remodeling the extracellular matrix. This study provides new insights into the targeted exploration of human UC-MSCs in the precise treatment of POF. Graphical abstract

Sixteen ceanothane-type triterpenoids, including four new compounds—hovendulcisic acids A–D (1–4) —were purified from the stems of Hovenia dulcis Thunb. The structures of 1–4 were confirmed by comprehensive means including ECD and quantum chemical calculations. Putative biosynthetic pathways of 1–16 were proposed, and 3, 5, and 15 exhibited antitumor activity on A549 and MDA-MB-231 cells.

Abstract Background Good knowledge of and attitudes toward hemodialysis and its complications might be expected to promote good practices and improve adherence. This study investigated, the knowledge, attitude, and practice of patients receiving hemodialysis regarding hemodialysis and its complications. Methods This cross-sectional study enrolled patients with uremia who were receiving hemodialysis at the Second Affiliated Hospital of Nanjing Medical University (China) between January 9, 2023, and January 16, 2023. A questionnaire was designed that included the following dimensions: demographic/clinical information, knowledge, attitude, and practice. Correlations between knowledge, attitude, and practice scores were evaluated by Pearson correlation analysis. Results The analysis included 493 patients (305 males, 61.87%). The average knowledge, attitude, and practice score was 19.33 ± 7.07 (possible range, 0–31), 28.77 ± 3.58 (possible range, 8–40), and 43.57 ± 6.53 (possible range, 11–55) points, respectively. A higher knowledge score was associated with younger age (P

Objective Our objective was to investigate the concentration of plasma thrombopoietin (TPO) in patients with aplastic anemia (AA) and myelodysplastic syndrome (MDS), as well as its relationship with patients' responses to recombined human TPO (rhTPO) therapy.

Excellent irradiation resistance is the basic property of nuclear materials to keep nuclear safety. The high-entropy design has great potential to improve the irradiation resistance of the nuclear materials, which has been proven in alloys. However, whether or not high entropy can also improve the irradiation resistance of ceramics, especially the mechanism therein still needs to be uncovered. In this work, the irradiation and helium (He) behaviors of zirconium carbide (ZrC)-based high-entropy ceramics (HECs), i.e., (Zr0.2Ti0.2Nb0.2Ta0.2W0.2)C, were investigated and compared with those of ZrC under 540 keV He ion irradiation with a dose of 1×1017 cm−2 at room temperature and subsequent annealing. Both ZrC and (Zr0.2Ti0.2Nb0.2Ta0.2W0.2)C maintain lattice integrity after irradiation, while the irradiation-induced lattice expansion is smaller in (Zr0.2Ti0.2Nb0.2Ta0.2W0.2)C (0.78%) with highly thermodynamic stability than that in ZrC (0.91%). After annealing at 800 ℃, ZrC exhibits the residual 0.20% lattice expansion, while (Zr0.2Ti0.2Nb0.2Ta0.2W0.2)C shows only 0.10%. Full recovery of the lattice parameter (a) is achieved for both ceramics after annealing at 1500 ℃. In addition, the high entropy in the meantime brings about the favorable structural evolution phenomena including smaller He bubbles that are evenly distributed without abnormal coarsening or aggregation, segregation, and shorter and sparser dislocation. The excellent irradiation resistance is related to the high-entropy-induced phase stability, sluggish diffusion of defects, and stress dispersion along with the production of vacancies by valence compensation. The present study indicates a high potential of high-entropy carbides in irradiation resistance applications.

In this paper, the reliability analysis of the YRY-4 borehole component strain observation data at Dongping seismic station is carried out through the four-component self-check and the relative calibration internal accuracy analysis. The data of the two instruments are compared by combining the sliding correlation calculation and the internal accuracy of the tidal factor. It is proved that the two surface strain correlation of the YRY-4 borehole component strain is high, and the correlation coefficient is close to 1. The relative calibration internal accuracy is high, which is consistent with the overall trend of the volume strain data. The observation environment of the two instruments is consistent, and the operation is stable, the data are normal and reliable. However, there are also inconsistencies in the curves of rainfall and site interference in special periods. For the two special cases, compared by correlation calculation and S transform, the results show that, due to the large difference in drilling conditions, the correlation between the two instrument data during rainfall period is poor, close to 0. During the site interference period, the two observation systems were affected, and the interference signals appeared synchronously in the frequency domain, which affected the data curve shape and the accuracy of the tidal factor, but the strain correlation between the two instruments reached 0.91 during the interference period. Comprehensive analysis shows that the two sets of instrument observation systems of component strain and volume strain at Dongping seismic station are reliable and stable.

Fresh Lentinus edodes was extremely susceptible to a series of deterioration phenomena such as loss of water, nutrition and flavor, tissue browning, decay, umbrella opening and aging in the process of storage and transportation, due to its high water content, strong respiration and transpiration, microbial contamination, etc. The deterioration phenomenon mentioned above severely limited the development of the preservation industry of L. edodes. Therefore, this paper summarizes the causes of phenomena mentioned above, and also reviewes the preservation technologies on L. edodes, including physical preservation (low temperature preservation, modified atmosphere preservation, cold sterilization preservation), chemical preservation, biological preservation and compound preservation, etc. The research progress, principle and effects of these preservation technologies on L. edodes are also reviewed. The problems existing in the research of postharvest deterioration and preservation technology on L. edodes are summarized and the prospect is made. This review would provide references for the research direction of postharvest preservation technology and the development of green preservation products on L. edodes.

Unsatisfied electrode bonding in half-Heusler devices limits their practical service at high temperatures. Here, the authors develop a direct bonding interface to ideal ohmic contact and thermally inert and ohmic contact, leading to high deficiency.

In the published publication [...]

We established a mouse model of Schistosoma japonicum infection in order to study the effects of the infection on hepatocyte autophagy and apoptosis. We also stimulated HepG2 cells with soluble egg antigens (SEA) in vitro. At two, four, and six weeks post-infection, quantitative real-time PCR and Western blot (WB) were used to detect liver expression levels of autophagy and apoptosis-related proteins. HepG2 cells were treated with different concentrations of SEA. The changes in the levels of autophagy-related proteins and HepG2 cell apoptosis were detected. The Lc3b, Beclin1, Atg7, and Atg12 mRNA levels were significantly lower at four and six weeks after infection than those in the uninfected group. At four and six weeks following infection, the levels of Beclin1, LC3BII/I, Atg7, and p62 proteins were considerably lower than those in the uninfected group. The protein levels of pro-apoptotic Bax and cleaved caspase 3 and fibrosis-related proteins α-SMA and collagen 3 in the liver post-infection were significantly higher than those in uninfected mice. HepG2 cells stimulated with SEA showed decreased levels of Beclin1, p62, and Atg7 proteins and significantly increased apoptosis rates. The findings demonstrated that following infection with S. japonicum, mice’s liver fibrosis worsened, hepatic autophagy was suppressed, and hepatocyte apoptosis was encouraged.

Abstract The most promising candidates for energy storage capacitor application are relaxor ferroelectrics, among which, the perovskite structure ferroelectric ceramics have witnessed great development progress. However, less attention has been paid on tetragonal tungsten bronze structure (TTBS) ceramics because of their lower breakdown strength and polarization. Herein, a multiscale regulation strategy is proposed to tune the energy storage performances (ESP) of TTBS ceramics from grain, domain, and macroscopic scale. The enhanced relaxor behavior with dynamic polar nanodomains guarantees low remanent polarization, while the refined grains and enlarged bandgap ensure increased breakdown strength. Hence, excellent ESP is realized in unfilled TTBS Sr0.425La0.1□0.05Ba0.425Nb1.4Ta0.6O6 (SLBNT) ceramics with an ultrahigh recoverable energy density of 5.895 J cm−3 and a high efficiency of 85.37%. This achievement notably surpasses previous studies in TTBS ceramics and is comparable to that of perovskite components. Meanwhile, the energy density exhibits a wide temperature, frequency, and cycling fatigue stability. In addition, high power density (257.89 MW cm−3), especially the ultrafast discharge time (t0.9 = 16.4 ns) are achieved. The multiscale regulation strategy unlocks the energy storage potential of TTBS ceramics and thus highlights TTBS ceramics as promising candidates for energy storage, like perovskite structured ceramics.

Objective: Triptriolide (T11) is isolated from the Chinese herb Tripterygium wilfordii Hook F (TwHF), which has been used as an immunosuppressive reagent for many years in China, while the role of this compound in TwHF is still unknown. In this study, we try to investigate the immune regulating effects of T11 on the proliferation and apoptosis of splenic lymphocyte in vivo and in vitro. Methods: we pretreated the BALB/c mice with T11 (2.8, 14, 28 mg/kg) and prednisone acetate (PA, 1.3 mg/kg, positive control) for 7 days before lipopolysaccharides (LPS, 3 mg/kg) stimulation. Then the histopathologic change of spleen was examined by H&E method, and the apoptosis of splenic lymphocyte was assessed by flow cytometry method. In addition, we further studied the inhibition effect of T11 (50, 100, 150, 200 µg/mL) on the proliferation and activity of splenic lymphocyte, which was with or without the stimulation of concanavalin A (Con A, 5 µg/mL) and lipopolysaccharides (LPS, 5 µg/mL) in vitro, respectively. Results: We found that T11 not only can restore the pathogenesis process in spleen, and boost the splenic lymphocyte apoptosis in vivo, but also can inhibit the splenic lymphocyte proliferation and affect its viability in vitro. Conclusion: The results indicated that T11 might modulate the immune function of LPS-induced BALB/c mice by inhibiting the proliferation and inducing the apoptosis of splenic lymphocyte. Therefore, T11 could be a novel immunomodulator in autoimmune disease treatment in clinical.

Ferroelectric/antiferroelectric phase boundary is both technologically and scientifically important. Here, the authors reveal the structure of intermediate phase involved in classical Pb(Zr1-xTix)O3.

Zinc is generally considered to be one of the most promising materials to be used in biodegradable implants, and many zinc alloys have been optimized to improve implant biocompatibility, degradation, and mechanical properties. However, long-term degradation leads to the prolonged presence of degradation products, which risks foreign body reactions. Herein, we investigated the in vivo biocompatibility and degradation of a biodegradable Zn–Mg–Fe alloy osteosynthesis system in the frontal bone, mandible, and femur in beagles for 1 year. Results of the routine blood, biochemical, trace element, and histological analyses of multiple organs, peripheral blood CD4/CD8a levels, and serum interleukin 2 and 4 levels showed good biocompatibility of the Zn–Mg–Fe alloy. Zinc content analysis revealed zinc accumulation in adjacent bone tissue, but not in the liver, kidney, and spleen, which was related to the degradation of the Zn–Mg–Fe alloy. The alloy demonstrated a uniform slowing degradation rate in vivo. No degradation differences in the frontal bone, mandible, and femur were observed. The degradation products included zinc oxide [ZnO], zinc hydroxide [Zn(OH)2], hydrozincite [Zn5(OH)6(CO3)2], and hopeite [Zn3(PO4)2·4H2O]. The good biocompatibility and degradation properties of the Zn–Mg–Fe alloy render it a very attractive osteosynthesis system for clinical applications.

Although microorganisms and silicon are well documented as factors that mitigate salt stress, their effect mitigating saline-alkaline stress in plants remains unknown. In this study, wheat plant seeds were treated with silicon, Enterobacter sp. FN0603 alone and in combination of both. Wheat seeds were soaked in silicon and bacterial solutions and sown in pots containing artificial saline-alkaline soils to compare the effects among all treatments. The results showed that the treatments with silicon and FN0603 alone significantly changed plant morphology, enhanced the rhizosphere soil nutrient content and enzyme activities, improved some important antioxidant enzyme activities (e.g., superoxide dismutase) and the contents of small molecules (e.g., proline) that affected osmotic conditions in the top second leaves. However, treatment with silicon and FN0603 in combination significantly further increased these stress tolerance indexes and eventually promoted the plant growth dramatically compared to the treatments with silicon or FN0603 alone (p

Background: Cervical cancer (CC) is a serious threat to women populations worldwide. Lipid metabolism is believed to have modulating functions in cancer. Long non-coding RNAs (lncRNAs) are potential biomarkers for the different tumor prognosis. Our work aims at investigating the prognostic value of lipid metabolism-related lncRNAs in CC.Methods: LncRNA expression profiling was conducted in 291 patients from The Cancer Genome Atlas (TCGA). Patient samples were randomly assigned to the training or testing set in a 3:2 ratio. A novel lipid metabolism-related five-lncRNA signature with prognostic value for CC was built through the univariate Cox regression, least absolute contraction and selection operator (LASSO) regression and multivariate Cox regression analyses, and was further evaluated by the Kaplan-Meier methods. Relevant analyses were also applied to identify the independent clinicopathological factors. GO and KEGG analyses were conducted to investigate the biological functions and molecular pathways. Immune infiltration analysis was included to probe the relationship between lncRNA signature and cancer cell microenvironment.Results: The novel lipid metabolism-related five-lncRNA signature was confirmed to be predictive of overall survival (OS) in CC patients. Risk score, cancer stage, pregnancy, and BMI were validated as independent factors with prognostic value. GO and KEGG indicated that lipid metabolism participated in several tumor associated functions and pathways. Moreover, our results suggested that the five-lncRNA expression has potential link with tumor immune microenvironment.Conclusion: In conclusion, we built an innovative prognostic risk signature based upon lipid metabolism-related lncRNAs. The five-lncRNA signature may be beneficial to provide novel potential therapeutic targets and improve personalized treatment strategies for CC patients in future clinical treatments.

Spinosin, a natural flavone-C-glycoside that is mainly isolated from the seeds of Ziziphus jujuba Mill. var. spinosa. It exerts the effects to ameliorate the neurological disorders, such as hypnosis effects, improvement of cognitive function, sedation effects, and anxiolytic effects, as well as anti-melanogenic effect, cardioprotective effects, and anti-cancer activity. However, the insufficient basic research, unclear mechanisms, and poor bioavailability may limit the prospects of spinosin in clinical utilization. In this review, we comprehensively summarized the latest information on the pharmacology, pharmacokinetics, toxicity, and NMR characteristic of spinosin, to evaluate its potential therapeutic for clinical application, hoping to provide some rational perspective for the innovative agent development and usage of spinosin in future.

Cervical cancer (CC) is a malignancy that tends to have a poor prognosis when detected at an advanced stage; however, there are few studies on the early detection of CC at the genetic level. The tumor microenvironment (TME) and genomic instability (GI) greatly affect the survival of tumor patients via effects on carcinogenesis, tumor growth, and resistance. It is necessary to identify biomarkers simultaneously correlated with components of the TME and with GI, as these could predict the survival of patients and the efficacy of immunotherapy. In this study, we extracted somatic mutational data and transcriptome information of CC cases from The Cancer Genome Atlas, and the GSE44001 dataset from the Gene Expression Omnibus database was downloaded for external verification. Stromal components differed most between genomic unstable and genomic stable groups. Differentially expressed genes were screened out on the basis of GI and StromalScore, using somatic mutation information and ESTIMATE methods. We obtained the intersection of GI- and StromalScore-related genes and used them to establish a four-gene signature comprising RIPOR2, CCL22, PAMR1, and FBN1 for prognostic prediction. We described immunogenomic characteristics using this risk model, with methods including CIBERSORT, gene set enrichment analysis (GSEA), and single-sample GSEA. We further explored the protective factor RIPOR2, which has a close relationship with ImmuneScore. A series of in vitro experiments, including immunohistochemistry, immunofluorescence, quantitative reverse transcription PCR, transwell assay, CCK8 assay, EdU assay, cell cycle detection, colony formation assay, and Western blotting were performed to validate RIPOR2 as an anti-tumor signature. Combined with integrative bioinformatic analyses, these experiments showed a strong relationship between RIPOR2 with tumor mutation burden, expression of genes related to DNA damage response (especially PARP1), TME-related scores, activation of immune checkpoint activation, and efficacy of immunotherapy. To summarize, RIPOR2 was successfully identified through comprehensive analyses of the TME and GI as a potential biomarker for forecasting the prognosis and immunotherapy response, which could guide clinical strategies for the treatment of CC patients.

This paper explores some measures for tunnel moistureproof by analyzing the causes of moisture in tunnels and the failures of instruments，circuits，and power supply systems due to high moisture content. These measures include waterproofing work of tunnel，the use of dehumidifier and desiccant，the daily maintenance and so on，so as to ensure the normal operation of instruments，extend the life of instruments，and reduce the failure rate.

The large family PbZrO3-based solid solutions are usually considered as antiferroelectric materials with specific antiparallel polarization configuration. Here, the authors demonstrate the PbZrO3-based material has ferrielectric dipoles ordering and configure a clear structure-property relationship.

Background: Nerve sheath myxoma is a rare benign soft tissue tumor. Intraspinal nerve sheath myxomas are rare. Only 8 cases of intraspinal nerve sheath myxoma have been reported to date, and no case of nerve sheath myxoma has been reported in the cervical spinal canal. Herein, we reported the first case of intradural extramedullary nerve sheath myxoma in the cervical spinal canal of a 57-year-old man, including its complete clinical course and radiological findings.Case Presentation: A 57-year-old male patient presented with numbness in his left finger without any obvious inducement for 3 years. CT and contrast-enhanced magnetic resonance imaging (MRI) of the spine were performed. Based on the radiological examinations, a diagnosis of schwannoma was initially made. However, nerve sheath myxoma was finally confirmed by histopathological and immunohistochemical examinations. Complete tumor excision at the C1-2 level was performed. Then, the patient recovered well, and the numbness of his left finger disappeared during the later follow-up after the surgery.Conclusion: Nerve sheath myxoma should receive diagnostic consideration for an extramedullary subdural lesion that is a clear boundary mass characterized by isointensity on T1-weighted images, heterogeneous intensity on T2-weighted images, obvious peripheral enhancement, and a growing tendency toward the intervertebral foramen.

In medical texts, temporal information describes events and changes in status, such as medical visits and discharges. According to the semantic features, it is classified into simple time and complex time. The current research on time recognition usually focuses on coarse-grained simple time recognition while ignoring fine-grained complex time. To address this problem, based on the semantic concept of complex time in Clinical Time Ontology, we define seven basic features and eleven extraction rules and propose a complex medical time-extraction method. It combines probabilistic soft logic and textual feature feedback. The framework consists of two parts: (a) text feature recognition based on probabilistic soft logic, which is based on probabilistic soft logic for negative feedback adjustment; (b) complex medical time entity recognition based on text feature feedback, which is based on the text feature recognition model in (a) for positive feedback adjustment. Finally, the effectiveness of our approach is verified in text feature recognition and complex temporal entity recognition experimentally. In the text feature recognition task, our method shows the best F1 improvement of 18.09% on the Irregular Instant Collection type corresponding to utterance l17. In the complex medical temporal entity recognition task, the F1 metric improves the most significantly, by 10.42%, on the Irregular Instant Collection type.

Creativity plays a very crucial impact on our cultural life and has also been important to the improvement of human civilization. Numerous studies have indicated that family circumstance plays an important role in the development of individual creativity. However, little is known about the mediating mechanisms underlying the association between childhood maltreatment and creativity. This study intended to explore the serial multiple mediation model in which undergraduates’ cognitive flexibility and self-efficacy were proposed to mediate the potential influence of childhood maltreatment on their creativity. Participants were 1069 undergraduates (573 males and 496 females, mean age was 20.57 ± 1.24 years ranging from 17 to 24) from a university in Shandong Province, China. Participants were required to complete an internet survey including the Short Form of Childhood Trauma Questionnaire (CTQ-SF), General Self-Efficacy Scale (GSES), Cognitive Flexibility Inventory (CFI), and Williams Creativity Aptitude Test (WCAT). Serial multiple mediation analysis and the bootstrap method were used to investigate the mediation effects of cognitive flexibility and self-efficacy. The results showed that childhood maltreatment indirectly influenced undergraduates’ creativity through three indirect paths: childhood maltreatment→cognitive flexibility→creativity, childhood maltreatment→self-efficacy→creativity, and childhood maltreatment→cognitive flexibility→self-efficacy→creativity. The ratios of the total indirect effects and branch-indirect effects to the total effects were 92.73%, 34.61%, 35.68%, and 22.44%, respectively. These results indicated that cognitive flexibility and self-efficacy could completely mediate the potential impact of childhood maltreatment on individuals creativity.

Entity and relation linking are the core tasks in knowledge base question answering (KBQA). They connect natural language questions with triples in the knowledge base. In most studies, researchers perform these two tasks independently, which ignores the interplay between the entity and relation linking. To address the above problems, some researchers have proposed a framework for joint entity and relation linking based on feature joint and multi-attention. In this paper, based on their method, we offer a candidate set generation expansion model to improve the coverage of correct candidate words and to ensure that the correct disambiguation objects exist in the candidate list as much as possible. Our framework first uses the initial relation candidate set to obtain the entity nodes in the knowledge graph related to this relation. Second, the filtering rule filters out the less-relevant entity candidates to obtain the expanded entity candidate set. Third, the relation nodes directly connected to the nodes in the expanded entity candidate set are added to the initial relation candidate set. Finally, a ranking algorithm filters out the less-relevant relation candidates to obtain the expanded relation candidate set. An empirical study shows that this model improves the recall and correctness of the entity and relation linking for KBQA. The candidate set expansion method based on entity–relation interaction proposed in this paper is highly portable and scalable. The method in this paper considers the connections between question subgraphs in knowledge graphs and provides new ideas for the candidate set expansion.

Ovarian cancer (OC) is one of the most malignant tumors whose mortality rate ranks first in gynecological tumors. Although immunotherapy sheds new light on clinical treatments, the low response still restricts its clinical use because of the unique characteristics of OC such as immunosuppressive microenvironment and unstable genomes. Further exploration on determining an efficient biomarker to predict the immunotherapy response of OC patients is of vital importance. In this study, integrative analyses were performed systematically using transcriptome profiles and somatic mutation data from The Cancer Genome Atlas (TCGA) based on the immune microenvironment and genomic instability of OC patients. Firstly, intersection analysis was conducted to identify immune-related differentially expressed genes (DEGs) and genomic instability-related DEGs. Secondly, Apolipoprotein B MRNA Editing Enzyme Catalytic Subunit 3A (APOBEC3A) was recognized as a protective factor for OC, which was also verified through basic experiments such as quantitative reverse transcription PCR (RT-qPCR), immunohistochemistry (IHC), Cell Counting Kit-8 (CCK-8), and transwell assays. Thirdly, the correlation analyses of APOBEC3A expression with tumor-infiltrating immune cells (TICs), inhibitory checkpoint molecules (ICPs), Immunophenoscores (IPS), and response to anti-PD-L1 immunotherapy were further applied along with single-sample GSEA (ssGSEA), demonstrating APOBEC3A as a promising biomarker to forecast the immunotherapy response of OC patients. Last, the relationship between APOBEC3A expression with tumor mutation burden (TMB), DNA damage response (DDR) genes, and m6A-related regulators was also analyzed along with the experimental verification of immunofluorescence (IF) and RT-qPCR, comprehensively confirming the intimate association of APOBEC3A with genomic instability in OC. In conclusion, APOBEC3A was identified as a protective signature and a promising prognostic biomarker for forecasting the survival and immunotherapy effect of OC patients, which might accelerate the clinical application and improve immunotherapy effect.

Venom-induced thrombocytopenia (VIT) is one of the most important hemotoxic effects of a snakebite, which is often associated with venom-induced consumptive coagulopathy (VICC). Refractory thrombocytopenia without significant coagulation abnormalities has also been reported after envenomation by some viperid snakes; however, the mechanisms are not well understood and therapeutic strategies are lacking. Here, we found that patients injured by Daboia siamensis or Agkistrodon halys snakes, who were resistant to standard antivenom treatment, had developed coagulopathy-independent thrombocytopenia. Venoms from these viperid snakes, rather than from the elapid snake (Bungarus multicinctus), induced platelet surface expression of neuraminidase-1 (NEU-1), and significantly increased the desialylation of the glycoproteins on human platelets. The desialylated platelets caused by viperid snake venoms were further internalized by macrophages, which resulted in reduced platelet numbers in peripheral blood. Importantly, neuraminidase inhibitor significantly decreased viper venom-induced platelet desialylation, therefore inhibiting platelet phagocytosis by macrophages, and alleviating venom-induced thrombocytopenia. Collectively, these findings support an important role for desialylated platelet clearance in the progression of viper envenomation-induced, coagulopathy-independent thrombocytopenia. Our study demonstrates that the neuraminidase inhibitor may be a potential therapy or adjuvant therapy to treat snakebite-induced thrombocytopenia.

In spite of extensive successes, cancer recurrence after radiation treatment (RT) remains one of the significant challenges in the cure of localized prostate cancer (PCa). This study focuses on elucidating a novel adaptive response to RT that could contribute to cancer recurrence. Here, we used PC3 cell line, an adenocarcinoma from a bone metastasis and radio-resistant clone 695 cell line, which survived after total radiation dose of 66 Gy (2 Gy × 33) and subsequently regrew in nude mice after exposure to fractionated radiation at 10 Gy (2 Gy × 5). Clone 695 cells not only showed an increase in surviving fraction post-radiation but also an increase in hydrogen peroxide (H2O2) production when compared to PC3 cells. At the single cell level, confocal microscope images coupled with IMARIS rendering software demonstrate an increase in mitochondrial mass and membrane potential in clone 695 cells. Utilizing the Seahorse XF96 instrument to investigate mitochondrial respiration, clone 695 cells demonstrated a higher basal Oxygen Consumption Rate (OCR), ATP-linked OCR, and proton leak compared to PC3 cells. The elevation of mitochondrial function in clone 695 cells is accompanied by an increase in mitochondrial H2O2 production. These data suggest that H2O2 could reprogram PCa’s mitochondrial homeostasis, which allows the cancer to survive and regrow after RT. Upon exposure to RT, in addition to ROS production, we found that RT induces the release of extracellular vesicles (EVs) from PC3 cells (p < 0.05). Importantly, adding H2O2 to PC3 cells promotes EVs production in a dose-dependent manner and pre-treatment with polyethylene glycol-Catalase mitigates H2O2-mediated EV production. Both RT-derived EVs and H2O2-derived EVs carried higher levels of mitochondrial antioxidant proteins including, Peroxiredoxin 3, Glutathione Peroxidase 4 as well as mitochondrial-associated oxidative phosphorylation proteins. Significantly, adding isolated functional mitochondria 24 h prior to RT shows a significant increase in surviving fractions of PC3 cells (p < 0.05). Together, our findings reveal that H2O2 promotes the production of EVs carrying mitochondrial proteins and that functional mitochondria enhance cancer survival after RT.

Background: Radiation-induced brain injury is a serious and treatment-limiting complication of brain radiation therapy. Although endothelial cell dysfunction plays a critical role in the development of this pathogenesis, the underlying molecular mechanisms remain elusive.Methods: Primary cultured rat brain microvascular endothelial cells (BMECs) were divided into five groups without or with exposure of x-rays delivered at 5 Gy or 20 Gy. For the irradiated groups, cells were continued to cultivate for 12 or 24 h after being irradiated. Then the mRNA libraries of each group were established and applied for next-generation sequencing. Gene ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were conducted to analyze the sequencing results. Quantitative polymerase chain reaction, western blotting, cck8 assay and intracellular calcium concentration assays were conducted to analyze the role of Orai2-associated SOCE in x-ray induced cellular injury.Results: In total, 3,005 transcripts in all the four x-ray–exposed groups of BMECs showed expression level changes compared with controls. With the dose of x-ray augment and the following cultured time extension, the numbers of differentially expressed genes (DEGs) increased significantly in BMECs. Venn diagrams identified 40 DEGs common to all four exposure groups. Functional pathway enrichment analyses indicated that those 40 DEGs were enriched in the calcium signaling pathway. Among those 40 DEGs, mRNA and protein expression levels of Orai2 were significantly upregulated for 24 h. Similarly, calcium influx via store-operated calcium entry, which is modulated by Orai2, was also significantly increased for 24 h in x-ray–exposed BMECs. Moreover, the change in SOCE was suppressed by btp-2, which is a non-selective inhibitor of Orai. Additionally, x-ray exposure induced a significant decrease of proliferation in BMECs in the dose- and time-dependent manner.Conclusion: These findings provide evidence for molecular mechanisms underlying BMECs dysfunction in development of radiation-induced brain injury and suggest new approaches for therapeutic targets.

Five novel triterpenoid saponins, hovenidulciosides C−G (1–5), and one known saponin hovenidulcioside A1 (6) were isolated from the seeds of Hovenia dulcis Thunb. The structures of 1–5 were determined through spectroscopic methods such as HR-ESI-MS, 2D-NMR (1H–1H COSY, HSQC, HMBC, ROESY and TOCSY), UV and IR and chemical methods. There were amino acetylated substituent in the sugar resident of hovenidulciosides F−G, which were firstly reported from this genus. Compound 1 supressed ARE-luciferase activity in MDA-MB-231 cells and inhibited the Nrf2 protein levels in A549 cells.

Previous research about organizational citizenship behavior (OCB) and counterproductive work behavior (CWB) has produced contradictory results. Drawing from the conservation of resources (COR) theory, the present study tries to explain the contradictory findings by examining the curvilinear relationship between OCB and CWB. Using data collected at three time points from 426 employees and 110 supervisors in Chinese companies, data analysis shows that OCB has an inverted U-shaped relationship with CWB. The results also demonstrate that citizenship fatigue mediates the relationship between OCB and CWB, perceived organizational support (POS) moderates the relationship between OCB and citizenship fatigue. In addition, POS moderates the mediating effect of citizenship fatigue in the inverted U-shaped curvilinear relationship between OCB and CWB. This mediating effect is stronger under conditions of low POS than high POS. The findings present a complementary explanation of the conflicting relationships between OCB and CWB.

Abstract Background The present study involves diversity and biological activities of the endophytic fungal community from Distylium chinense, a rare waterlogging tolerant plant endemic to the Three Gorges Reservoir. This study has been conducted hypothesizing that the microbial communities in the TGR area would contribute to the host plant tolerating a range of abiotic stress such as summer flooding, infertility, drought, salinity and soil erosion etc., and they may produce new metabolites, which may possess plentiful bioactive property, especially antioxidant activity. Therefore in the current study, the antioxidant, antimicrobial and anticancer activities of 154 endophytes recovered from D. chinense have been investigated. Furthermore, the active metabolites of the most broad-spectrum bioactive strain have also been studied. Results A total of 154 fungal endophytes were isolated from roots and stems. They were categorized into 30 morphotypes based on cultural characteristics and were affiliated with 27 different taxa. Among these, the most abundant fungal orders included Diaporthales (34.4%) and Botryosphaeriales (30.5%), which were predominantly represented by the species Phomopsis sp. (24.7%) and Neofusicoccum parvum (23.4%). Fermentation extracts were evaluated, screening for antioxidant, antimicrobial and anticancer activities. Among the 154 isolates tested, 99 (64.3%) displayed significant antioxidant activity, 153 (99.4%) exhibited inclusive antimicrobial activity against at least one tested microorganism and 27 (17.5%) showed exclusive anticancer activity against one or more cancer cell lines. Specifically, the crude extract of Irpex lacteus DR10–1 exhibited note-worthy bioactivities. Further chemical investigation on DR10–1 strain resulted in the isolation and identification of two known bioactive metabolites, indole-3-carboxylic acid (1) and indole-3-carboxaldehyde (2), indicating their potential roles in plant growth promotion and human medicinal value. Conclusion These results indicated that diverse endophytic fungal population inhabits D. chinense. One of the fungal isolate DR10–1 (Irpex lacteus) exhibited significant antioxidant, antimicrobial and anticancer potential. Further, its active secondary metabolites 1 and 2 also showed antioxidant, antimicrobial and anticancer potential.

Abstract Background Concentrated growth factor (CGF), as a natural biomaterial, is known to contain platelets, cytokines, and growth factors to facilitate the healing process, but there has been little information acquired in regenerative endodontics. The purpose of this study was to investigate the effects of CGF on proliferation, migration, and differentiation in human dental stem pulp cells (hDPSCs) exposed to lipopolysaccharide (LPS) in vitro and its potential role in pulp regeneration of the immature teeth in vivo. Methods In vitro experiments: CGF-conditioned medium were extracted by freeze-dried method. hDPSCs were isolated and identified. The proliferative potential of hDPSCs with different concentration of CGF and LPS was evaluated by Cell Counting Kit-8. Migration capacity was analyzed by Transwell assays, odonto/osteoblastic differentiation was determined by measuring alkaline phosphatase (ALP) activity using ALP staining, and the extent of mineralization was evaluated by using Alizarin red S staining. The mRNA expression level of DMP-1, DSPP, OPN, Runx2, and OCN were determined by quantitative polymerase chain reaction (qPCR). In vivo experiments: CGF were used as root canal filling agent of the immature single-rooted teeth in the beagle dogs. The teeth were then radiographed, extracted, fixed, demineralized, and subjected to histologic analyses at 8 weeks. The newly formed dentine-pulp complex and the development of apical foramen were evaluated by the hematoxylin-eosin (HE) and Masson trichrome technique. Soft tissues were analyzed by immunohistochemical staining of vascular endothelial growth factor (VEGF) and Nestin. Results In vitro experiments: The cultured cells exhibited the characteristics of mesenchymal stem cell. The treatment of LPS significantly increased the expression of TNF-α, IL-1β, IL-6, and IL-8 in hDPSCs, and CGF inhibited the mRNA expression of IL-8 in LPS-stimulated hDPSCs. The proliferation values of the CGF group in LPS-stimulated hDPSCs were significantly higher than that of the control group from day 3 to day 7 (P

The cross-talk between tumor cells and the tumor microenvironment (TME) is an important factor in determining the tumorigenesis and progression of cervical cancer (CC). However, clarifying the potential mechanisms which trigger the above biological processes remains a challenge. The present study focused on immune-relevant differences at the transcriptome and somatic mutation levels through an integrative multi-omics analysis based on The Cancer Genome Atlas database. The objective of the study was to recognize the specific immune-related prognostic factors predicting the survival and response to immunotherapy of patients with CC. Firstly, eight hub immune-related prognostic genes were ultimately identified through construction of a protein–protein interaction network and Cox regression analysis. Secondly, 32 differentially mutated genes were simultaneously identified based on the different levels of immune infiltration. As a result, an immune gene-related prognostic model (IGRPM), including six factors (chemokine receptor 7 [CCR7], CD3d molecule [CD3D], CD3e molecule [CD3E], and integrin subunit beta 2 [ITGB2], family with sequence similarity 133 member A [FAM133A], and tumor protein p53 [TP53]), was finally constructed to forecast clinical outcomes of CC. Its predictive capability was further assessed and validated using the Gene Expression Omnibus validation set. In conclusion, IGRPM may be a promising prognostic signature to predict the prognoses and responses to immunotherapy of patients with CC. Moreover, the multi-omics study showed that IGRPM could be a novel therapeutic target for CC, which is a promising biomarker for indicating the immune-dominant status of the TME and revealing the potential mechanisms responsible for the tumorigenesis and progression of CC.

Tumor microenvironment (TME) is emerging as an essential part of cervical cancer (CC) tumorigenesis and development, becoming a hotspot of research these years. However, comprehending the specific composition of TME is still facing enormous challenges, especially the immune and stromal components. In this study, we downloaded the RNA-seq profiles and somatic mutation data of 309 CC cases from The Cancer Genome Atlas (TCGA) database, which were analyzed by integrative bioinformatical methods. Initially, ESTIMATE computational method was employed to calculate the amount of immune and stromal components. Then, based on the high- and low-immunity cohorts, we recognized the differentially expressed genes (DEGs) as well as the differentially mutated genes (DMGs). Additionally, we conducted an intersection analysis of DEGs and DMGs, ultimately determining an immune-related prognostic signature, GTPase, IMAP Family Member 4 (GIMAP4). Moreover, sequential analyses demonstrated that GIMAP4 was a protective factor in CC, positively correlated with the overall survival (OS) and negatively with distant metastasis. Besides, we utilized the Gene Set Enrichment Analysis (GSEA) to explore the enrichment-pathways in high and low-expression cohorts of GIMAP4. The results indicated that the genes of the high-expression cohort had a high enrichment in immune-related biological processes and metabolic activities in the low one. Furthermore, CIBERSORT analysis was applied to evaluate the proportion of tumor-infiltrating immune cells (TICs), illustrating that several activated TICs were strongly associated with GIMAP4 expression, which suggested that GIMAP4 had the potential to be an indicator for the immune state in TME of CC. Hence, GIMAP4 contributed to predicting the CC patients’ clinical outcomes, such as survival rate, distant metastasis and immunotherapy response. Moreover, GIMAP4 could serve as a promising biomarker for TME remodeling, suggesting the possible underlying mechanisms of tumorigenesis and CC progression, which may provide different therapeutic perceptions of CC, and therefore improve treatment.

The unstable combustion problem in small-sized solid rocket engines with a large aspect ratio is so complicated that its causes remain unclear. In this study, the coupled vibration between the sound field and shell in the engines was proposed as a possible cause. A solid rocket engine structure was abstracted into a multilayer thin-walled cylindrical cavity in this study, followed by the theoretical calculation and simulation calculation of its inherent frequency. Next, a thin-walled cylindrical cavity fluid-solid coupling experimental platform with the function of modal measurement was established to verify the accuracy of simulated modes for the shell structure and acoustic cavity. Then, the mode of the finite element model (FEM) for the solid rocket engine was theoretically calculated and simulated, accompanied by finite element calculation and experiment of the acoustic mode of the internal acoustic cavity. Subsequently, the engine mode was compared with the acoustic mode of the internal acoustic cavity. On this basis, a new cause for the damage and disintegration of the solid rocket engines in the final working stage was revealed. Moreover, a brand-new idea of inhibiting the pressure oscillation-induced unstable combustion in the solid rocket engines was put forward.

Parabambusicolaceae is a well-studied family in Massarineae, Pleosporales, comprising nine genera and approximately 16 species. The family was introduced to accommodate saprobic bambusicola-like species in both freshwater and terrestrial environments that mostly occur on bamboos and grasses but are also found on different host substrates. In the present study, we surveyed and collected ascomycetes from bamboo and submerged grass across Yunnan Province, China. A biphasic approach based on morphological characteristics and multigene phylogeny demonstrated five new taxa in Parabambusicolaceae. A novel genus Scolecohyalosporium is introduced as a monotypic genus to accommodate S. submersum sp. nov., collected from dead culms of grass submerged in a freshwater stream. The genus is unique in forming filiform ascospores, which differ from other known genera in Parabambusicolaceae. Multigene phylogeny showed that the genus has a close relationship with Multiseptospora. Moreover, the novel monotypic genus Neomultiseptospora, isolated from bamboo, was introduced to accommodate N. yunnanensis sp. nov. Neomultiseptospora yunnanensis formed a separated branch basal to Scolecohyalosporium submersum and Multiseptospora thailandica with high support (100% ML, 1.00 PP). Furthermore, the newly introduced species, Parabambusicola hongheensis sp. nov. was also isolated from bamboo in terrestrial habitats. Parabambusicola hongheensis clustered with the other three described Parabambusicola species and has a close relationship with P. bambusina with significant support (88% ML, 1.00 PP). Parabambusicola hongheensis was reported as the fourth species in this genus. Detailed description, illustration, and updated phylogeny of Parabambusicolaceae were provided.

Abstract Background Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. Results For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. Conclusions SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.

In this note we establish certain weighted estimates for a class of maximal functions with rough kernels along “polynomial curves” on Rn. As applications, we obtain the bounds of the above operators on the mixed radial-angular spaces, on the vector-valued mixed radial-angular spaces, and on the vector-valued function spaces. Particularly, the above bounds are independent of the coefficients of the polynomials in the definition of the operators.

The objective of this study was to improve the stability and water-solubility of patchouli alcohol by complexing with β-cyclodextrin (β-CD). The interactions between patchouli alcohol and β-CD were characterized by differential scanning calorimetry (DSC), Fourier transformation-infrared (FT-IR) spectroscopy, powder X-ray diffraction (PXRD), and Scanning electron microscope (SEM), respectively. According to molecular modeling method, the enthalpy formation of host-guest illustrated the predominant configuration and the lowest value ΔbGo was -10.8174±1.9235 kcal/mol, suggesting the complex could reduce the energy of the system. The characterization analysis confirmed the formation of PA-CD inclusion complex, and the results indicated the advantage of the inclusion complex in stability and dissolution rates. These results identified PA-CD inclusion complex an effective way for the storage of PA, and better inclusion method still needed to be studied.